FR2892730A1 - Detecting the presence/risk of cancer development in a mammal, comprises detecting the presence/absence or (relative) quantity e.g. of nucleic acids and/or polypeptides coded by the nucleic acids, which indicates the presence/risk - Google Patents

Abstract

Detecting the presence/risk of cancer development in a mammal, comprises detecting nucleic acids (I) comprising one of (SEQ ID No. 23, 52, 53, 148 and 225) or a distinctive fragment having at least 15, preferably 16, 17, 18, 19, 20, 25 or 30 consecutive bases, nucleic acids (II) having a complementary sequence of (I), functional analogs (III) of (I) or (II) from an another species and/or polypeptides coded by (I)-(III), in a sample, where the presence/absence or (relative) quantity of the target molecules indicates the presence/risk of cancer development. Detecting the presence/risk of cancer development in a mammal, comprises detection of the nucleic acids (I) comprising one of 5 fully defined 30-102 amino acid sequences (SEQ ID No. 23, 52, 53, 148 and 225) (PANEL 11) given in the table 1 of the specification or a distinctive fragment of those having at least 15, preferably 16, 17, 18, 19, 20, 25 or 30 consecutive bases, the nucleic acids (II) having a complementary sequence of (I), the functional analogs (III) of (I) or (II) from an another species and/or the polypeptides coded by (I)-(III), in a biological sample of the mammal, where the presence, absence or (relative) quantity of the target molecules in the sample being an indication of the presence or risk of cancer development in mammal. Independent claims are included for: (1) an in vitro or ex vivo detection of the presence/risk of cancer development in a mammal, comprising the determination of the presence/absence of an alteration in a gene or RNA e.g. receptors, adapters, enzymes, factors involved in gene expression regulation, chemokines, cytokines or interleukines, i.e. the gene or RNA involved in the stimulation of toll-like receptors, secretion of cytokines or activation of T lymphocytes, in a biological sample of the mammal, preferably in a blood (derivative) sample, where the presence of such alteration indicates presence/risk of cancer development in mammal; (2) the use of a specific nucleic probe of target nucleic acids, comprising of 15-400 bases, for the in vitro detection of human cancer; (3) the use of a nucleic starter allowing the amplification of total or part of a target nucleic acid, being simple-strand, with a length range of 5-50 bases, for in vitro detection of human cancer; (4) a product comprising a support on which at least two probes are immobilized of distinct nucleic acids comprising a complementary and/or specific sequence from at least two distinct target nucleic acids comprising at least two sequences comprising one of 437 fully defined 30-500 amino acid sequences (SEQ ID No. 1-437) given in the specification or at least a gene or RNA indicated in the table 5 or 6, of the specification; and (5) a product comprising a support on which at least a set of two distinct nucleic acid probes comprising a complementary sequence and/or specific nucleic acids of the panels 1-11, are immobilized.

Description

Method of detecting cancer

  The present application relates to methods and compositions useful for the detection of cancer in mammals, particularly humans. In particular, it describes serum markers of cancers and their uses in diagnostic methods. It also relates to tools and / or kits that can be used to implement these methods (reagents, probes, primers, antibodies, chips, cells, etc.), their preparation and their uses. The invention is useful for detecting the presence or the evolution of a cancer in mammals, in particular breast cancer, including in the early phase.

  In women, breast cancer is the leading cause of cancer death in industrialized countries. Age is the most important risk factor. Thus, the risk increases by 0.5% per year of age in Western countries. Other risk factors are known such as the number of pregnancies and the age of first pregnancy, breastfeeding, the age of puberty and menopause, estrogenic treatments after the onset of menopause, stress and nutrition.

  The diagnosis of breast cancer is usually done by mammography. However, it is estimated that the minimum size of a mammogram-detectable tumor is 1 cm, which has an evolutionary history of 8 years on average during diagnosis. Small tumors are much less malignant than can be extrapolated from their sizes: the aggressiveness of large tumors does not only come from their size, but also from their inherent aggression, which increases with a tumor (Bucchi et al., Br J Cancer 2005, 156-161; Norden T, Eur J Cancer 1997, pp. 624-628).

  The benefit of mammography has been demonstrated in hundreds of thousands of patients over the last 30 years. However, biases exist in these tests, such as dependence on Page sensitivity, hormone intake, number of mammograms performed, physician experience, and others (see Fletcher and Elmore, NEJM 2003, p. 1672f or Baines CJ, Breast J 2005, S7-10).

  The analysis of the expression of a panel of target genes is also relevant in the fight against breast cancer, and we can notably cite the analysis of a panel of 176 genes that are expressed differentially between patients. expressing the ER receptor and patients not expressing the ER receptor (Bertucci et al, Human Molecular Genetics, 2000; 9: 2981-2991). One can also cite the analysis of a panel of 37 genes which makes it possible to diagnose breast cancer in an early manner (Sharma et al., Breast Cancer Research 2005, 7: R634-R644). However, the patients included in this study all had suspicions of breast disease (suspected initial mammogram), and this array of genes might be poorly suited for a routine breast cancer diagnostic test prior to any mammogram.

  There is therefore a great need for diagnostic tools and tests that can detect cancer reliably, easily and at an early stage.

  The present application provides a set of biological markers that can be used, alone or in combination, preferably in combination, to reliably detect, characterize or track the presence or evolution of a cancer in a mammal, preferably breast cancer. The invention is particularly advantageous insofar as it can be carried out from whole blood, without requiring tissue biopsy or separation steps.

  More particularly, the present application results from the identification of serum genetic markers characteristic of human patients with breast cancer. These markers correspond for example to variations in splicing or gene expression levels, and may allow, alone or, advantageously, in combination, to detect in patients the presence or stage of evolution of a cancer. They advantageously make it possible to detect the presence of a breast cancer, in the early phases of it (that is to say, in particular at a stage where a mammogram would be ineffective), in a reliable and simple manner, from a sample of whole blood.

  An object of the present application relates to a method for detecting (in vitro or ex vivo) the presence or risk of developing cancer in a mammal, including determining the presence (or absence or amount of (relative) ), in a biological sample of the mammal, one, preferably several target molecules selected from: a) nucleic acids comprising a sequence selected from SEQ ID NOs: 1- 318 or a distinctive fragment thereof having at least 15 preferably at least 16, 17, 18, 19, 20, 25 or 30 consecutive bases, b) the nucleic acids having a sequence complementary to a sequence according to a), c) the functional analogues of nucleic acids according to a) or b), or d) the polypeptides encoded by the nucleic acids according to a) to c), the presence (or absence or (relative) amount) of such target molecules in the sample being indicative of the presence or of the risk of developing cancer at this mammal.

  In a particular variant embodiment, the method comprises the combined determination of the presence or absence or (relative) amount of at least 5, 10, 15, 20, 30, 40, 50, 60, 70 or more of the molecules. targets as defined above. The "combined" determination refers to the fact that a hybridization profile (or signature) involving multiple markers is determined. The combined determination is typically performed simultaneously, i.e., by overall measurement of an expression profile. Nevertheless, the combined determination can also be performed by parallel or sequential measurements of several markers, leading to the identification of a profile. The invention makes it possible to establish and determine a hybridization profile (or a signature) on a set of markers, in order to evaluate the presence or risk of developing cancer in a mammal. The hybridization profile is typically performed using a combination of several markers selected by the targets indicated above, for example containing all of these targets.

  In a particular embodiment, the method of the invention comprises determining the presence (or the absence or the (relative) amount) of at least 10 target molecules in a biological sample of the mammal. distinct from those defined above.

  In preferred embodiments, the method of the invention comprises the combined determination of the presence (or absence or (relative) amount), in a biological sample of the mammal, of particular subsets of target molecules selected from those defined above. Such subsets, described in the examples, are particularly suitable for the detection, particularly in the early phase, of the presence of breast cancer in patients from a whole blood sample.

  Thus, in a particular embodiment, the method of the invention comprises the combined determination of the presence (or the absence or the (relative) amount), in a biological sample of the mammal, of nucleic acids comprising the sequences shown in SEQ ID NOs: 18, 19, 23, 26, 51, 52, 53, 54, 55, 69, 80, 125, 145, 148, 225, 228, 240, and 312, or a distinctive fragment thereof. having at least 15, preferably at least 16, 17, 18, 19, 20, 25 or 30 consecutive bases, or having a sequence complementary thereto and / or functional analogues thereof from other species and / or polypeptides encoded by these nucleic acids. The examples provided in the present application indeed show that this panel of markers makes it possible to predictively detect the presence, the risk of developing or the stage of evolution of a cancer. In a particular embodiment, the method further comprises the detection of one or more of the other target molecules as defined above.

  In another particular embodiment, the method of the invention comprises the combined determination of the presence (or the absence or the (relative) amount), in a biological sample of the mammal, of the nucleic acids comprising the Sequences represented in SEQ ID NOs: 18, 19, 23, 26, 27, 51, 52, 53, 54, 55, 69, 80, 125, 145, 148, 161, 188, 225, 228, 240, 280 and 312 or a distinctive fragment thereof having at least 15, preferably at least 16, 17, 18, 19, 20, 25 or 30 consecutive bases, or having a sequence complementary thereto and / or functional analogues thereof. from other species, and / or polypeptides encoded by these nucleic acids. The examples provided in the present application indeed show that this panel of markers makes it possible to predictively detect the presence, the risk of developing or the stage of evolution of a cancer. In a particular embodiment, the method further comprises the detection of one or more of the other target molecules as defined above.

  In another particular embodiment, the method of the invention comprises the simultaneous determination of the presence (or the absence or the (relative) amount), in a biological sample of the mammal, of the nucleic acids comprising the sequences represented in SEQ ID NOs: 13, 16-19, 23, 26-28, 47, 51-55, 58, 69, 80, 81, 89, 116, 121, 125, 145, 148, 158, 160, 161 , 164, 189, 190, 225, 229, 240, 248, 280, 281, 284, 299, 300, 310 and 312 or a distinctive fragment thereof having at least 15, preferably at least 16, 17, 18 , 19, 20, 25 or 30 consecutive bases, or having a sequence complementary thereto and / or functional analogues thereof from other species, and / or polypeptides encoded by these nucleic acids. The examples provided in the present application indeed show that this panel of markers makes it possible to predictively detect the presence, the risk of developing or the stage of evolution of a cancer.

  In a particular embodiment, the method further comprises the detection of one or more of the other target molecules as defined above.

  In another particular embodiment, the method of the invention comprises the simultaneous determination of the presence (or the absence or the (relative) amount), in a biological sample of the mammal, of the nucleic acids comprising the sequences represented in SEQ ID NOs: 7, 13, 14, 16-19, 23-28, 47, 51-55, 58, 69, 80, 81, 89, 116, 121, 125, 137, 139, 145, 148 , 158, 160, 161, 164, 189, 190, 225, 228, 229, 240, 245, 248, 252, 280, 281, 284, 290, 298-300, 310 and 312 or a distinctive fragment thereof having at least 15, preferably at least 16, 17, 18, 19, 20, 25 or 30 consecutive bases, or having a sequence complementary thereto and / or functional analogues thereof from other species, and / or polypeptides encoded by these nucleic acids. The examples provided in the present application indeed show that this panel of markers makes it possible to predictively detect the presence, the risk of developing or the stage of evolution of a cancer. In a particular embodiment, the method further comprises the detection of one or more of the other target molecules as defined above.

  In another particular embodiment, the method of the invention comprises the simultaneous determination of the presence (or the absence or the (relative) amount), in a biological sample of the mammal, of the nucleic acids comprising the sequences represented in SEQ ID NOs: 5, 7, 13, 14, 16-20, 23-28, 47, 51-55, 58, 64, 69, 80, 81, 88-90, 116, 121, 125, 137 , 139, 145, 148, 158, 160, 161, 164, 188-191, 208, 222, 225, 228, 229, 236, 240, 242, 245, 248, 252, 280, 281, 284, 290, 298 -300 and 309-312 or a distinctive fragment thereof having at least 15, preferably at least 16, 17, 18, 19, 20, 25 or 30 consecutive bases, or having a sequence complementary thereto and or functional analogues thereof from other species, and / or polypeptides encoded by these nucleic acids. The examples provided in the present application indeed show that this panel of markers makes it possible to predictively detect the presence, the risk of developing or the stage of evolution of a cancer. In a particular embodiment, the method further comprises the detection of one or more of the other target molecules as defined above.

  In a specific mode of implementation, the method of the invention comprises the determination of the presence (or absence or (relative) amount), in a biological sample of the mammal, of the nucleic acids comprising respectively the sequences represented in SEQ ID NOs: 1-318 or a distinctive fragment thereof having at least 15, preferably at least 16, 17, 18, 19, 20, 25 or 30 consecutive bases, or nucleic acids having a complementary sequence of these.

  The present invention is based on the demonstration and characterization of serum biological events characteristic of the presence of breast cancer in a human patient. These events constitute biomarkers, the detection of which in a patient makes it possible, preferably in combination, to determine, even at an early stage, the risk of developing such a cancer or the presence of such a cancer.

  The identified biological events typically correspond to changes in the regulation of gene expression. It can be a partial or total inhibition of the expression of genes or certain forms of genes, an increase in the expression of genes or certain forms of genes, the appearance or disappearance forms of gene splicing, etc.

  The invention is therefore based on the detection, in a sample, of one or more target molecules representative of the biological events thus identified. As indicated above, these target molecules can be chosen from:

  a) nucleic acids comprising a sequence selected from SEQ ID NOs: 1-31 or a distinctive fragment thereof having at least 15, preferably at least 16, 17, 18, 19, 20, 25 or 30 consecutive bases, b) the nucleic acids having a sequence complementary to a sequence according to a), c) the functional analogues of nucleic acids according to a) or b), or d) the polypeptides encoded by the nucleic acids according to a) to c).

  The target molecule may be the complete sequence of the gene or of the RNA or of the protein corresponding to the sequences SEQ ID NOs: 1-318, or a distinctive fragment thereof, that is to say a fragment of which the sequence is specific for said gene or RNA, or said protein, and / or comprises a domain of variability (splicing, deletion, polymorphism, etc.) representative of the biological event to be detected. The complete list of markers and the corresponding genes are shown in Table 1.

  The term functional analogue refers to an analogue from another mammalian species. Indeed, the sequences SEQ ID NOs: 1- 318 have been identified from human subjects, and these sequences constitute effective and adapted markers for the detection of cancer in human patients. Nevertheless, for an application of the methods of the invention to other mammalian species, it is generally preferable to use functional analogues of these sequences, characterized in the species under consideration. These analogs can be identified by any technique known to those skilled in the art, in particular in view of the sequences provided in the application and the names of the corresponding genes.

  In a particular embodiment, the method comprises determining the presence of at least one nucleic acid according to a) to c).

  In a very particular embodiment, the method is used to detect cancer in a human subject and includes determining the presence of at least one nucleic acid according to a) or b). More preferably still, the method comprises the combined detection of the presence or absence of a panel of target markers, as defined in the present application.

  A particular embodiment of the invention is a method for detecting the presence or risk of developing breast cancer in a mammal, comprising the combined determination of the presence or amount, in a mammalian blood sample, the following target molecules: a) nucleic acids comprising the sequences shown in SEQ ID NOs: 18, 19, 23, 26, 51, 52, 53, 54, 55, 69, 80, 125, 145, 148, 225, 228 , 240 and 312 or a distinctive fragment thereof having at least 15, preferably at least 16, 17, 18, 19, 20, 25 or 30 consecutive bases, and / or b) nucleic acids having a sequence complementary to sequences according to a), and / or c) the functional analogues of the nucleic acids according to a) or b) from another species, and / or d) the polypeptides encoded by the nucleic acids according to a) to c), the presence of such target molecules in the sample being an indication of the presence or risk of developing breast cancer in this mammal.

  Another specific object of the invention is a method for detecting the presence or risk of developing breast cancer in a mammal, comprising detecting, in a mammalian blood sample, the following target molecules: nucleic acids comprising the sequences shown in SEQ ID NOs: 18, 19, 23, 26, 51, 52, 53, 54, 55, 69, 80, 125, 145, 148, 225, 228, 240 and 312 or a distinctive fragment thereof having at least 15, preferably at least 16, 17, 18, 19, 20, 25 or 30 consecutive bases, and / or b) the nucleic acids having a sequence complementary to sequences according to a), and / or c) the functional analogues of the nucleic acids according to a) or b) from another species, and / or d) the polypeptides encoded by the nucleic acids according to a) to c), the presence, absence or quantity ( relative) of these target molecules in the sample being an indication of the presence or risk of developing breast cancer in this mammal.

Detection of a nucleic acid

  Various techniques for detecting a species of nucleic acid in a sample are useful in the present invention, such as, for example, Northern blotting, selective hybridization, the use of probed oligonucleotide-coated media, amplification nucleic acid as for example by RT-PCR, quantitative PCR or ligation-PCR, etc. Such methods may include the use of a nucleic acid probe (eg an oligonucleotide) capable of selectively or specifically detecting the target nucleic acid in the sample. The amplification may be carried out according to various methods known per se to those skilled in the art, such as PCR, CSF, transcription-mediated amplification (TMA), strand displacement amplification (SDA), NASBA, the use of allele-specific oligonucleotides (ASO), allele-specific amplification, Southern blotting, SSCA conformational analysis, in situ hybridization (eg, FISH), gel migration, analysis of heteroduplexes, etc.

  According to a preferred embodiment, the method comprises the detection of the presence or absence or the (relative) amount of a nucleic acid according to a) to c) by selective hybridization or selective amplification. Selective hybridization is typically performed using nucleic probes, preferably immobilized on a support, such as a solid or semi-solid support having at least one surface, flat or otherwise, for immobilizing nucleic probes. Such supports are for example a blade, ball, membrane, filter, column, plate, etc. They can be made of any compatible material, such as glass, silica, plastic, fiber, metal, polymer, etc. The nucleic probes may be any nucleic acid (DNA, RNA, PNA, etc.), preferably single-stranded, comprising a sequence specific for a target molecule as defined in a) to c) above. The probes typically comprise from 5 to 400 bases, preferably from 8 to 200, more preferably less than 100, and even more preferentially less than 75, 60, 50, 40 or even 30 bases. The probes may be synthetic oligonucleotides, produced on the basis of the target molecule sequences of the invention according to conventional synthesis techniques. Such oligonucleotides typically have from 10 to 50 bases, preferably from 20 to 40, for example about 25 bases. In a particularly advantageous mode, several different oligonucleotides (or probes) are used to detect the same target molecule. They may be oligonucleotides specific for different regions of the same target molecule, or centered differently on the same region. It is also possible to use pairs of probes, one of which is perfectly matched to the target molecule, and another has a mismatch, thus making it possible to estimate the background noise. In the following examples, 6 to 11 pairs of 25 base oligonucleotides were used for each target molecule.

  The probes may be synthesized beforehand and then deposited on the support, or synthesized directly in situ, on the support, according to methods known per se to those skilled in the art. The probes can also be manufactured by genetic techniques, for example by amplification, recombination, ligation, etc.

  The probes thus defined constitute another object of the present application, as well as their uses (essentially in vitro) for the detection of cancer in a subject. Particularly preferably, a set of nucleic probes comprising all or a fragment of at least 15 consecutive bases, preferably at least 17, 19, 20, 22 or 25 consecutive bases, of each of the sequences SEQ ID NO: 1 is used. -318, or a complementary strand thereof, advantageously immobilized on a support.

  Hybridization can be carried out under standard conditions known to those skilled in the art and adjustable by it (Sambrook, Fritsch, Maniatis (1989) Molecular Cloning, Cold Spring Harbor Laboratory Press). In particular, the hybridization can be carried out under conditions of high, medium or low stringency, depending on the desired level of sensitivity, the quantity of available material, etc. For example, suitable hybridization conditions include a temperature of between 55 and 63 ° C for 2 to 18 hours on low density media. Other hybridization conditions may be necessary for high density media, such as hybridization between 45 and 55 C. After hybridization, different washes can be performed to remove unhybridized molecules, typically in SSC buffers comprising SDS, such as a buffer comprising 0.1 to 10 X SSC and 0, 5-0.01% SDS. Other wash buffers containing SSPE, MES, NaCl or EDTA may also be used.

  In a typical embodiment, the nucleic acids (or the chips or supports) are prehybridized in hybridization buffer (Rapid Hybrid Buffer, Amersham) typically containing 100 g / ml of salmon sperm DNA. 65 C for 30 min. The nucleic acids of the sample are then placed in contact with the probes (typically applied on the support or the chip) at 65 ° C. for 2 to 18 hours. Preferably, the nucleic acids of the sample are marked beforehand with any known labeling (radioactive, enzymatic, fluorescent, luminescent, etc.). The supports are then washed in a 5 × SSC buffer, 0.1% SDS at 65 ° C. for 30 min, then in a 0.2 × SSC buffer, 0.1% SDS. The hybridization profile is analyzed according to conventional techniques, for example by measuring the marking on the support by means of a suitable instrument (for example Instantlmager, Packard Instruments). Hybridization conditions can naturally be adjusted by those skilled in the art, for example by modifying the hybridization temperature and / or the saline concentration of the buffer, as well as by adding auxiliary substances such as formamide or simple DNA. strand.

  A particular object of the invention thus lies in a method for detecting the presence or risk of developing breast cancer in a mammal, comprising bringing into contact, under conditions allowing hybridization between complementary sequences, nucleic acids derived from a sample of mammalian blood and a set of probes specific for the following target molecules: a) the nucleic acids comprising the sequences shown in SEQ ID NOs: 18, 19, 23, 26, 51, 52, 53, 54, 55, 69, 80, 125, 145, 148, 225, 228, 240 and 312 or a distinctive fragment thereof having at least 15, preferably at least 16, 17, 18, 19, 20, 25 or 30 bases consecutive, and / or b) the nucleic acids having a sequence complementary to sequences according to a), and / or c) the functional analogues of the nucleic acids according to a) or b) from another species, to obtain a profile of hybridization, the hybridization profile being characteristic of the presence or risk of developing breast cancer in this mammal.

  In particular embodiments, the methods of the invention also use other target molecules, in particular the subsets of target molecules mentioned in the present application.

  Thus, another particular object of the invention resides in a method for detecting the presence or the risk of developing a cancer in a mammal, comprising contacting, under conditions allowing hybridization between complementary sequences, nucleic acids derived from a mammalian blood sample and a set of probes specific for at least two distinct molecules selected from the following targets: a) nucleic acids comprising the sequences shown in SEQ ID NOs: 1-318 or a distinctive fragment of these having at least 15, preferably at least 16, 17, 18, 19, 20, 25 or 30 consecutive bases, and / or b) the nucleic acids having a sequence complementary to sequences according to a), and / or c ) the functional analogues of the nucleic acids according to a) or b) from another species, to obtain a hybridization profile, the hybridization profile being characteristic of the presence or risk of deviation elopper cancer in this mammal.

  The selective amplification is preferably performed using a primer or pair of primers for amplifying all or part of one of the target nucleic acids in the sample, when present therein. The primer may be specific for a target sequence according to SEQ ID NO: 1-318, or a region flanking the target sequence in a nucleic acid of the sample. The primer typically comprises a single-stranded nucleic acid, advantageously between 5 and 50 bases long, preferably between 5 and 30. Such a primer constitutes another object of the present application, as well as its use (essentially in vitro ) for the detection of cancer in a subject.

  In this respect, another subject of the invention lies in the use of a nucleotide primer or a set of nucleotide primers allowing the amplification of all or part of one or, preferably, several genes or RNAs comprising a target sequence according to SEQ ID NO: 1-318, for the detection of cancer in a mammal, preferably breast cancer, particularly in a human being.

Detection of a polypeptide

  In another embodiment, the method comprises determining the presence of a polypeptide according to d). The detection of a polypeptide in a sample can be carried out by any technique known per se, such as in particular by means of a specific ligand, for example an antibody or an antibody fragment or derivative. Preferably, the ligand is an antibody specific for the polypeptide, or a fragment of such an antibody (for example an Fab, Fab ', CDR, etc.), or a derivative of such an antibody (for example a single antibody). chain, ScFv). The ligand is typically immobilized on a support, such as a slide, ball, column, plate, etc. The presence of the target polypeptide in the sample may be detected by demonstrating a complex between the target and the ligand, for example using a labeled ligand, using a second labeled revealing ligand, etc. Immunological techniques that can be used and are well known are ELISA, RIA, etc.

  Antibodies specific for the target polypeptides may be produced by conventional techniques, including immunizing a non-human animal with an immunogen comprising the polypeptide (or an immunogenic fragment thereof), and recovering antibodies (polyclonal) or producing cells (to produce monoclonals). Techniques for producing poly- or monoclonal antibodies, ScFv fragments, human or humanized antibodies are described for example in Harlow et al., Antibodies: A laboratory Manual, CSH Press, 1988; Ward et al., Nature 341 (1989) 544; Bird et al., Science 242 (1988) 423; WO94 / 02602; US5,223,409; US5,877,293; WO93 / 01288. The immunogen may be synthetically manufactured, or by expression, in a suitable host, of a target nucleic acid as defined above. Such an antibody, monoclonal or polyclonal, as well as its derivatives having the same antigenic specificity, are also an object of the present application, as well as their use for detecting cancer.

  Implementation of the method The method of the invention is applicable to any biological sample of the mammal under test, in particular any sample comprising nucleic acids or polypeptides. A sample of blood, plasma, platelet, saliva, urine, stool, etc., may be advantageously mentioned, more generally any tissue, organ or, advantageously, biological fluid comprising nucleic acids or polypeptides.

  In a preferred and particularly advantageous embodiment, the sample is a blood or plasma sample. The invention results indeed from the identification of blood markers of cancer, and thus allows detection of these pathologies without tissue biopsy, but only from blood samples.

  The sample can be obtained by any technique known per se, for example by sampling, by non-invasive techniques, from collections or sample banks, etc. The sample may also be pre-treated to facilitate the accessibility of the target molecules, for example by lysis (mechanical, chemical, enzymatic, etc.), purification, centrifugation, separation, etc. Advantageously, the PaxGene system is used (Feezor et al., Physiol Genomics 2004, pp. 247-254). The sample can also be labeled, to facilitate the determination of the presence of the target molecules (fluorescent, radioactive, luminescent, chemical, enzymatic labeling, etc.).

  In a preferred embodiment, the biological sample is a whole blood sample, that is to say having not undergone a separation step, which may optionally be diluted.

  The invention is applicable to any mammal, preferably humans. The method of the invention is particularly useful for the detection of breast cancer, including the presence, risk of development or stage of development of breast cancer in humans. Thus, the data provided in the examples show that the invention makes it possible to detect the presence of breast cancer with a sensitivity greater than 92% and a specificity greater than 86%.

  A particular object of the present application relates to a method for detecting the presence, evolution or risk of developing breast cancer in a human subject, comprising the combined determination of the presence (or absence or quantity thereof ( relative)), in a biological sample of the human subject, target molecules selected from: a) nucleic acids comprising a sequence selected from SEQ ID NO: 1-318 or a fragment thereof having at least 15, preferably at least minus 16, 17, 18, 19, 20, 25 or 30 consecutive bases, b) the nucleic acids having a sequence complementary to a sequence according to a), and c) the polypeptides encoded by the nucleic acids according to a) or b) .

  Preferably, the method comprises the combined determination of the presence, absence or quantity of 5, 10, 20, 30, 40, 50 or 60 target molecules as defined above.

  Another particular object of the present application relates to a method for detecting the presence, evolution or risk of developing breast cancer in a human subject, comprising contacting a biological sample of the acid-containing subject.

  16 nucleic acids with a product comprising a support on which are immobilized nucleic acids comprising a sequence complementary to and / or specific to one or, preferably, several target molecules chosen from (i) nucleic acids comprising a sequence chosen from SEQ ID NO : 1-318 or a fragment thereof having at least 15, preferably at least 16, 17, 18, 19, 20, 25 or 30 consecutive bases and (ii) nucleic acids having a sequence complementary to a sequence according to (i), and determining the hybridization profile, the profile indicating the presence, the stage or the risk of developing breast cancer in said human subject. Preferably, the product comprises distinct nucleic acids comprising a complementary and / or specific sequence of at least 5, 10, 20, 30, 40, 50, 60 or more different target molecules as mentioned above.

  Another subject of the present application relates to a product comprising a support on which are immobilized nucleic acids comprising a complementary and / or specific sequence of one or, preferably, several target molecules selected from (i) nucleic acids comprising a sequence selected from SEQ ID NO: 1-318 or a fragment thereof having at least 15, preferably at least 16, 17, 18, 19, 20, 25 or 30 consecutive bases and (ii) the nucleic acids having a sequence complementary to a sequence according to (i). Preferably, the product comprises distinct nucleic acids comprising a complementary and / or specific sequence of at least 5, 10, 20, 30, 40, 50, 60 or more different target molecules as mentioned above. Preferably, the product comprises a support on which are immobilized at least 18 distinct nucleic acid probes comprising a complementary and / or specific sequence of 18 distinct target nucleic acids chosen from SEQ ID NO: 1-318, preferably from 18 acids. distinct target nuclei as defined above. Another object of the present application relates to a product comprising a support on which is immobilized at least one, preferably several, nucleic acids comprising a sequence chosen from SEQ ID NO: 1-318, or a functional analogue thereof.

  Preferably, the product comprises at least 5, 10, 20, 30, 40, 50, 60 or more different nucleic acids selected from the nucleic acids mentioned above. In a particular embodiment, the product each comprises nucleic acids of sequence SEQ ID NO: 1-318.

  Another subject of the present application relates to a product comprising a support on which at least one ligand of a polypeptide encoded by a target nucleic acid as defined above, that is to say a nucleic acid comprising a sequence selected from SEQ ID NO: 1-318, a distinctive fragment thereof having at least 15, preferably at least 16, 17, 18, 19, 20, 25 or 30 consecutive bases, a nucleic acid having a complementary sequence thereof or a functional analogue thereof.

  Preferably, the product comprises at least 5, 10, 20, 30, 40, 50, 60 or more different polypeptide ligands selected from the polypeptides mentioned above.

  The support can be any solid or semi-solid support having at least one surface, flat or not, allowing the immobilization of nucleic acids or polypeptides. Such supports are for example a blade, ball, membrane, filter, column, plate, etc. They can be made of any compatible material, such as glass, silica, plastic, fiber, metal, polymer, polystyrene, teflon, etc. The reagents can be immobilized on the surface of the support by known techniques, or, in the case of nucleic acids, synthesized directly in situ on the support. Immobilization techniques include passive adsorption (Inouye et al., J. Clin Microbiol 28 (1990) 1469), the covalent bond. Techniques are described for example in WO90 / 03382, WO99 / 46403. The reagents immobilized on the support can be ordered according to a pre-established scheme, to facilitate the detection and identification of the complexes formed, and in a variable and adaptable density.

  In one embodiment, the product of the invention comprises a plurality of synthetic oligonucleotides, of a length of between 5 and 100 bases, specific for one or more target nucleic acids defined in a) to c).

  The products of the invention typically comprise control molecules for calibrating and / or normalizing the results.

  Another object of the present application relates to a kit comprising a compartment or container comprising at least one, preferably several, nucleic acids comprising a complementary and / or specific sequence of a target nucleic acid as defined above and / or a , preferably several ligands of a target polypeptide as defined above. Preferably, the product comprises at least 5, 10, 20, 30, 40, 50, 60 or more nucleic acids and / or different ligands selected from the nucleic acids and ligands mentioned above. In a particular embodiment, the product comprises each nucleic acid of sequence SEQ ID NO: 1-318 or a ligand for each of the target polypeptides as defined above. The kit may furthermore comprise reagents for a hybridization or immunological reaction, as well as, if appropriate, controls and / or instructions.

  Another subject of the invention relates to the use of a product or kit as defined above for the detection of cancer in a mammalian subject, preferably a human subject, in particular breast cancer.

  Another subject of the invention relates to a nucleic acid with a sequence chosen from SEQ ID NO: 1-318, or a distinctive fragment thereof comprising at least 15 consecutive bases, preferably at least 16, 17, 18, 19, 20, 25 or 30, or a nucleic acid having a sequence complementary thereto, or a functional analogue thereof. The invention also relates to a cloning vector or expression comprising these nucleic acids, as well as any recombinant cell comprising such a vector or nucleic acid.

  Another object of the invention relates to the use of a nucleic acid comprising a sequence selected from SEQ ID NO: 1-318, or a distinctive fragment thereof comprising at least 15 consecutive bases, preferably at least 16 , 17, 18, 19, 20, 25 or 30, or a nucleic acid having a sequence complementary thereto, or a functional analogue thereof, for the detection (essentially in vitro) of a cancer in a mammal subject.

  According to a particular embodiment of the invention, a blood sample is taken from a mammal to be tested. The blood sample is optionally processed to make the nucleic acids more accessible, and these are labeled. The nucleic acids are then applied to a product as defined above and the hybridization profile is determined to diagnose the presence or absence of cancer in the subject. The method of the invention is simple, practiced ex vivo, and allows the early detection of cancer from a blood sample.

  It is understood that any equivalent technique may be used in the context of this application to determine the presence of a target molecule.

  Other aspects and advantages of the invention will appear on reading the examples which follow, which should be considered as illustrative and not limiting.

  FIGURE 1 Figure 1: PCR amplification of DATAS cDNAs derived from profiling # 1 (PBMN) using 10 pairs of semi-degenerate primers. DATAS profiling was performed in both directions (stage I & II cancers versus controls and controls against stage I 15 & II cancers). A positive control using cDNA from HepG2 cells is included. Figure 2: PCR amplification of DATAS cDNAs from profiling n 2 (PBMO) using 10 pairs of semi-degenerate primers. DATAS profiling was performed in both directions (stage III & IV cancers versus controls and controls against stage III & IV cancers). A positive control using cDNA from HepG2 cells is included. Figure 3: PCR amplification of DATAS cDNAs from profiling n 3 (PBMP) using 10 pairs of semi-degenerate primers. DATAS profiling was performed in both directions (stage I to IV cancers versus controls and controls against stage I to IV cancers). A positive control using cDNA from HepG2 cells is included. Figure 4: Specific configuration of probes to measure the expression of variants generated by alternative splicing. Probe A, common to both isoforms, measures the expression of both variants. Probe B, specific for the additional sequence of the long form, as well as probes C and D, specific for the junction sequences around this additional sequence measure the expression of the long isoform. E probe, specific for the junction resulting from the absence of the additional sequence, measures the expression of the short isoform.

  Figure 5: Definition of the "target" sequences. 15 nucleotides on either side of each junction and up to 500 nucleotides for the additional and common upstream sequences are captured. Figure 6: Target sequences and associated data. Description of the columns: idn: n identification of the splicing event; Description: type of splicing event; long form: n of accession of the long form; short form: n of accession of the short form; target A to E: Sequences of targets A to E; long .: size of the sequences of the previous column. Figure 7: Hierarchical clustering on 37 controls and 55 patients using 100 oligonucleotides.

EXAMPLES

  1. Characteristics of the biological samples The examples presented below were initially made from 92 blood samples (5 ml of whole blood taken from two PaxGene tubes). These samples included 37 blood samples from healthy control patients (S, obtained from the French Blood Establishment) and 55 samples from patients with stage 1 / II breast cancer (Cl / II). 2. Extraction of total RNA from the blood sample

  Blood samples were collected directly into PAXGene 'Blood 25 RNA tubes (PreAnalytix, Hombrechtikon, CH). After the blood sample collection step and in order to obtain a total lysis of the cells, the tubes were left at ambient temperature for 4 h and then stored at -20 ° C. until the biological material was extracted. Specifically, in this protocol, the total RNAs were extracted using PAXGene Blood RNA kits (PreAnalytix) according to the manufacturer's recommendations. Briefly, the tubes were centrifuged (15 min, 3000 g) to obtain a nucleic acid pellet. This pellet was washed and taken up in a buffer containing proteinase K necessary for protein digestion (10 min at 55 ° C.). Further centrifugation (5 min, 19000g) was performed to remove cell debris and ethanol was added to optimize the nucleic acid binding conditions. The total RNAs were specifically fixed on the PAXgene RNA spin column and, before elution thereof, digestion of the contaminating DNA was performed using the RNAse free DNAse set (Qiagen, Hilden, Germany). ). The quality of the total RNAs was analyzed by the AGILENT 2100 bioanalyzer (Agilent Technologies, Waldbronn, Germany). 3. DATAS Profiling Experiments

  Three series of DATAS profiling were performed between the following groups:

  DATAS n 1: Early breast cancers (Stage I and II) versus control group (PBMN study) DATAS n 2: Late breast cancers (Stage III and IV) versus control group (PBMO study) DATAS n 3: Breast cancer (Stage I, II, III and IV) vs Control group (PMNP study)

  DATAS is a technology for profiling gene expression between two samples that characterizes the qualitative differences in messenger RNAs, such as those generated by alternative splicing. This proprietary technology is described in US Patent 6,251,590.

  The total RNAs corresponding to the two situations, one normal (mN) and the other pathological (mP), are isolated from the blood samples using the PAXgene system (PreAnalytix) described above. These RNAs (50 g per group) are converted to complementary (cN) and (cP) DNAs using reverse transcriptase (RT) (Invitrogen) and a biotinylated oligodT25 oligonucleotide (Invitrogen). Samples contributing 30 to 50 g per group are shown in Tables A to F.

  Hybrids mN / cP and cN / mP are then made in the liquid phase. After ethanol precipitation of mN and cP and cN and mP, the precipitates are taken up in 30 l of hybridization solution containing 80% formamide and 0.1% SDS for incubation at 40 C overnight. The heteroduplexes are then captured using magnetic beads Streptavidin (Dynal). A magnet keeps the balls in the tube during rinsing operations. The beads / heteroduplexes are then taken up in 50 μl of RNAseH buffer and incubated with RNaseH (Invitrogen) for 30 minutes at 37 ° C. The supernatant is recovered after a new application of the magnet. Residual DNA is removed by the action of DNAseI (Ambion). After inactivation of the enzyme, the fragments of RNAs are precipitated with ethanol and taken up in DEPC treated water supplemented with RNAse out (Ambion). The RNA fragments are then reverse transcribed (TaqMan Reverse transcription kit, Applied Biosystem) using random hexamer oligonucleotides. The complementary DNAs obtained are then amplified by PCR using semidegenerated primers. 10 pairs of primers are generally used. The amplicons obtained can be visualized by agarose gel electrophoresis (FIGS. 1, 2 and 3). There are heterogeneous amplified populations of nature and intensity that vary according to the primers and the samples used. These amplified populations are cloned into a TOPO TA cloning vector (Invitrogen) to be transformed into a strain of competent E. coli bacteria (Invitrogen). The colonies are subcultured into 96-well plates and grown overnight in 2XTY supplemented with ampicillin. A glycerol stock (50%) is then made. Generally, a 96-well plate is passed through a pair of primer for one of the two directions. This provides 96x10x2 = 1920 colonies to characterize. 1728 clones were sequenced in the framework of profiling DATAS n 1, 1920 were cloned and sequenced as part of profiling DATAS n 2 and 1920 were cloned and sequenced as part of profiling DATAS n 3.

  4. Bioinformatic Analysis Table G summarizes the number of clones characterized in the three profiling banks. A so-called singleton clone means that the sequence of this clone has been identified only once in the library and that no other clone overlaps this sequence. A cluster is a group of clones whose sequences overlap. The three DATAS profilings generated 1741 non-redundant clones.

  Table G: Characterization of clones obtained in the three DATAS banks Banks DATAS Cancers I Cancers III & All cancers Consolidation & II vs. IV vs. vs. control over the three control control banks Number of clones 1728 1920 1920 5568 sequenced Number of clusters 267 347 303 886 Number of 239 362 440 855 singletons Number of clones no 506 709 743 1741 (*) redundant within the bank A bioinformatics analysis has 1741 clones were performed to identify the genes they are associated with and the known splicing events in the corresponding public nucleic acid libraries.

  Thus, the 1741 DATAS clones could be associated with 1170 different genes, some non-overlapping DATAS fragments being associated with different regions of the same gene.

  5. Selection and Drawing of Target Events for Microarray Drawing The detection and quantification of the expression of microarray splice variants requires the use of a particular probe configuration. Any reference messenger RNA / splice variant pair can be modeled as long isoform / short isoform (Figure 4). Thus, a splice variant associated with an exon skip will be the short isoform relative to the reference variant. A splice variant with a new exon or intron retention will be the long isoform relative to the reference variant. Other alternative splicing events (uses of 5 'or 3' splicing sites) can also be modeled in the same way.

  The set of probes necessary for measuring the expression of splice variants is also indicated in FIG. 4. This set consists of two traditional exon probes A and B and three exon-exon junction probes or Exon-intron C, D and E. Probe A measures the expression of both isoforms, probes B, C and D express the long isoform and probe E express the short form.

  In order to design all these probes, it is necessary to identify the splicing events corresponding to the DATAS fragments, then the target regions from which the probes will be drawn. The target sequences corresponding to the junction probes C, D and E are defined by a length of 30 nucleotides, 15 nucleotides on either side of the junction. It is thus possible to cover any junction with probes of 25 nucleotides of the type: 10/15, 11/14, 12/13, 13/12, 14/11 and 15/10 (the sign / representing the junction zone) . The constraints are less strong on the exonic probes A and B. The additional sequence, specific for the long form (sequence 2 of FIG. 4) and the common sequence upstream of the splice site (sequence 1 of FIG. the target sequences for these probes with a ceiling of 500 nucleotides for sequences that can exceed this size. The definition of the target sequences is summarized in Figure 5.

  Thus, the 1170 genes corresponding to the 1741 DATAS clones were used to identify, for each of them, the cDNAs and ESTs represented in the public databases of sequence data, potentially having qualitative differences in sequences, a source of events. splicing. The events retained are located within 100 nucleotides with respect to the 5 'or 3' ends of the DATAS fragments.

  2108 events have been selected and listed in an Excel workbook, part of which describes the extracted information is shown in Figure 6. This information includes, for a given event: an identification number of the event, the nature of the event, the access numbers of the long and short forms, the target sequences A to E and the size of these target sequences.

  A strict quality control has been applied for the definition of these sequences. Ambiguities on certain nucleotides were corrected by substituting them with the corresponding nucleotides on RefSeq reference RNA or from genomic DNA. All target sequences were realigned to confirm their membership in the appropriate short or long forms.

  6. Drawing Probes and Chip In order to measure the expression of the 2108 events described above, a custom microarray was designed. On this chip, each event was characterized by its five A-E target sequences. For each sequence A and B, 11 pairs of 25 nucleotide probes were designed, whereas the C, D, or E target sequences were detected with 6 pairs of 25 nucleotide probes.

  By pair of probes is meant a first probe that hybridises perfectly (this is called PM probes or perfect match) with one of the cDNAs from a target transcript, and a second probe, identical to the first probe at the same time. except for a mismatch (this is called a MM or mismatched probe) in the center of the probe. Each MM probe was used to estimate the background noise corresponding to a hybridization between two nucleotide fragments of non-complementary sequence. (Affyrnetrix technical note "Statistical Algorithms Reference Guide", Lipshutz, et al (1999) Nat Genet 1 Suppl., 20-24). If the design of at least 6 probes for sequences A and B or at least 4 probes for sequences C, D, and E was impossible, these sequences were not included on the chip. Such a situation can result from sequences of low complexity, containing repetitive structures or consecutive or non-consecutive hairpin structures. An A-E sequence size of less than 30 nucleotides also led to the exclusion of these probes. Only the good quality sequences, oriented in the 5 '-> 3' direction, were used for the design of the probes carried out according to the instructions of Affymetrix.

  7. Synthesis of cRNA, obtaining and labeling cDNAs and fragmentation In order to analyze the expression of the target transcripts according to the invention, the

  Complementary DNAs (cDNA) of the mRNAs contained in the total RNAs as purified above, were obtained from 400 ng of total RNA by the use of a Klenow enzyme 3'-5'-exonuclease, 100 units of the SuperScript II reverse transcription enzyme (Invitrogen), 10 units of the RNAse H Superase-IN inhibitor (Ambion, Huntigdon, UK) and 200 pmol of random primer containing the T7 promoter (RP-T7- primer, Eurogenetec, Seraing, Belgium). All the cDNAs thus obtained were then engaged in in vitro transcription, which was carried out with a MEGAscript T7 kit (Ambion) for 16 h at 37 C. The resulting cRNA was subsequently column purified with an RNeasy Mini kit. (Invitrogen), and the quality of the obtained cRNA was analyzed by the AGILENT 2100 bioanalyzer. The purified cRNAs were then quantified by spectrophotometry, and the cRNA solution was adjusted to a concentration of 1.24 g / gl cRNA. Twenty-six micrograms of cRNA were then dispatched on two Eppendorf tubes, and 3 g of random primers were added to each tube. The reverse transcription was carried out with 800 units of SuperScriptII (Invitrogen) and 10 units of an RNAse H inhibitor, in the presence of Klenow enzyme, for 1 h at 37 C. The double-stranded cDNA resulting from this approach was then purified using the QIAquick PCR Purification Kit (Qiagen) and quantified spectrophotometrically. Sixteen micrograms of cRNA, divided into three Eppendorf tubes, were then fragmented with 0.6 units of DNAse I per tube for 10 minutes at 37 C. The fragmentation efficiency was verified using the bioanalyzer 2100 (Agilent). . The fragmented cDNAs were then labeled with biotin using 330 units of the terminal transferase (Roche Molecular Biochemicals, Meylan, France) and 1 l of DNA Labeling Reagent (DLR-1α, 5 mM) [Affymetrix] per microgram of cDNA during 60 min at 37 C.

  All of the fragmented and labeled cDNA was finally hybridized to the custom DNA chip (labeled A520138F, cf Example 6) according to a standard hybridization protocol adapted to 11 m chips.

  8. Demonstration of expression profiles for the diagnosis of breast cancer from blood samples

  30 8.1. Demonstration of a Transcript Expression Profile to Discriminate Patients Controls (S) of Patients with Stage I / II Cancer The Expression of Approximately 2000 RNA Variants, Representing About 800 Genes, was analyzed and compared between patients S and CI / II. For this, 16 g of fragmented cDNA from each sample were added to hybridization buffer (Affymetrix) and 200 l of this solution were contacted for 16 h at 50 ° C on expression chips.

  In order to record the best hybridization and washing performances, biotinylated control RNAs (bioB, bioC, bioD and cre) and oligonucleotides (oligo B2) were also included in the hybridization buffer. After the hybridization step, the biotinylated and hybridized cDNAs on the chip were revealed by the use of streptavidin-phycoerythrin solution and the signal was amplified by the use of anti-streptavidin antibodies. Hybridization was performed in a GeneChip Hybridization Furnace (Affymetrix), and the Euk GE-WS2 Protocol of Affymetrix was followed. The washing and revelation steps were performed on a Fluidics Station 450 station (Affymetrix). Each chip was then analyzed on an Affymetrix G3000 GeneArray Scanner scanner at a resolution of 1.5 microns to identify hybridized areas on the chip. This scanner allows the detection of the signal emitted by the fluorescent molecules after excitation by an argon laser using the epifluorescence microscope technique. For each position, a signal is obtained which is proportional to the quantity of cDNAs fixed. The signal was then analyzed by GeneChip Operating Software (GCOS 1.2, Affymetrix).

  In order to prevent the variations obtained by the use of different chips, a standardization approach using the Bioconductor tool, which allows to harmonize the average distribution of the raw data obtained for each chip, was realized. The results obtained on one chip can then be compared to the results obtained on another chip. The GCOS 1.2 software also included the inclusion of a statistical algorithm to consider whether a transcript was expressed or not.

  From the 6,242 groups of probes, representing about 2,000 transcripts, of the chip, the inventors selected the relevant transcripts that were correlated with the development of breast cancer. Transcripts that have too low a level of expression on the majority of the chips as well as transcripts that do not show significant variation between the different chips have been excluded (Li et al, 2001, Bioinformatics, 17: 1131-1142).

  The search for a panel of transcripts discriminating groups of patients EFS and CUII was carried out by a technique of Data Mining, named random forest algorithm (http://ligarto.org/rdiaz/Papers/jornadas.bioinfo.randomForest.pdf ). In addition to analyzing the data with the random forest algorithm, which represents a multivariate analysis, a so-called univariate analysis was also used to identify differentially expressed transcripts between the EFS and CUII patients. This analysis, named SAM (for Significance Analysis of Microarrays), is mainly based on a modified version of the Student's t-test, which makes it possible to prevent bias introduced by genes with low variability. This approach controls the level of false positive genes in a univariate analysis.

  All of the analyzes mentioned above made it possible to demonstrate a first panel of transcripts, comprising 318 relevant transcripts according to the invention (see Table 1, SEQ ID Nos: 1-318). The increase or decrease in expression of each of these transcripts observed in patients S versus patients C I / II is presented in Table 1.

  The inventors studied the simultaneous expression of 318 transcripts to obtain an expression profile. Using the random forest method, 90% of patients were correctly classified. More specifically, 32 of the 37 controls and 51 of 55 patients were correctly classified, which corresponds to a sensitivity of 92.7% and a specificity of 86.4%. In addition to the analysis of the initial 92 samples, an additional analysis was performed to validate the relevance of the signature identified above: an independent cohort of five healthy controls and 16 phase UII breast cancer was blinded. The analysis of an independent cohort is one of the best ways to test the predictive value of a signature of genes or transcripts (see The SMRS working group, Nat Biotech 2005, 7: p.833-838). Based on the sequences SEQ ID Nos: 1-318, the random forest algorithm correctly classified five controls out of five and 13 patients out of sixteen (86% classification).

  8.2. Identification of a subset of 100 markers The inventors have also studied the simultaneous expression of 100 nucleotide sequence transcripts chosen from the sequences presented in Table 2 to obtain an expression profile. Using the random forest method, 89% of patients were correctly classified. More specifically, 31 of 37 controls and 51 of 55 patients were correctly classified, which corresponds to a sensitivity of 92.7% and a specificity of 83.7%. These results were confirmed with another analysis technique, hierarchical clustering. In this unsupervised analysis, a Control is positioned among the patients (to the left of the red dotted line, see Figure 7), and 10 patients are among the healthy controls (to the right of the red dotted line). Figure 7 shows the hierarchical clustering analysis of blood samples obtained from 55 patients with early stage cancer (C 1 / II, also called D) and 37 patients with controls (healthy donors) using expression of 100 genes identified by algorithmic analysis. The hierarchical clustering function of the Spotfire software organizes C 1 / II patients and controls in columns, and the genes in rows so as to obtain adjacent patients or genes with comparable expression profiles. The Pearson correlation coefficient was used as a similarity index for genes and patients. The results correspond to the Affymetrix fluorescence level normalized by the bioconductor tool. In order to account for the constitutive differences in expression between genes, the expression levels of each gene were normalized by calculating a reduced centered variable. White represents low levels of expression, gray intermediate levels and black high levels. The height of the branches of the dendrogram indicates the index of similarity between the expression profiles. In addition to the analysis of the initial 92 samples, an additional analysis was performed to validate the relevance of the signature identified above: an independent cohort of five healthy controls and 16 phase I / I1 breast cancer was blinded. Based on the top 100, the random forest algorithm correctly ranked five in five controls and 14 out of sixteen patients (90% classification).

  Among this combination of 100 marker genes, the inventors have shown that smaller panels also make it possible to discriminate the control patients of patients suffering from breast cancer, as described in the following examples. 8.3. Identification of a predictive panel of 66 markers

  The inventors have demonstrated a combination of 66 markers, based on the sequences SEQ ID Nos: 5, 7, 13, 14, 16-20, 23-28, 47, 51-55, 58, 64, 69, 80, 81, 88-90, 116, 121, 125, 137, 139, 145, 148, 158, 160, 161, 164, 188-191, 208, 222, 225, 228, 229, 236, 240, 242, 245, 248, 252, 280, 281, 284, 290, 298-300 and 309-312 (see Table 3). This combination correctly classifies more than 80% of the samples. 8.4. Identification of a predictive panel of 53 markers The inventors have also demonstrated a combination of 53 markers, based on the sequences SEQ ID Nos: 7, 13, 14, 16-19, 23-28, 47, 51-55, 58, 69, 80, 81, 89, 116, 121, 125, 137, 139, 145, 148, 158, 160, 161, 164, 189, 190, 225, 228, 229, 240, 245, 248, 252, 280, 281, 284, 290, 298-300, 310 and 312. This combination also makes it possible to correctly classify more than 80% of the samples. 8.5. Identification of a Predictive Panel of 42 Markers The inventors have also demonstrated a combination of 42 markers, based on the sequences SEQ ID Nos: 13, 16-19, 23, 26-28, 47, 51-55, 58, 69, 80, 81, 89, 116, 121, 125, 145, 148, 158, 160, 161, 164, 189, 190, 225, 229, 240, 248, 280, 281, 284, 299, 300, 310 and 312. This combination also makes it possible to correctly classify more than 80% of the samples. 8.6. Identification of a panel predictive of 22 markers The inventors have demonstrated a combination of 22 markers, based on the sequences SEQ ID Nos: 18, 19, 23, 26, 27, 51, 52, 53, 54, 55, 69 , 80, 125, 145, 148, 161, 188, 225, 228, 240, 280 and 312. This combination correctly classifies 76% of the samples.30 8.7. Identification of a predictive panel of 18 markers

  The inventors have also demonstrated a combination of 18 markers, based on the target sequences SEQ ID NOs: 18, 19, 23, 26, 51, 52, 53, 54, 55, 69, 80, 125, 145, 148, 225, 228, 240 and 312 shown in Table 3. This combination correctly classifies 76% of the samples.

  The target probes used to detect this combination of 18 genes are given in Table 5. 76% of the patients were correctly classified.

  This confirms that the analysis of the expression of these 18 genes is a good tool to discriminate patients with a high risk of relapse of patients with a low risk of relapse. The use of restricted gene panel is particularly suitable for obtaining a tool for detection and prognosis. Indeed, the analysis of the expression of a dozen genes does not require custom manufacture of a DNA chip, and can be implemented directly by PCR or NASBA techniques, or low density chip, which presents an important economic asset and a simplified implementation. Table A: Selected samples for early breast cancer group for DATAS # 1 (PBMN) Stage Quantity Clinic Used I (ug) 10.0 Sample D104 D105 I 5.0 D106 I 2.0 D111 I 2.0 D114 I 3.0 D118 I 5.0 D123 I 6.0 D117 II 2.0 D121 II 5.0 D130 II 10.0 Table B: Samples selected for the control group for DATAS No. 1 (PBMN) D1 Sample Stage Quantity Clinical used DFS> 5 (μg) 1.66 D3 DFS> 5 1.66 D9 DFS> 5 1.66 D10 DFS> 5 1.66 D17 DFS> 5 1.66 D28 DFS> 5 1.66 D36 DFS> 5 1.66 D63 DFS> 5 1.66 D75 DFS> 5 1.66 D76 DFS> 5 1.66 D11 DFS <5 1.66 D14 DFS <5 1.66 D15 DFS <5 1.66 D16 DFS <5 1.66 D27 DFS <5 1.66 D31 DFS <5 1.66 D41 DFS <5 1.66 D66 DFS <5 1.66 D102 DFS <5 1.66 D103 DFS <5 1.66 D67 Benin 1.66 D69 Benin 1.66 D70 Benin 1.66 10 D71 Benin 1.66 D72 Benin 1.66 D73 Benin 1.66 D74 Benin 1.66 D79 Benin 1. 66 D115 Benin 1.66 D125 Benin 1.66 Table C: Samples selected for the late breast cancer group for the DATAS n 2 (PBMO) Sample Stage Quantity D55 Clinical used (μg) S III _ 3.33 D59 S III 3.33 D90 SIII 3.33 D134 S III 3.33 D168 S III 3.33 D178 S III 3.33 D126 S III 3.33 D132 S III 3.33 D91 S IV 3.33 D83 S IV 3.33 D101 S IV 3.33 D138 S IV 3.33 D161 S IV 3.33 D170 S IV 3.33 D99 S IV 3.33 Table D: Samples selected for the control group for DATAS n 2 (PBMO) Sample Stage Quantity Dl Clinic used DFS> 5 (ug) 1.66 D3 DFS> 5 1.66 D9 DFS> 5 1.66 D10 DFS> 5 1.66 D17 DFS> 5 1.66 D28 DFS> 5 1.66 D36 DFS> 5 1.66 D63 DFS> 5 1.66 D75 DFS> 5 1.66 D76 DFS> 5 1.66 D11 DFS <5 1.66 D14 DFS <5 1.66 D15 DFS <5 1.66 D16 DFS <5 1.66 D27 DFS <5 1.66 D31 DFS <5 1.66 D41 DFS <5 1.66 D66 DFS <5 1.66 D102 DFS <5 1.66 D103 DFS <5 1.66 D67 Benin 1.66 D69 Benin 1.66 D70 Benin 1.66 D71 Benin 1.66 D72 Benin 1.66 D73 Benin 1.66 D74 Benin 1.66 D79 Benin 1.66 D115 Benin 1.66 D125 Benin 1.66 Table E: Selected samples for the all-stage breast cancer group for 5 DATAS n 3 (PBMP). Sample Stage Quantity D91 Clinic used SIV (ug) 1.3 D92 SIV 1.3 D101 SIV 1.3 D138 SIV 1.3 D161 SIV 1.3 D170 SIV 1.3 D99 SIV 1.3 D195 SIV 1.3 D197 SIV 1,3 D205 S IV 1,3 D55 SIII 1,3 D59 S III 1,3 D90 SIII 1,3 D134 S III 1,3 D168 S III 1,3 D178 S III 1,3 D126 S III 1,3 D132 S III 1.3 D135 S III 1.3 D185 S III 1.3 D108 S II 1.3 D109 S II 1.3 D148 S II 1.3 D156 S II 1.3 D160 S II 1.3 D162 S II 1,3 D163 S II 1,3 D166 S II 1,3 D167 S II 1,3 D172 S II 1,3 D112 IF 1,3 D120 IF 1,3 D122 IF 1,3 D127 IF 1,3 D131 IF 1 , 3 D145 IF 1.3 D147 IF 1.3 D153 IF 1.3 D173 IF 1.3 D176 IF 1.3 Table F: Samples selected for the control group for DATAS # 3 (PBMP) Sample Stage Quantity Dl Clinic used DFS> 5 (ug) 1.66 D3 DFS> 5 1.66 D9 DFS> 5 1.66 D10 DFS> 5 1.66 D17 DFS> 5 1.66 D28 DFS> 5 1.66 D36 DFS> 5 1.66 D63 DFS> 5 1.66 D75 DFS> 5 1.66 D76 DFS> 5 1.66 D11 DFS <5 1.66 D14 DFS <5 1.66 D15 DFS <5 1.66 D16 DFS <5 1.66 D27 DFS <5 1.66 D31 DFS <5 1.66 D41 DFS <5 1.66 D66 DFS <5 1.66 D102 DFS <5 1.66 D103 DFS <5 1. 66 D67 Benin 1. 66 D69 Benin 1. 66 D70 Benin 1. 66 Benin 1. 66 D71 Benin 1. 66 D72 Benin 1. 66 D73 Benin 1. 66 D74 Benin 1. 66 D79 Benin 1. 66 D115 Benin 1. 66 D125 Table 1 List of 318 transcripts differentially expressed in the development of breast cancer.  SEQ Description of the N Genbank N C UII vs.  Sequence Target ID N sequence (reference) Genbank Healthy (variant) 1 lysozyme NM 000239. BE720647. 1 0.8 ATTTATCCTGCAGTGctttgctgcaa gata 2 cDNA AL832453. 2 BU634341. 1 0.8 AAATAAAATAT CA G G ATAT G G DKFZ TCCCCCTTGAGACTGAAGGAA DKFZp451G151 CTGAAGATTTTAAACCTTAGTA (Leucine-rich repeat AGAACCACATTTCATCCCTATC kinase 2) AGAGAACTTTCTTGAGGCTTGT CCTAAAGTGGAGAGTTTCAGT GCCA 3 cDNA AL832453. 2 BU634341. 1 0.8 GAATGAATTTTCTTGctgctatgcctt DKFZp451 G 151 tCt (leucine-rich repeat kinase 2) 4 cDNA AL832878. 1 AI223156. 1 0.8 TGCCAAGGAAGACCCCCTCCT DKFZp667I093 GACCCCTGTTCCGGCTTCAGA (Guanine nucleotide AAACCCGTTTAGGGAGAAGAA binding protein, gamma 2) G 1 1 1 1 1 CTGTGCCATCCTTTAA cDNA AL832878. 1 AI223156. 1 0.7 TGCAGATTTGATGGCctactgtgaa DKFZp667I093 gcaca (guanine nucleotide binding protein, gamma 2) 6 chemokine (C-C NM 001838. 2 BI910219. January 1 GATGAGGTCACGGACGATTAC motif) receptor 7 G 0.8 ATCGGAGACAACACCACAGTG GACTACACTTTGTTCGAGTCTT TGTGCTCCAAGAAGGACGTGC GAACTTTAAAG CCTG GTTCCT CCCTATCATGTACTCCATCATT TGTTTCGTGGGCCTACTGGGC AATGGGCTGGTCGTGTTGACC TATATCTATTTCAAGAGGCTCA AGACCATGACCGATACCTACCT GCTCAACCTGGCGGTGGCAGA CATCCTCTTCCTCCTGACCCTT CCCTTCTGGGCCTACAGCGCG GCCAAGTCCTGGGTCTTCGGT GTCCACTTTTGCAAGCTCATCT TTGCCATCTACAAGATGAGCTT CTTCAGTG G CATG CT CTCCTACTT CTTTG CATCAG CATTGACCG ACGTGGCCATCGTCCAGGCTG TCTCAGCTCACCGCCACCGTG CCCGCGTCCTTCTCATCAGCA AGCTGTCCTGTGTGGGCATCT GGATACTAGCCACAGTGCTCT CCATCCC 7 BC009917 Homo sapiens. 1 BCO28225. 1 1.4 ATGAAGAAAAACAAAgtgcacaga hypothetical protein gacccg DKFZp76I A052 8 cDNA clone BCO38965. 1 N70893.  1 1.2 AGGACAGCCCTGGGCagagatga IMAGE: 3920936 ggcaggg (High density lipoprotein binding protein (vigilin)) 9 cDNA clone BC040042. 1 BI001496. 1 1,3 TAATGCCAAGACAAAgccacggga IMAGE: 5207605 ggagca (Immunoglobulin heavy constant gamma 2 (G2m marker)) 10 cDNA clone BC040042. 1 BF841656. 1 1.3 CACAGGTGTACACCCTGCCCC IMAGE: 5207605 CATCCCGGGAGGAGATGACCA (Immunoglobulin heavy constant AGAACCAGGTCAGCCTGACCT GCCTGGTCAAAGGCTTCTACC gamma 2 (G2M CCAGCGACATCGCCGTGGAGT marker)) GGGAGAGCAATGGGCAGCCG GAGAACAACTACAAGACCACA CCTCCCATGCTGGACTCCGAC GGCTCCTTCTTCCTCTACAGCA AGCTCACCGTGGACAAGAGCA GGTGGCAGCAGGGGAACGTCT TCTCATGCTCCGTGATGCATGA GGCTCTGCACAACCACTACAC GCAGAAGAGCCTCTCCCTGTC TCCGGGTAAATGAGTGCCACG GCCGGCAAGCCCCCGCTCCCC AGGCTCTCGGGGTCGCGTGAG GATGCTTGGCACGTACCCCGT GTACATACTTCCCAGGCACCC AG CATG GAAATAAAG CACCCA GCGCT 11 BC048206 Microtubule. 1 AW015234.  1.3 TCTCTCTTTCCAATCTTACGCC associated ATG GC 1 C CATCAGTTCATTTCAG monoxygenase, calponin and CTTCCAGTGCTACACCCACTTC d L IM TTG G CTGACACACTTCTG CTCT domain containing 2 GTGACTG GTTTTCTTG AAG CCA ATTTTCAAAGAGTGGTACTAAC CCCCAACCCGCTTTCCGCACC CCGTCCTCTCCGCCAGCAGTA CTGGTTGCACTAACTGTGAGT GTCTTGCATACTGATGGACTCA TTTGGTGGCATGGTTGGCTAA CAGCATGGCGGGGGGTGTTCA GCTTGAGACCCATGCCTGTGT TCATTTCCCATGGAGCTGGCA GCCTGGTCTACCCCAAGTGCA TGCCCCGCCTCTCCTCTCTCC CTTGGGTCTGCCTGCGTGCAT GCTTCTCCAGTTGCGTCTGCG AAGCTACCTACTTTCTTGGGAG GGTCGACCTTGATCATGAAACA ATACCATGAGGGGGCCTCTGT CACCTTTGAAAAGAACACTTTT TGAGCAGCCTCAAAAAGCTCAT ACATAC 12 Microtubule BC048206. 1 AF052170. 1 1.4 TGGGAGGGTCGACCTTGATCA TGAAACAATACCATGAGGGGG associated monoxygenase, calponin and LIM CCTCTGTCACCTTTGAAAAGAA domain containing 2 iii 1 I CAC AG GAGCAGCCTCAAAA CTCATACATAC CAG CG CCTT CTTAAATTGGCTCTAATGTAAA GATTGTTAATGTCATTTATCAAA ACCATAG GTGATTATTTG GAG G GATTTAAAAAACTTAATTACTCT CAGGCCTCATCCCAAGCTTGA CACATGCTCTGTAGGTTGAACA CATAATCACAAATATTCTAGCA AATGCTGCCTTGGTTGCAGCC TGCACTGTAGACCCAAGGGTT TTG CTG CTC TG G CTCTTCTTAT CCTTGGCTCATAAAGCCCCAG ATGATGCCAGAGCTTCAATTAG AGCCATCATCATCCCAGGCAG GGATATCTTTGAGAAATGACTC AGTTCAGCCCCAGGCCCCTGT GACTCTGCTTAAAGCACACATT TCTGCTGACTCTTGTACCTGGG GCAGCAGGATAATCACCAACA C 13 cellular homolog of NM 001997. 2 NM 001997 0.5 GTCGCCCAGATCAAGgctcatgtag the fox sequence in. 2 cctca the Finkel-Biskis-Reilly murine sarcoma virus 14 cellular homolog of NM 001997. 2 W17004. 1 0.6 GGCCGCATGCTTGGAaggtaaagt the fox sequence in the Finkel-Biskis-Reilly murine sarcoma virus 15 cellular homolog of NM 001997. 2 AU098396. 1 0.6 GTCGCCCAGAGCAAGgctcatgta the fox sequence in gcctca the Finkel-Biskis-Reilly murine sarcoma virus 16 cellular homolog of NM 001997. 2 AA063591. 1 0.7 TGACCGGCCAGGAAAcggtcgccc the fox sequence in agatca the Finkel-Biskis-Reilly murine sarcoma virus 17 cellular homolog of NM 001997. 2 AA094898. 1 0.6 CAGGCCGCATGCTTGaggtaaagt the fox sequence in ccatgg the Finkel-Biskis-Reilly murine sarcoma virus 18 cellular homolog of NM 001997. 2 AA187006. 1 0.7 AGGCCGCATGCTTGGaggtaaagt the fox sequence in ccatgq the Finkel-Biskis-Reilly murine sarcoma virus 19 cellular homolog of NM 001997. 2 AA225636. 1 0.6 GGCCAGGAAACGGTCgcccagat the fox sequence in the Finkel-Biskis-Reilly murine sarcoma virus 20 cellular homolog of NM 001997. 2 BM820687.  0.5 GGTCGCCCAGATCAAgctcatgtag the fox sequence in 1 cctca the Finkel-Biskis- mouse Reilly sarcoma virus 21 cellular homolog of NM 001997. 2 AA491544. 1 0.7 GCCGCATGCTTGGAGgtaatgtcc the fox sequence in atggtt Finkel-Biskis-Reilly murine sarcoma virus 22 cellular homolog of NM 001997. 2 AV743892. 1 0.5 GTCGCCCAGATCAAGgctctgtagc the fox sequence in ctcac the Finkel-Biskis- Reilly murine sarcoma virus 23 cellular homolog of NM 001997. 2 BU603086. 1 0.6 GAAGTAGCAGGCCGCatgcttgga the fox sequence in ggtaaa the Finkel-Biskis- Murine Reilly sarcoma virus 24 cellular homolog of NM 001997. 2 BF218408. 1 0.6 AGGCCGATGCTTGGAggtaaagtc the fox sequence in the Finkel-Biskis-Reilly murine sarcoma virus 25 cellular homolog of NM 001997. 2 AI499403. 1 0.7 CCCGCATGCTTGGAGgtaaagtcc the fox sequence in atggtt Finkel-Biskis-murine Reilly sarcoma virus 26 cellular homolog of NM 001997. 2 AW795076.  0.6 CGGTCGCCCAGATCAaggctcatg the fox sequence in 1 tagcct the Finkel-Biskis- Reilly murine sarcoma virus 27 cellular homolog of NM 001997. 2 D52122. 1 0.6 GGCCGCATGCTTGGggtaaagtcc the fox sequence in atggtt the Finkel-Biskis-Reilly murine sarcoma virus 28 cellular homolog of NM 001997. BE535673. 1 0.6 GCCGCATGCTTGGAGGtaacagtc the fox sequence in the Finkel-Biskis- Reis murine sarcoma virus 29 re (cosphate! NM 002355. 2 CA430891. 1 0.8 CGACACACCCTAGCGgacaatttta receptor ceptor (cation accct dependent) mitogen-activated NM 002419. 2 AK090614. 1 1,2 TTCCATTCCATGCAGgaaggctgg protein kinase kinase kinase aagcgc kinase 11 31 proteoglycan 1, NM 002727. 1 BQ051861. 1 0.8 AATCCTCAGTTCAAGgttatcctacg secretory granule caga 32 proteoglycan 1, NM 002727. 1 BQ051861. 1 0.8 GACTGACC 1 1 1 1 1 CCaaagacgag secretory granule aatcca 33 protein kinase C NM 002743. 1 BU631834. 1 1.5 CTCGCAGAAACCCAAccgctccac substrate 80K-H caccgt 34 SEC14-like 1 (S.  CD366399. 1 1.6 GTAGGTAGGTTCGTAgtagggttcg cerevisiae) NM 003003. 1 taggt 35 SEC14-like 1 (S.  NM 003003. 1 AK130317. 1 1.3 TAGGGCTAGTAGGTAGGGCTA cerevisiae) GTAGGTAGGGCTAGTAGGTAG GGCTAGTAGGTAGGGCTAGTA GGTAGGGCTAGTAGGTAGGGC TAGTAGGTAGGGTTCGTAGGT AGGGTTCGTAGGTAGGGTTCG TAG GTAG G GTTAGTAG CG CGT CTGTGCTGCTTCCACCTGGTG CTTCCTGTTCCCAAATCACAAG GGCCTGAAGGTGGTCCCTGCT TTCTCTTTCTCTTTCTCTGTGTC TCAGATG G CGATTTTG CTGACA GCTGCCAAGAAAATGCTTCACT CAACAGTCCTCATGTGCCCAG AGATGTTTATAGAACTGTTTGA ATTGCAGCCATCCCCTGCCCC CTCCCAGGCTGAAGATCTGTT C 1 1 1 1 1 AAGTTGATTCGGGAGT GGCATTCTTTTATACCCAAAGA CTGTAGTGCATCTTGAAGAGCT CAAAGCACATGACCGCACAAA TGCTTACAGGGTTTCCTCCCGA GTAATCCAATCTCACTCCCCTT GTAAGG 36 SEC14-like 1 ( S.  NM 003003. 1 AK130317. 1 TAGGGTTCGTAGGTAGGGCTA I cerevisiae) GTAGGTAGGGTTAGTAGGTAG GGCTAGTAGGTAGGGCTAGTA GGTAGGGTTAGTAGGTAGGGT TCGTAGGTAGGGCTGGTAGGT AGGGTTAGTAGGTAGGGCTAG TAGGTAGGGCTAGTAGGTAGG G CTAG TAG G TAG G TAG GTTAG GTAGGGCTAGTAGGTAGGGCT AGTAGGTAGGGTTAGTAGGTA 1.4 GGGTTCG SEC14-like 1 (S.  NM 003003. 1 AK130317. 1 AGGTAGGGTTCGTAGgtagggcta 37 cerevisiae) 1.5 gtaggt cysteine-rich acidic NM 003118. 1 BG325726. 1 GTGAAGAAGATCCATGAGAAT secreted protein 1,4 GAGAAGCGCCTGGAG 38 (osteonectin) cysteine-rich NM 003118. 1 BG325726. 1 9aC999 protein secreted secreted protein 1,3 tacctc 39 (osteonectin) and acid protein NM 003118. 1, AA325849. 1 CATAGGAGCATTGCACCACCCG secreted secreted protein 40 Î (osteonectin) I 1 1 1 1 CGAGACCTGTGACCTG 1,3 GACAAT 41 cysteine-rich acidic NM 003118. 1 AA325849. 1 GAGAATGAGAAGCGCCTGGAG secreted protein GCAGGAGACCACCCCGTGGAG (osteonectin) CTGCTGGCCCGGGACTTCGAGAAGAACTATAACATGTACATCT TCCCTGTACACTGGCAGTTCG1,3 GCCAGCTGGACCA 42 cysteine-rich acidic NM 003118. 1 AA325849. 1 ng GCACCCCATTGACGGgtacctctcc secreted protein cacac (osteonectin) 43 nuclear factor NM 003204. 1 BM973053.  1.5 CGGGTCAGTGTACAGgaagaggc (erythroid-derived 2) - 1 aggcact like 1 44 nuclear factor NM 003204. 1 BM973053.  1.5 TGCTGTGAGGCAGAGgaatgatgg (erythroid-derived 2) - 1 agaatc like 1 synuclein, alpha (non-NM 000345. 2 NM007308 1.2 TACGAACCTGAAGCCTAAGAAA A4 component of. 1 TATCTTTGCTCCCAGTTTCTTG amyloid precursor) AGATCTGCTGACAGATGTTCCA TCCTGTACAAGTGCTCAGTTCC AATGTGCCCAGTCATGACATTT CTCAAAGTTTTTACAGTGTATC TCGAAGTCTTCCATCAGCAGTG ATTGAAGTATCTGTACCTGCCC CCACTCAGCATTTCGGTGCTTC CCTTTCACTGAAGTGAATACAT GGTAGCAGGGTCTTTGTGTGC TGTGGA I I I I GTGGCTTCAATC TACGATGTTAAAACAAATTAAA AACACCTAAGTGACTACCACTT ATTTCTAAATCCTCACTAIliii TTGTTGCTGTTGTTCAGAAGTT GTTAGTGATTTGCTATCATATA TTATAAGAIIIii AGGTGTCTTT TAATGATACTGTCTAAGAATAA TGACGTATTGTGAAATTTGTTA ATATATATAATACTTAAAAATAT GTGAGCATGAAACTATGCACCT ATAAATACTAAATA 46 synuclein, alpha (non NM 000345. 2 NM_007308 1.4 CCACAGGAAGGAATTCTGGAA A4 component of. 1 GATATGCCTGTGGATCCTGAC amyloid precursor) AATGAGGCTTAT synuclein, alpha (non-NM 000345. 2 NM_007308 1.5 GACCAGTTGGGCAAGaatgaaga A4 component of. 1 aggagcc amyloid precursor) synuclein, alpha (non-NM 000345. 2 L36674. 1,. 2 L36674. 1 1,3 GTGTTCTCTATGTAGgctccaaaac A4 component of caagg amyloid precursor) 50 translationally NM 003295. 1 AA223997. 1 0.5 AAAACCTTTTATGACAG GG G CT controlled tumor GCAGAACAAATCAAGCACATC protein 1 CTTGCTAATTTCAAAAACTACC AG 51 translationally- NM 003295. 1 CA848049. 1 0.7 AGAtcgcggacgggttgtgcctggaggTG controlled tumor G protein 1 52 translationally- NM 003295. 1 CA848049. 1 0.5 TCCGACATCTACAAGatccgggag controlled tumor atcgcg protein 1 53 translational NM 003295. 1 BCO22436. 1 0.6 CCGACATCTACAAGATCCGGG controiled tumor AGATCGCGGACGGGTTGTGCC protein 1 TG 54 translationally- NM 003295. 1 BC040008. 1 0.5 GCGCCGCTCCGGCTGCACCG controlled tumor CG CTCG CTCCGAGTTTCAG G C protein 1 TCGTGCTAAGCTAGCGCCGTC GTCGTCTCCCTTCAGTCGCCAT CATGATTATCTACC 55 TYRO protein NM 003332. 1 BF092099. 1 0.8 GAGGGGCTGCGGAGGcagcgac tyrosine kinase ccggaaac binding protein 56 triosephosphate NM 000365. 3 BI226906. 1 1,3 CATGCTCTGGCAGAGgatggctga isomerase 1 agtcca 57 transgelin 2 NM 003564. 1 AA428309. 1 1,3 ATTAACACCACTGACtgtg ctcacc acaca 58 uroporphyrinogen NM 000374. 2 BQ008745. 1 1.5 GTGTGCCGCTGATTGtggaccctg decarboxylase atgaca 59 cold shock domain NM 003651. 3 BC009744. 1 1,3 GAGGAGGAAGGGAGCGGCAG protein A CAGTGAAGGATTTGACCCCCC TG CCACTGATAG G CAGTTCTCT GGGGCCCGGAATCAGCTGCG CCGCCCCCAGTATCGCCCTCA GTACCGGCAGCGGCGGTTCCC GCCTTACCACGTGGGACAGAC CTTTGACCGTCGCTCACGGGT CTTACCCCAT 60 cold shock domain NM 003651. 3 BC009744. 1 1.5 CCCAACAGAATACAGgctggtgag protein A attgga 61 solute carrier family NM 003982. 2 AW798524.  0.8 TCTCTGCTCTTCAATggtatcatgggg 7 (cationic amino acid absorbing agent, y + system), member 7 62 annexin A2 NM 004039. 1 AV709641. 1 0.9 GACGCTTCTGAGCTaaaagcttcca tgaag 63 annexin A2 NM 004039. 1 BF244428. 1 1.6 AGCTTGGAGGGTGATgtgtggatg aggtca 64 beta-2-microglobulin NM 004048. 2 AV734235. 1 0.7 ATTTG GATTG GATGAATTCCAA ATTCTGCTTGCTTGCIiit1AAT ATTGATATGCTTATACACTTAC ACTTTAT G CACAAAATG TAG G G TTATAATAATGTTAACATGGAG ATGATCTTCTTTATAATTCTACT TTGAGTGCTGTCTCCATGTTTG ATGTATCTGAG CAG GTTG CTCC ACAG GTAG CTCTAG GAGG G CT GGCAAC 65 beta-2-microglobulin NM 004048. 2 BF912731. 1 0.8 AGATAGTTAAGTGGGatcgagaca tgtaag 66 calreticulin NM 004343.  2 CA306742. 1 1.4 GACTCCAAG CCTGAGg cag cag a gaaacaa 67 CD74 antigen NM004355. 1 BQ029721. 1 1.5 ACACCCAGACCCCAGgaagagcc aatgttt 68 HLA-B associated NM 004640. 3 BM980603.  1,4 GCCCCAGGAGGAGAGcagtttaaa transcript 1 1 gatttt 69 SEC24 related gene NM 004922. 1 AW449995.  1.8 GCAGCTGTCTGGAATgCagaggC family, member C (S.  1 agctgga cerevisiae) 70 actinin, alpha 4 NM 004924. 3 CB051741. 1 0.7 CCATCGGGGCAGAAGaacttcatc acagct 71 hemoglobin, alpha NM 000517. 3 H78334. 1, 1.4 CGGTCAACTTTCAAGctccttaagc 1/2 cactg 72 hemoglobin, alpha NM 000517. 3 H55830. 1 1.4 TCAAGGCCGCCTGGGgatgttcctg 1/2 tCCtt 73 cyclin-dependent NM 004935. 1 BI669825. 1 0.8 GTGGCTCTGAAACGGggtgtgCCg kinase agttcc 74 histone deacetylase 1 NM 004964. 2 BF204295. 1 1.7 CAGAGGAGAAGAAAGggtcaagg aggaggt 75 WD repeat domain 1 NM 005112. 3 BCO30541. 1 1.4 CTAAGGAACATCGACgaccacagc cgcttt 76 ubiquitin specific NM 005153. 1 W19112.  1 0.7 ATCGGCTCTTTGCAGtggtctaccat protease 10 cacg 77 v-fos murine FBJ NM 005252. 2 BG541010. 1 0.8 CCTGTCAACGCGCAGgaCttCtgCa osteosarcoma viral cggac oncogenehomolog 78 v-fos murine FBJ NM 005252. 2 BG541010. 1 1.5 GGCAAGGTGGAACAGgagacaga osteosarcoma viral ccaacta oncogenehomolog 79 v-fos murine FBJ NM 005252. 2 BI325046. 1 1.5 GGCAAGGTGGAACAGgagacagg osteosarcoma viral acaacta oncogenehomolog 80 hemoglobin, alpha NM 000558. 3 R91899. 1, 1.7 ACCAAGACCTACTTCcgggtcaact 1/2 tcaag 81 hemoglobin, alpha NM 000558. 3 H58664. 1 1.7 GGAGGCCCTGGAGAGctcctaagc 1/2 cactgc 82 actin protein NM 005718. 2 AI470163. 1 0.7 ATTGCTGTGAAACAGgggtatgata 2/3 complex, subunit tcagc 4, 20kDa 83 B-cell receptor NM 005745. AI962313.  1 1,3 GCAGTTGCCACCTTCCaCgCCtga associated protein 31gcgtgg 84 RNA binding pattern NM 005778. 1 CA488450. 1 0.8 GAGCAGACAAGTTTGactctgaac protein 5 aggaag 85 CD164 antigen, NM 006016. 3 AF299342. 1 0.8 CTGTGACTCCAACCTCACAACC Sialomucin TGTGCGAAAGTCTACCTTTGAT GCAGCCAGTTTCATTGGAGGA ATTGTCCTGGTCTTGGGTGTG CAGGCTGTAATTTTCTTTCTTTA TAAATTCTGCAAATCTAAAGAA CGAAATTACCACACTCTGTAAA CAGACCCATTGAATTAATAAGG ACTGGTGATTCATTTGTGTAAC TCACTGAAGCCAAAATACTATC TTTTAAGATGTCCCACATGGAA GACGCTATTCCAGGATCTTTAA ATTTCCATGGATGCATATAGGA TGTTTGGGAGCATCATCCGTG AAGAAAAAATCAATTAAATCATT GTGTTCAACAGGAATATTTAAA ATATTCTGCATGAATCCTGTGG CTGTCTTATTTTAAATAGCTGC TGCTGTGGGATTATA 1 1 1 1 1 1 1 1 CCTTAACATGCCAAATATAACT TTCTGAAAGTGATGGAAAATGT TGTCTTGTGCAGACAACATCAT GGCTCTTGGCAGTTTA 86 CDI64 antigen, NM 006 016. 3 AF299343. 1 0.8 CAGCCAATTCTACAGctaaaccca sialomucin cagttc 87 ubiquitous alpha NM 006082. 1 BG981396. 1 1.3 CACCCTGAGCAGCTCaccaccca tubulin caccacc 88 talin 1 NM 006289. 2 AI393487. 1 1.4 CCCAGAGTATTAACGCTCCAA GAGTATTATTAACGCTGCTGTA CCTCGATCTGAATCTGCCGGG GCCCCAGCCCACTCCACCCTG CCAGCAGCTTCCAGCCAGTCC CCACAGCCTCATCAGCTCTCTT CACCGIIIIIIGATACTATCTT CCCCCACCCCCAGCTACCCAT AGGGGCTGCAGAGTTATAAGC CCCAAACAGGTCATGCTCCAAT AAAAATGATTCTACCTACAA 89 talin 1 NM 006289. 2 AI393487. 1 1.4 TGCTTCGGAAGGAACgagagctgg aagagg 90 talin 1 NM 006289. 2 AI417760. 1 1.4 AGGAAGAAATGCTTCggaaggaa acidic (leucine-rich) NM 006305. 2 AW577170.  1.4 AGGAGGATGAGGATGgaggatga nuclear 1 agaaggt phosphoprotein 32 family, member A 92 translocase of inner NM 006327. 1 AU142330. 1 0.7 GATGTTGCATGACAGGGACTACT mitochondrial ggcta membrane 23 homolog (yeast) 93 microspherule NM 006337. 3 CD369365. 1 1.5 AACTCTGTGGTGGAGacaggaag protein 1 ctggggc 94 APG7 autophagy 7 NM 006395. 1 BO000091. 1 0.7 CTTGTGCCTCACCAGatccgggga like (S.  cerevisiae) tttCtt 95 acidic (leucine-rich) NM 006401. Y07570. 1 1.5 GAAGTCAGTGAGGAGgaagaaga nuclear atttgga phosphoprotein 32 family, member B 96 acidic (leucine-rich) NM 006401. Y07570. 1 1.4 AG GATGAG GATGAAG ag g agg aa nuclear gaaggtq phosphoprotein 32 family, member B 97 acidic (leucine-rich) NM 006401. 1 BF195216. 1 GAAGTCAGTGAGGAGaggaggaa nuclear gaaggtg phosphoprotein 32 family, member B 98 butyrophilin, NM 007049. 2 BQ929466. 1 1,3 CATTCTTACATGCTGaggaccgga subfamily 2, member gaagtg Al 99 EAP30 subunit of NM 007241. 2 BF525899. 1 1.2 CTGCAGCTGGCAGAGaagaatgg ELL complex ctacgtg 100 coatomer protein NM 007263. BM798704.  1.5 CCACGAGAGTCGGAGgaaggagC complex, subunit 1 epsilon tgaagag 101 soluble galactoside-NM 009587. 1 BG390210. 1 1.2 TACATCAGCTTCCAGaccagal binding lectin 9 gtcatc (galectin 9) 102 soluble galactoside-NM 009587. 1 BG698264. 1 0.8 CTCCAGTGGAACCAGgtttgctgtg binding lectin 9 aactt (galectin 9) 103 CDKNIA interacting NM 012127. AK027287. 1 1,3 TAGAAGCTGGTGGAGgtgaggtcc zinc finger protein 1 Agagat 104 CDKNIA interacting NM 012127. AK027287. 1 1,2 CAGGCACATTCACAGccgcatctgc zinc finger protein 1 cocoa 105 F-box protein 7 NM 012179. BE905968. 1 1 1,3 AATTTTGAAGCTGAGTCAATTC AAGATAATG CG CATATG G CAG AG G G CACAG GTTTCTATCCCT CAGAACCCATGCTCTGTAGTG AATCGGTGGAAGGGCAAGTGC CACAZTCATTAGAGACCTTGTA TCAATCAGCTGACTGTTCTGAT GCCAATGATGCCTTGATAGTGT TGATACATCTTCTCATGTTGGA GTCA 106 WW domain binding NM 012478. 2 BG820375. 1 1,2 CCACCTCCCTACTACCCaccggaa protein 2 gataag 107 px19-likeprotein NM 013237. 2 BM504662.  1,3 CACGCCCGGCTGATGggaatttggt 1 cttgc 108 insulin-like growth NM 000876. BM787853.  1,4 GGAAACAGTGATAAGTAAGCT factor 2 receptor 1 GACCACTTGCTGTAGGAGAAG TTCCAACGTGTCC 109 insulin-like growth BM787853.  1,3 GACGCATCTCAAAACAGAGGG factor 2 receptor NM 000876. January 1 CTGCATTCGAAGAAACCCTTGC TGCTTTAGTCCCGATAGGGTAT TTGACCCCGATATATTTTAGCA IIIIAATTCTCTCCCCCTATTTA TTGACTTTGACAATTACTCAGG TTTGAGAAAAAGGAAAAAAAAA CAGCCACCGTTTCTTCCTGCCA GCAGGGGTGTGATGTACCAGT TTGTCCATCTTGAGATGGTGAG GCTGTCAGTGTATGGGGCAGC TTCCGGCGGGATGTTGAACTG GTCATTAATGTGTCCCCTGAGT TG GAG CTCATTCTGTCTCTTTT CTCIIIIGCTTTCTGTTTCTTAA GGGCACACACACGTGCGTGCG AGCACACACACACATACGTGC ACAGGGTCCCCGAGTGCCTAG G I I I I GGAGAGTTTGCCTGTTC TATGCCTTTAGTCAGGAATGGC TGCACC I Iii I GCATGATATCT TCAAGCCTGGGCGTACAGAGC ACATTTGTCAGTA 1 1 1 1 1 GCCG insulin-like growth AAGGAGGTCAGGCCCCACTCC 110 factor 2 receptor NM 000876. 1 BF222741. 1 1.3 j TTCCTGATTGTTTACAGTCATT GGAATAAGGCATGGCTCAGAT CGGCCACAGGGCGGTACCTTG TGCCCAGGGTTTTGCCCCAAG TCCTCATTTAAAAGCATAAGGC CGGACGCATCTCAAAACAGAG GGCTGCATTCGAAGAAACCCT TG CTG CTTTAGTC C C G GATAG GTATTTGACCCCGATATATTTT AGCATTTTAATTCTCTCCCCCT ATTTATTGACTTTGACAATTACT CAGGTTTGAGAAAAAGGAAAAA AAAACAGCCACCGTTTCTTCCT GCCAGCAGGGGTGTGATGTAC CAGTTTGTCCATCTTGAGATGG TGAGGCTGTCAGTGTATGGGG CAGCTTCCGGCGGGATGTTGA ACTGGTCATTAATGTGTCCCCT GAGTTGGAGCTCATTCTGTCTC TTTTCTCTTTT G CTTTCTGTTTC TTAAGGGCACACACACGTGCG TGCGAGCACACACACACATAC GTGC 111 insulin-like growth NM 000876. 1 BF222741. 1 GTGGCTGATGGAAGAgatccagct factor 2 receptor 1.3 gcctcc 112 adducin 1 NM 014190. 2 CA396829. 1 1,3 AGAAGGGCTCTGAAGagaatctgg (alpha) / adducin 1 acgagg (alpha) eukaryotic translation BM142283.  GTTAACCTCACCCTACAGATGA initiation factor 2-AGATAATAGAGCAAGAAAAAGA AATTGCAGAACTAAAGAAGCAG CTAAACCTCCTTTCTCAAGACA AAGGGGTGAGGGATGACGGAA AGGATGGGGGCGTGGGATGAA 113 alpha kinase 1 NM 014413.  2 1 1.3 AGTGGAC 114 KIAA0040 NM 014656. 1 I CB050264. 1 1,7 ATGGTTCCCAAGTGTgtgtaagtgt gtgta 115 Homocysteine-NM 014685. 1 BG828243. 1 0.8 G G G TG CATCAG CTTTTG TTC CA inducible, CCACCAAGTGCACAAGAGATA endoplasmic reticulum stress-CCTGTGGTCTCTGCACCTGCT CCAGCCCCTATTCACAACCAGT inducible, ubiquitin-like domain member TTCCAGCTGAAAACCAGCCTG CCAATCAGAATGCTGCTCCTCA 1 AGTG GTTG TTAATC CTG GAG C CAATCAAAATTTGCGGATGAAT GCACAAGGTGGCCCTATTGTG GAAGAAGATGATGAAATAAATC GAGATTGGTTGGATTGGACCT ATTCAGCAGCTACATTTTCTGT TTTTCTCAGTATCCTCTACTTCT ACTCCTCCCTGAGCAGATTCCT CATGGTCATGGGGGCCACCGT TGTTATGTACCT 116 NM 014685 homocysteine. 1 BG828243. 1 0.7 GGAAAACATCTCAAGgcctgaagct inducible, gccca endoplasmic stress-inducible reticulum, ubiquitin-like domain member 117 Homocysteine-NM 014685. 1 BG828243. 1 0.8 GTACTACATGCAATAtttagcagcc inducible, actgc endoplasmic reticulum stress-inducible, ubiquitin-like domain member 118 lysosomal-associated NM 014713. 2 AL039105. 1 CTGATTCCATTCTTCTGTTACC protein transmembrane 4 alpha 0.8 GAC11111GACTTCGTCCTCAG TTGCCTGGTTGCTATTAGTTCT CTCACCTATTTGCCAAGAATCA AAGAATATCTGGATCAACTA 119 DAZ associated NM 014764. 1 AU118651. 1 0.8 AGCAGTACCTCCCTAAAGCATT protein 2 TTGAGGTAGGGGGAGGTATCCA TTCATAAAATGAATGTGGG 120 ring finger protein 10 NM 014868. BU626650. 1 1.5 CGAGAGCGCAGGATTGAGATA GAGGAGAACA 121 ring finger protein 10 NM 014868. BU626650. 1 1.5 AGAAACAGGGCAAGTacccagaa gtccaca CAGAAGTCCACATTCCCCTCG AGAATCTACAGCAGTTTCCTGC CTTCAATTCTTATACCTGCTCC TCTGATTCTGCTTTGGGTCCCA CCAGCACCGAGGGCCATGGG GCCCTCTCCATTTCTCCTCTCA 122 ring finger protein 10 NM 014868. 3 BF815780. 1 1,3 GCAGAAGTC 123 ring finger protein 10 NM 014868.  3 BF815780. 1 1,4 CAGGTTCCCATGCAGactttctgctg accc 124 ribosomal protein L4 BM846228.  0.7 TCAGTGAATTAG CAGgtcatcag ac NM 000968. 2 1 tagtg 125 ribosomal protein L4 NM 000968. 2 CB141160. 1 0.7 GTCATCAGACTAGTGCTGAGT CTTGGGGTACTGGCAGAGCTG TGGCTCGAATTCCCAGAGTTC GAGGTGGTGGGACTCACCGCT CTGGCCAGGGTGCTTTTGGAA ACatgtgtcgtg 126 ribosomal protein L4 NM 000968. 2 CD686462. 1 0.6 GCGTGTGCTCGCCCACTGATA TCGGTGTACTCCGAAAAGGGG GAGTCATCTGGCAAAAATGTCA CTTTG C CTG CT G TATTCAAG G C TCCTATTCGACCAGATATTGTG AACTTTGTTCACACCAACTTGC GCAAAAACAACAGACAGCCCT ATGCTG 127 ribosomal protein L4 NM 000968. 2 CD686462. 1 0.7 TGGTCATGTCTAAAGgtcatcgtatt gagg 128 ribosomal protein L5 NM 000969. 2 GATATCATTTGTCAG attg cttatg cc BE879402. 1 0.8 Cgt 129 BAT2 domain NM 015172. 1 AB029019. 2 1,4 CACTTCCACCTTCAAccttagctcca containing 1 gttt 130 adenosine deaminase, NM 015841. 1 AA096321. 1 1,3 TCACACAGGACAGAGgaggcaga RNA-specific gcttctg 131 endoplasmic NM 015913. 2 CA418006. 1 0.8 TTCCCAAATTTCTACagcctctttcct reticulum thioredoxin Ctt superfamily member, 18 kDa 132 hypothetical protein NM 016127. 3 AA576624. 1 0.8 GGAGTCAAACACTGGatgcagaa MGC8721 attttgg 133 tetratricopeptide NM 017775. BE164618. 1 1.5 TTTTGATGCACAGAGctaccaccac repeat domain 19 agtgc 134 hypothetical protein NM 017841. 1 BI553945. 1 0.8 TCI111IGCTAAAGAACATCTG FLJ20487 CAGCACATGACAGAAAAGCAG CTGAACCTCTATGACCGCCTG ATTAACGAGCCTAGTAATGACT GGGATATTT 135 hypothetical protein NM 017865. 2 AK001070. 1 1.6 ACCAGAGACCTTCCCACCTCC FLJ20531 AGGAGAGGAAGAGGGTGAGG AAGAAGAGGACAATGATGAGG ATGAAGAGGAGATGCTCAGTG ATGCCAGCTTATGGACCTACA G 136 ubiquitin B NM 018955. BE708511. 1 1,4 CCCTGACCGGCAAGAcatcactctg gaggt 137 ubiquitin B NM 018955. 2 AA206538. 1 1.4 CAG GTCAAAATG CAGatcttcgtga aaacc 138 ubiquitin B NM 018955. 2 AA206538. 1 1,3 CAG G TCAAAAT G CAG has been agglutinated to agglutine ubiquitin B NM 018955. 2 AA340917. 1 1.4 AGATCTTCGTGAAGACCCTGA CCGGCAAGACCATCACTCTGG AGGTGGAGCCCAGTGACACCA TCGAAAATGTGAAGGCCAAGA TCCAAGATAAAGAAGGCATCC CCCCCGACCAGCAGAGGCTCA TCTTTGCAGGCAAGCAGCTGG AAGATGGCCGCACTCTTTCTGA CTACAACATCCAGAAAGAGTC GACCCTGCACCTGGTCCTGCG CCTGAGGGGTGGCTGTTAATT CTTCAGTCATGGCATTCGCAGT CCCAGTGATG G G G CATTACTCT CACTATAG C CATTTG CCCCAA CTTAAGTTTAGAAATTACAAGT TTCAGTAATAGCTGAACCTGTT CAAAATGTTAATAAAGG ubiquitin B 140 018 955 NM. 2 BU661443. 1 1.4 TCCCTGTGGGTGGACGTGGTT GGTGATTGGCAGGATCCT 141 ubiquitin B NM 018955. 2 BU661443. 1 1,5 GGTTGGCTTTGTTGGgtgagcttgttgtg 142 homoiogog, su sub family NM 018981. 1 AF490904. 1 1,3 CTTAGTGGCATGTTGgatggtcttgt om taat C, member 10,143 major NM 019111. 2 AA505585. 1 AGAGAGAAGATCACTGAAGAA histocompatibility ACTTCTGCTTTAATGACTTTAC complex, class II, DR AAAG CTG G CAATATTACAATC C alpha TTGACCTCAGTGAAAGCAGTCA 0.8 TCTTCAGCGTTTTCCAGCCCTA TAGCCACCCCAAGTGTGGTTAT GCCTCCTCGATTGCTCCGTACT CTAAC 144 major NM 019111. 2 AA505585. 1 0.8 ATCTAGCTGGCTTTCcctgtctattg class II, 9 complex, I, DR CCtt alpha 145 major NM 019111. 2 CD686254. 1 TCAGAGACAGTCTTCCTGCCC histocompatibility complex, class II, DR alpha 0.7 AGGGAAGACCACCTTTTCCGC AAGTTCCACTATCTCCCCTTCC TGCCCTCAACTGAGGACGTTTA CGACTGCAGGGTGGAGCACTG GGGCTTGGATGAGCCTCTTCT CAAGCACTGGGagtgtgatgctccaag CCCtCtC 146 KIAA1191 protein NM 020444. 2 ', BE313670. 1 1.7 GCAGCAGGATCACAGgtggagga aggagaq 147 KIAA1191 protein NM 020444. 2 BI254429. 1 1.5 GCAGCAGGATCACAGaacagacc caggaaa 148 mesoderm induction NM 020948. 1 AY124186. 1 0.7 TTTCTCACACAGGCAtactccaaat early response 1 gCtC 149 Actinin, alpha 1 NM 001102. 2 BG036045. 1! 0.7 AACCACTTTGACCGGggagaagc agaattt 150 membrane-spanning NM_152851 GGAACTCTCTCTCTGATGCTGA 4-domains, subfamily NM 022349. 2. 1 0.8 TTTGCACTCTGCTGGAATTCTG A, member 6A CCTAGCTGTGCTCACTGCTGT GCTGCGGTGGAAACAGGCTTA C myelin protein Zero- TGCCCTGGCATTCTGGCAGAG AATCCTCACCAGTTCTCACCAA CCTTCCCCCCAGGCAAGGGCA GCTGCCAGCATGGTGCTCTGC CAGGACAGGTTTCCCTGAAGG AAGCTGCTCACACTGAGATGA GCCTCTCAGGGCAGGACCTCT TCCCAAGCCCTGCACACCCAC like 1 151 024 569 NM. 2 AI693779. 1 0,9 CCCTGCAGCCCTTTTGGCTC 152 mouse GCTTCAGTCCGCCGAgagcagtac mouse limbimb-bg ud to NM 030915. 1 W45195. 1 1.1 cgtgtg heart Bene heterogeneous CTGACCCAGATAAAACAAAAAG TGGATTCTCTCCTGGAAAACCT 153 nuclear GGAAAAAATGGAAAAGGAACA ribonu cleoprotein C NM 031314. 1 CF128443. GAGCAAACAAGCAG ib (C1 / C2) polymerase (RNA) II NMG 002694 GGTGGGGGTGGAAGCagccgca (DNA directed) polypeptide C C15433kDa NM 032940. 1. 2 1,3 ggagcaag caspase 4, apoptosis-NM_001225 155 related cysteine NM 033306. 1. 2 1,2 TGTTCCCTATGGCAGaaggcaacc protease acagaa 156 major NM 033554. 2 BU621846. 1 0.8 GTCGCTGAGAGCCTCTTCCTG histocompatibility CCCAGAACAGATTACAGCTTCC complex, class II, DP ACAAGTTCCATTACCTGACCTT alpha 1 TGTGCCCTCAGCAGAGGACTT CTATGACTGCAGGGTGGAGCA CTGGGGCTTGGACCAGCCGCT CCTCAAGCACTGGG 157 major NM 033554. 2 BU621846. 1 0.7 ACCCTCATCTGCCACATTGACA histocompatibility AGTTCTTCCCACCAGTGCTCAA II, CGTCACGTGG complex, class DP alpha 1 158 major NM 033554. 2 BU621846. 1 0.7 AAGGAGCCTGTGGAGctgggcca histocompatibility gcccaac complex, class II, DP alpha 1 159 FK506 binding NM 054014. 1 NM 000801 GCTCCCTGTTCTTGGatctgccatg protein 1A, 12kDa. 2 0.8 gaggq 160 intracellular chloride! NM 001288. 3 BG491600. 1 CCAGGGACGGCCACTTCCTGG channel 1 TCCCCGACGCAACCATGGCTG AAGAACAACCGCAGGTCGAAT 0.8 TGTTCGTGAAG 161 intracellular chloride NM 001288. 3 AV683308. 1 GGGCAGCTCCCATTCctgctgtatg channel 1 0.7 gcact 162 vacuolar protein NM 080631. 1 BX648347. 1 ACCGGAGGGAAGAAGgtgtgctca sorting 41 (yeast) 1,4 gtgaag 163 zinc finger protein 1 BCO53361. 1 1.5 μGGAAAGGAGAAGGAATAAGA 384 NM 133476. 2 CGGCAGGAGGAAGAGAGAGAGA 1 GAGG 164 chromosome 19 open NM 138774. 2 AI375989. 1 1,4 AC CTCATCTCG G CCAg tg ctg cct reading frame 22 ggagg 165 nuclear receptor NM 000176. 1 1 X03348. TTCCTAAGGACGGTCTGAAGA 1 subfamily 3, group C, GCCAAGAGCTATTTGATGAAAT member 1 TAGAATGACCTACATCAAAGAG (glucoc ucocorticoid CTAGGAAAAGCCATTGTCAAGA receptor) GGGAAGGAAACTCCAGCCAGA ACTGGCAGCGGTTTTATCAACT GACAAAACTCTTG 166 Nucleosome NM 139207. 1 BU620919.  1 0.8 AGTGATATGGTTCAG9aacacgat assembly protein 1- gaacct like 1 167 1 NM 139207. 1 AU117948. 1 0.8 ATGAATATTTTACAAATGAAGT Nucleosome GCTGACAAAGACATACAGGAT assembly protein 1- GAGGTCAGAA like 1 168 Nucleosome NM 139207. 1 AU117948. 1 0.8 GCTGGCCAGCCTATGagttttgtctt assembly protein 1-agaa like 1 169 Nucleosome NM 139207. 1 AK122670. 1 0.8 CCTGCCTAGGGTAGTTAAAAG assemblyprotein 1- ACGAGTGAATGCTCTCAAAAAC like 1 CTGCAAGTTAAATGTGCACAGA TAGAAGCCAAATTCTATGAGGA AGTTCACGATCTTGAAAGGAAG TATGCTGTTCTCTATCAG 170 TAF15 RNA NM 139215. 1 BF812650. 1 1.3 GCTATGGTGGGGACAGAGGAG polymerase II, TATA box binding protein GCGGCTATGGAGGAGACCGAG GAGGTGGCTATGGAGGAGATC (TBP) -Associated GAGGTGGCTATGGAGGAGACC factor, 68kDa GAGGTGGAGGCTATGGTGGAG ACCGAGGAGGCTATGGAGGAG ATCGAGGAGGTTACGGAGGAG ATCGAGGAGGTTATGGAGGAG ATCGAGGAGGCTATGGAGGAG ACAGAAGCCGGGGGGGCTATG GAGGAGACCGTGGTGGTGGCA GTGGCTACGGTGGAGACCGAA GTGGAGGCTATGGAGGAGACA GGAGTGGTGGCGGCTATGGAG GAGACCGAGGTGGGGGCTAC GGAGGAGACCGAGGTGGCTAT GGAGG 171 TAF15 RNA NM 139215.  1 BF812650. 1 1.3 GGGACAGAGGCGGCGgctatggt polymerase II, TATA box binding protein ggggaca (TBP) -Associated factor, 68kDa GACCACAGCAATGACCAGCCC TCATTAGGGCCCTGGATGATTT TTG GT CTAATAAC G CATG CGAT TGTTGATGIIIIIIGGTCAGAG GGTATGAACAGGAAGAATTAAA TG CAG CAG G CTTTATTTTAAAT GCCGATTCACATTACTCTGTTC AAGCTGCGTTGAGATGTTAAAC TGGCTTACTATAGACTTCGTAA AAATGGCTCCAGAAAAGTAACA AACTGAAATCTTTGAGATCACA CAGGTTGGAAATATGTACATAA CTG CACAAG GTGTCAATTCTG C TCTACAGTGCAGTTTTAGTCAG iiiIAGTTGCATAGGTTTCCAT TGTATTTATAGTCTGTTTATGCT AAATCTGGCCAAAGATGAACAT TGTCCACCACTAAAATGCCTCT GCCACTTTGAATTCTGTGCTAA 172 DEAD (Asp-Glu- NM 001356. BE000596. 1 GTGGCCAGAATGCGGTG Ala-Asp) box polypeptide 3, X-linked ATCAAAACGCTCCATC I CAGTGGCATAGGAAGACGGCA AAAATTTCCTAAAGTGCA 173 girlfriend II NM 152727. AK094867. 1 1,4 ACCCCTTCTG CTCAGgtgtgg atgg tattg 174 heat shock 70kDa NM 153201. 1 BU731317. 1 0.8 ACTCGTATCCCCAAGattcagaag protein 8 CttCtC 175 hypothetical protein NM 153233. 1 BCO38360. 1 1.4 ACTGGCCAGGACCTGgaagcaga FLJ36445 cacctct 176 dynein, cytoplasmic, NM 001378. 1 U39575. 1 1.4 GGAAGACAAAGAAGGagagattca intermediate agcagg polypeptide 2 / dynein, cytoplasmic, intermediate 1 polypeptide 2177 tropomyosin 3 NM 153649. 1 BM006741.  1,3 TGATGAGAGTGAGAGgcagagac 1 ccgtgct 178 tropomyosin 3 NM 153649. 1 BM006741.  1,3 TGATGAGAGTGAGAGagaggatgctg 1gaccag 179 EST BE881352. 1 - BE881352. 1 1,3 TCAATATAAAACCCCcacctaccac acatt 180 EST AW368637. 1 - AW368637.  1.4 CTTAAACTCCAGCACcatcatagcc 1 accat 181 eukaryotic translation NM 001402. 4 AU146228. 1 1.5 CACCAATGGAAGCAGtggacaag elongation factor 1 aaggctg alpha 1 182 eukaryotic translation NM 001402.  BU580573. 1 0.8 CATCAAAGCAGTGGACAAGAA elongation factor 1 alpha 1 GGCTGCTGGAGCTGGCAAGGT CACCAAGTCTGCCCAGAAAGC TCAGAAGGCTAAATGAATATTA TCCCTAATACCTGCCACCCCAC TCTTAATCAGTGGTGGAAGAAC GGTCTCAGAACTGTTTGTTTCA ATTGGCCATTTAAGTTTAGTAG TAAAAGACTGGTTAATGATAAC AATGCATCGTAAAACCTTCAGA AGGAAAGGAGAATGTTTTGTG GACCACTTTGGTTTTC 1 I 1 1 G G CGTGTG CAGTTTTAAGTTAT TAG 11111 AAAATCAGTACTTTT TAATGGAAACAACTTGACCAAA AATTTGTCACAGAA I I I I GAGA CCCATTAAAAAAGTTAAATGAG 183 NM 001402 eukaryotic translation. AA595862. 1 0.8 TGCGGTGGGTGTCATCAAAGC elongation factor 1 alpha 1 AGTGGACAAGAAGGCTGCTGG AGCTGGCAAGGTCACCAAGTC TGCCCAGAAAGCTCAGAAGGC TAAATGAATATTATCCCTAATAC CTGCCACCCCACTCTTAATCAG TGGTGGAAGAACGGTCTCAGA ACTGTTTGTTTCAATTGGCCAT TTAAGTTTAGTAGTAAAAGACT GGTTAATGATAACAATGCATCG TAAAACCTTCAGAAGG 184 NM 001404 eukaryotic translation. 3 AA206367. 1 0.7 CTGAGTCCAGATTGGCAGGTG elongation factor 1 GACTACGAGTCATACACATGG gamma CGGAAACTGGATCCTGGCAGC GAGGAGACCCAGACGCTGGTT 1 eukaryotic translation NM 001404. 3 AA206367. 1 0.6 CAGCATGTGGGCAAAGCCTTC 185 elongation factor 1 AATCAGGGCAAGATCTTCAAGT gamma GAACATCTCTTGCCATCACCTA G 186 eukaryotic translation NM 001404. 3 BQ375267. 1 0.8 GTTCTAGAGCCTTCTTTCCGCC elongation factor 1 AGGCCTTCCCAATACCAACCG gamma CTGGTTCCTCACCTGCATTAAC CAGCCCCAGTTCCGGGCTGTC TTGGGCGAAGTGAAACTGTGT GAGAAGATGGCCCAGTTTGAT Gctaaaaagtttgcagag 187 eukaryotic translation NM 001404. 3 BU783548. 1 0.6 ATTTAAGCGCAAGTACTCCAAT elongation factor 1 GAGGACACACTCTCTGTGGCA gamma CTGCCATATTTCTGGGAGCACT TTGATAAGGACGGCTGGTCCC TGTGGTACTCAGAGTATCGCTT CCCTGAAGAACTCACTCAGAC CTTCATGAGCTGCAATCTCATC ACTG 188 eukaryotic translation NM 001404. 3 BE502067. 1 0.6 TGGACAAGCTGAGGAAGAATG elongation factor 1 gamma CCTTCGCCAGTGTCATCCTTTT TGGAACCAACAATAGCAGCTC CATTTCTGGAGTCTGGGTCTTC! CGAGGCCAG 189 eukaryotic translation NM 001404. 3 BE502067. 1 0.6 CAGGTGGACTACGAGTCATAC elongation factor 1 ACATGGCGGAAACTGGATCCT gamma GGCAGCGAGGAGACCCAGAC GCTGGTTCGAGAGTACTTTTCC TGGGAGGGGGCCTTCCAGCAT GTGGGCAAAGCCTTCAA 190 eukaryotic translation j GAGCTTGCCTTTCCGctgagtcca elongation factor 1 NM 001404. 3 BE502067. 1 0.6 gattgg gamma 191 eukaryotic translation NM 001404. 3 Î AAGGAGGAGAAAAAGGCGGCT elongation factor 1 GCCCCTGCTCCTGAGGAGGAG gamma ATGGATGAATGTGAGCAGGCG CTGGCTGCTGAGCCCAAGGCC AAGGACCCCTTCGCTCACCTG BG533219. 1 0.8 CCCAAGAG 192 eukaryotic translation NM 001404. 3 BG615194. 1 0.7 TTCCGCCAGGCCTTTCCCAATA elongation factor 1 CCAACCGCTGGTTCCTCACCT gamma GCATTAACCAGCCCCAGTTCC GGGCTGTCTTGGGCGAAGTGA AACTGTGTGAGAAGA 193 eukaryotic translation NM 001404. 3 BG702200. 1 0.8 GTTCACGGGAAGAGAAGCAGA elongation factor 1 AGCCCCAGGCTGAGCGGA gamma 194 O-linked N-AW002377.  ; AAAGAATATCTAGCCctctgttcaac acetylglucosamine NM 181673. 1 1 0.8 Acca (GIcNAc) transferase 195 tyled N-AW002377.  0.8 CACGAAAAGTAGCCGctctggtga acetylglucosamine NM 181673. 1 agct ace (GIcNAc) transferase 196 WD ana AB028960. AK023778. 1 1,3 CCAATTTCTTTGGCAgcaacgctca tetratricopeptide gtata repeats 1,197 actin, gamma 1 NM 001614. 2 CD687776. 1 1,2 CATGGAGAAGATCTGggcgcacc actggca 198 arachidonate 5- NM 001629. 2 BX366320.  1 1,3 AGAGAGAACGCAGAGgccacgga lipoxygenase-agccctq activating protein 199 Homo sapiens AK026373. 1 AV725084. 1 1,2, ATTTCAACAGCTGAGgaaggtgtctt cDNA: FLJ22720 fis, gctg clone HS114320 Homo sapiens AK026373. 1 BQ276346. 1 TTTGGCAGGAAGGTGTCTTGC 200 cDNA: FLJ22720 fis, 0.8 TGCAGGTAACTAATGAAGAAGT clone HSI14320 GGTCAACCACAGAGTCTTCAA GAAATAAGAAATTCTGTACCAT CTGAAAGTAGTTCTTGTTGGTG CCTTCATTTAAAAAGCACTCTT TAAAATAAAAGGGAAATGTTTT CTGATAAAA 201 DKFZp586K2322 AL080113. 1 AV751235. 1 0.8 TTTATTTTCAAATGCAGTGTAG (NM_006386 or NM 030881 AGCTAGATTAAAAGCAACTCTT) TG CCACCTACTCTG C CCTTTTG GCAAAGTTACCTTGAACAAAGA ATCTTAAG G GTTTATTAAGAAC TCTTTAIIIICTTCATACCCTGT TCTCTGCAGTGCTTTCTAACAG CTTCTGGGTGCAGA IIII CTTC GG CTT CATCCTTTTG CACTCAG ATTACAG GTAG GTAGTG CTTAA GAAAAGTCATGGAGGACTAAA GCCTAAGTCCTTTTCACTTTTC CTCCATCTGAAGGTAGGTGAG TTCATCCTCTTCATAGTAATGC TGIIIIACCAAGACTTTATAGC AGATG GACCCAGAAAGAATTTT CTGCTATTGTGTTCACTACAAC AGGATAGGGACATCAGACAGC CCCAGAAACCCCTTCCAGATCT GATATGGGACTATTAA IIIII AT GCTGTTAATTGGTATTCATTCA CAATGCAGTTGAAGGGGGAAG GCTCCACTGCATTCTTTG 202 calmodulin 2 ATTGCAAAACGGGTGtattatccag (phosphorylase NM 001743. 3 BF701704. 1 0.8 • tact kinase, delta) 203 calpain, small subunit Î 1 / calpain, small CCTTTGAGGCAGCAGatgaaagtg subunit 1 NM 001749. BE907701.  1 1.4 ggaaca 204 Cysteinyl-tRNA AAACAGGAACAAGAAgcagcaaa synthetase NM 001751. 3 AK125503. 1 1.5 gctggcc 205 CD97 antigen NM_078481 ATACCGTCTGTGAAGatgtggacg NM 001784. 2. 1 1,3 agglucos 206 CD97 antigen NM 001784. 2 BIO28545. 1 1,2 CAGGCTGGAAGCCCAGACACG GAATCCCGGATAACCAAAAGG ACACTGTCTGTGAAG 207 Homo sapiens BCO34141. 1 AV688287. 1 1.4 CAAGGGACCAAGGTGgagcagttg immunoglobulin constant kappa aaatct, mRNA 208 ferritin, heavy NM 002032. 1 BG248923. 1 0.6 TGTCTCTGGGGATCCCTAGTAT polypeptide 1 AACACATGCA 209 Homo sapiens BCO53635. 1 AI806846. 1 1,5 CCGGCTGGTCAAAGTgtgggtgct chromosome 4 open Î ggcagc reading frame 9 210 Homo sapiens T-cell K02885. 1 U85050. 1 0.8 GGTTCGGGGACCAGGttaaccgtt receptor active betagtagag chais V-D-L2-C-beta- 1 (TC (TCRB) mRNA 211 Homo sapiens T-cell K02885. 1 AF043180. 1 0.8 GAGGACCTGAACAAGGTGTTC receptor active beta- CCACCCGAGGTCGCTGTGTTT drain - GAGCCATCAGAAGCAGAGATC 1. 2-C-beta-1 bet (TC (TCRB) TCCCACACCCAAAAGGCCACA mRNA CTGGTGTGCCTGGCCACAGGT ATCTTCCCTGACCACGTGGAG CTGAGCTGGTGGGTGAATGGG AAGGAGGTGCACAGTGGGGTC AGCACGGACCCGCAGCCCCTC AAGGAGCAGCCCGCCCTCAAT GACTCCAGATACTGCCTGAGC AGCCGCCTGAGGGTCTCGGCC ACCTTCTGGCAGAACCCCCGC AACCACTTCCGCTGTCAAGTCC AGTTCTACGGGCTCTCGGAGA ATGACGAGTGGACCCAGGATA GGGCCAAACCCGTCACCCAGA TCGTCAGCGCCGAG 212 Homo sapiens T-cell K02885. 1 AF317590. 1 1,2 TCTGTGCCAGCAGCCTAGACAGAGAGAGACAGAGAGAGOAGA BACTIVE ACTIVE BACTERATORS V-D-J-BETA-1. 2-C-beta-1 (TCRB) mRNA 213 Homo sapiens T-cell K02885. ATATCTCTGCAGCGTcgggggtca receptor active beta- AF327908. 1 0.7 atctqg flesh - 1. 2-C-bet beta-1 (TC RB) mRNA 214 Homo sapiens T-cell CTGCAGTGCTAGAGAtccggggtc receptor active beta- K02885. 1 AF327022. 1 0.7 ccatca flesh V-D-J-beta- 1. 2-C-beta-1 (TCRB) mRNA 215 Human T-cell CCAGATCGTCAGCGCcgaggcctg receptor active beta- M12886. 1 BCO36926. 1 0.8 gggtag chain mRNA 216 Human myosin-IXb CCTCTGGCCTCACAGtgtcccagg mRNA U42391. 1 BF948234. 1 1,3 agcaca 217 glutathione TGGAACTTCACCAAGttcctcatc9 a peop NM 002085. 1 BI254515. 1 0.8 caag (Phospholipid hydroperoxidase) 218 Poly (A) binding protein, cytoplasmic TTCCAACTGTTTAAAattgatcaggg 1 NM 002568. 1 AA033548. 1 0,9 acca 219 CAGTATGGTGAGGAGgtgtgagag prohibitin NM 002634. 2 BI261762. 1 1.4 ggtcca 220 BMO 14639.  TCAGAGTGGAAGCAGgtgagaatg prohibitin NM 002634. 2 1 1.6 gagggg 221 BMO 14639.  CTTTGGGCGAGGAGAgtgtgagag prohibitin NM 002634. 2 1 1.4 ggtcca 222 GCGAGGAGAGTGCGTgtgtgaga prohibitin NM 002634. BE536369. 1 1.4 gggtcca 223 TTCCAGAAGCCAGAGAGACCA AGTGTTATGTAAGAAGTAGTGT spermidine / spermine CGGCTGTGTAGAACCACTGAC NI-acetyltransferase NM 002970. 1 CD108391. 1 0.8 TACACAGGCCGAAGTTACTGA GAACTTGGACAGAAAAAATAGC CAGCAAGTGTTCAAACTACTGA GG TTAGATATG CTG CACTTAAGAATACTAG GGC AGGTT 224 secret protein secreted protein NM 003118. 1 BG424815. 1 1.4 CAGGAGACACCCCG (osteonectin) 225 or NM 003295. 1 BG284235. 1 0.6 TTCTTTATTGGTGAAAACATGA ontr ied tumor ATC CAGATG G CATG GTTG CTCT controlled ATTG GACTACCGTGAG GATG G protein 1 TGTGACCCCATATATGATTTTC TTTAAGGATGGTTTA 226 translationally- NM 003295. 1 BG284235. 1 0.7 GAAATGGAAAAATGTtaacaaatgt controlled tumor ggcaa protein 1 227 translationally- NM 003295. 1 CD641954. 1 0.7 TTATTTTGGATCTATCACCTGT controlled tumor CATCATAACTG G CTTCTG CTTG protein 1 TCATCCACACAACACCAGGACT TAAGACAAATGGGACTGATGTC ATCTTGAGCTCTTCATTTATTTT

  GACTGTGATTTATTTGGAGTGG AGGCATTG 1 1 1 1 1 AAGAAAAAC ATGTCATGTAGGTTGTCTAAAA ATAAAATGCATTTAAAC 228 translationally- NM 003295.1 AV749932.1 0.6 CGTCGTCTCCCTTCAGTCGCC controlled tumor ATCATGATTATCTACC contro protein 1 229 translationally- NM 003295.1 AV749932.1 0.6 GGGACCTCATCAGCCacgatgag controlled tumor atgttct protein 1 230 vasodil ator- NM TTTATTTCCTACCAGcagg agg ag stimulaulated ccagag phosphoprotein 231 cold shock domain 1,2 CCCAAGGTACCGTAGcaggggac protein A NM 003651.3 BG739968.1 ctcctcg 232 cold shock domain 1.5 AATAACCCACGGAAATATCTGC protein A NM 003651.3 BE935120.1 .GCAGTGTAGGAGATGGAGAAA CTGTAGAGTTTGATGTGGTTGA AGGAGAGAA 233 cold shock domain 1.5 GTATTTGTACATCAGactgccatca protein A NM 003651.3 BE935120.1 agaag 234 chromosome 22 open 1.5 GAAGCAGAAGAGGTGTGAAAG reading frame 19 NM 003678.2 AK122673.1 AAGGTGCTGCTGGGAGGGGA GTCTGACAACCCAGC 235 Homo sapiens 0.8 ACGACATCGCAGAAGGTGGCT ve mb assoo CGGAAATTCTGGTGGAAGAAC membrane protein 8 GTGAAGATGATTGTCCTTATCT (endo brevin) NM 003761.2 BG623073.1 GCGTGATTG11111ATCATCAT CCTCTTCATTGTGCTCTTTGCC ACTGGTGCCTTCTCTTAAGTAA CAGGGAACCTCTCCCACCTGC CCTTC IIII CAGGGACAACCCT CCATAAATGTGTGCCAAGAGG GTCTCCTTTCCTGTCTTCCTCT ACAGAGAATGCTGCTCGGTCC TCCTACCCCTCTTCCCGAGGC CTGCTGCCACGTTGTATGCCC CAGAAGGTACCTTGGTCCCCC GGAAGGAGAGAA 236 Homo sapiens NM 003761.2 BG623073.1 0.7 GATCTGGAAGCCACAtctgagcact vesicle-associated membrane protein 8 tcaag (endobrevin) 237 CASPB and FADD- NM 003879.3 BI871546.1 1.3 AGTACAAGCAGTCTGgtggatgga like apoptosis regulator 238 atggaa beta-2-microglobulin BM NM 004048.2 831738. 0.8 AG GTTTACTCACGTCATCCAG C 1 AGAGAATGGAAAGTCAAATTTC CTGAATTGCTATGTGTCTGGGT TTCATCCATCCGACATTGAAGT TGACTTACTGAAGAATGGAGA GAGAATTGAAAAAGTGGAGCA TTCAGACTTGTCTTTCAGCAAG GACTGGTCTTTCTATCTCTTGT ACTACACTGAATTCACCCCCAC TGAAAAAGATGAGTATGCCTGC CGTGTGAACCATGTGACTTTGT CACAGCCCAAGATAGTTAAGT GGG 239 beta-2-microglobulin NM 004048.2 BM831738 . 0.7 TG GAG GCTATCCAGCgtactccaa 1 agatam 240 Guanine nucleotide NM004125.2 BC015206.1 0.6 GTGGAGAGGATCAAGgtctctcag binding protein, gcagct gamma 10 241 BCL2-associated NM 004323.2 BI826041.1 1,2 TGACTGTCACCCACAgcaatgaga athanogene agcacg 242 c-src tyrosine kinase NM 004383.1 BG953215 .1 1,1 CCTCAAGTTCTCGCTagatgtctgc gaggc 243 HLA-B associated NM 004640.3 CB148695.1 1,4 GCCCCAGGAGGAGAGgtgagctg transcript 1 aagatgg 244 family with sequence NM 004699.1 AA024425.1 0.8 CACGGGGGAAGAGTGgaccactct similarity 50, tcaact member A 245 family with sequence NM 004699.1 AA584911 .1 1.6 TCAAGAGTGAGTGTTtgcggagtca si gaggc similarity 5 50, member A 246 GNAS complex locus NM 000516.3 BU784018.1 1.5 CTACTCCTGAG GATG gtgtgtatg g CttCC 247 GNAS complex locus NM 000516.3 BG911454.1 1,4 GACGCCAGGGTTTGGgtgctggag aatctg 248 hemoglobin, alpha NM 000517.3 AA343446.1 1.7 TGCTTCTCCCCGCAGgatgttcctgt 1/2 CCtt 249 WD repeat domain 1 NM 005112.3 BX648190.1 1.2 AAGTTCACAATTG G Cg a cca cag c ccctt 250 retinoblastoma NM 0 05610.1 BF475362.1 0.8 TTTATTCATGGTGGTCATACTG binding protein 4 CCAAGATATCTGATTTCTCCTG GAATCCCAATGAACCTTGGGT GATTTGTTCTGTATCAGAAGAC AATATCATG 251 small EDRK-rich NM 005770.2 BG435668.1 0.9 CCGTCGCCATGACCCgcggtaacc factor 2 agcgtg 252 NM 005801.2 putative translation initiation factor BG655736.1 0.7 CCTTTGTGCTTGCAGaagtttgcctg caat membrane 253 NM 005898.2 AA437165.1 0.8 AACAGCTTCAAACAGt99 tt99 cactus, tacc chromosome 11, surface marker 1 254 capping protein (actin NM 006136.1 BG702980.1 0.7 filament) Z-line muscle, alpha 2 AGCAAAAAA 1 1 1 1 1 Ggaatggtcgtt ggag 255 Microspherule NM 003333.3 CB110581.1 1.4 AACTCTGTGGTGGAGgtgagctgg protein 1 ggagga 256 Transforming, acidic NM 006342.1 BM313828. 1.3 ACAGTGGAGCAGAAGgtgggtgcg coiled-coil protein Containing 1 qgaagc 3257 acidic (leucine-rich) NM 006401.1 AI446778.1 1.2 AAGACGAGGACGATGAGGATG GTGAAGAAGAGGAGTTTGATG nuclear phosphoprotein 32 AAGAAGATGATGAAGATGAAG family, member B 258 ATGTAGAAGGGGATGAGGACG ACGATGAAGTCAGTGAGGAG acidic (leucine-rich) NM 006401.1 AI446778. 1 1,3 AGGAGGAGGACGAAGaaggaga nuclea ragatagagg phosphoprotein 32 phosp family, member B 259 granulysin / granulysin NM 006433.2 BI838502.1 0.8 GATAAGCCCACCCAGagaagtgttt ccaat 260 lysosomal associated BQ006415.1 1,4 aqatgctccaqaaggtgagtgtggctgcag multispanning membrane protein 5 NM 006762.1 261 lysosomal associated BQ006415. 1 1.5 AAGATGCTCCAGAAGgtgagtgtgg multispanning 99 protein membrane 5 NM 006762.1 ctgca 262 transforming growth AI610679.1 1,4 CGGGCTACNANATGCGCTTGG factor, beta 1 GGGGAGCCAGGACGGAGGAA (Camurati-GAGGAGAGAGAAAGAGA Engelmann disease) NM000660.1 263 myosin IF NM 012335.2 BF823263.1 1,3 GTGGACAATGGGAAGctgctggaa gggcct 264 ribosomal protein BM826692. 0.8 AAGCCTACAAGAAAGTTtgcctatct L13a NM 012423.2 1 gggg 265 glutathione SN59567.1 1.4 CATGCTGTTCCTTCCTCGCCAC transferase pi NM 000852.2 CCTCTGCTTC 266 chromosome 11 open BE041814.1 0.8 TCGCGGGGCAAAATGgagctcga reading frame 10 NM 014206.1 ggccatg 267 integrin, alpha X AA251543.1 1, 4 TGCGACCGCCTACAGgtgacctcc (p150)), (aaagct antigen (p 15 pha alpha polypeptide) 268 NM 000887.3 ring finger protein 10 NM 014868.3 BM471027. 1.3 ACTTTCTGCTGACCCCTCTGTC 1 ACCCACTGCCAGTCAGGGCAG TCCCTCATTCTGCGTTGGGAGT CTGGAAGAAGACTCTCCCTTC 269 ribosomal protein L4 NM 000968.2 CB164625.1 0.7 GGTGCTTTTGGAAACatgtgtcgtg gaggc 270 KIAA0690 NM 015179.2 BG506709.1 TCTCTGGGCAAGCAGaaagcaaa 1.6 aggtgat 271 KIAA0690 NM 015179.2 BG506709.1 1.6 GAATACAAGGCCAAGaaagcaaa aggtgat 272 bridging integrator 2 NM 016187.1 AK093638.1 0.9 AAGGCCATCGTATGGaataatgatc tCCtt 273 ribosomal protein NM 000990.2 BG824148.1 0.8 CAACTTCGACAAATAccacccagg L27a ctactt 274 ribosomal protein NM 000990.2 BI906450.1 0.8 gccacccaggctactttgggaaagt L27a 2 75 ribosomal protein NM 000990.2 CB119057.1 0.7 GCCACGGCCGCATAGgcaagcac L27a cggaagc 276 ankyrin repeat NM 017664.1 BCO39715.1 0.7 GGAGCATTCCATATAGAAACTG domain 10 CTGAAACTGCCACAGGTGCTT CTCCGAAAACCTTACAGTTGTG GCATTGAATGTTCAGTATCGCT TCCTTTCTGCACACG 277 ribosomal protein NM 000992.2 BQ335217.1 0.7 CCAAGTTCCTGAGGAacatgcgctt L29 ribosomal protein tgcca 278 NM CACCPTCTGATTCTAATAGAGA S13 GCCGGATTCACCGTTTGGCTC GATATTATAAGACCAAGCGAGT CCTCCCTCCCAATTGGAAATA 279 CNDP Dipeptidase 2 NM 018235.1 AW502844. 1.5 CACAGCAGCATCAAGgtggagtgc (1 agcaac metallopeptidase M20 family) 280 ribosomal protein NM 001021.2 BE731466.1 0.5 AATTATGTTCCTGAGgtctcagcctt GGAT 281 ribosomal protein S17 NM 001021.2 AV752729.1 0.6 GCCGCGTTCCACCAAAACCGT S17 GAAGAAAGCGGCCCGGGTCAT CATAGAAAAGTACTACACGCG CCTGGGCAACGACTTCCACAC GAACAAGCGCGTGTGCGAGGA GATCGCCATTATCCCCAGCAAA AAGCTCCG 282 sulfatase 2 NM 018837.1 AB033073 .2 1, 5 GCGAGAGTGTGTCGAgtgagtgtg cgtctg 283 ubiquitin B NM 018955.2 BG286180.1 1, 6 G AAG GCG GAAAAGAG gtca aa atg cagatc 284 ubiquitin B NM 018955.2 BG286180.1 1,4 GGTATCCGCTAACAGgtcaaaatg cagatc 285 glycogen synthase NM 019884.1 BQ927367.1 1, 3 ACTTCAGTGCTGGTGgtgagggCa kinase 3 alpha tagcct 286 KIAA1185 protein NM 020710.1 BQ352354.1 1.1 GTGTTAGGAGCGGAGataccttca cttgct peptidyl 287 NM 021130.1 AA340318.1 0.8 CGCGTCTCCTTTGAGctgtttgcag acaag isomerase A (cyclophilin A) 288 NM 021130.1 peptidyl prolyl isomerase A AA357116.1 0.8 TCCCAAAGACAGCAGaaaattttcgt gctc (cyclophilin A) 289 peptidylprolyl NM 02113 0.1 BE293161. 1 0.7 CGCGTCTCCTTTGAGgtacggggc isomerase A ctggat (cyclophilin A) 290 hypothetical protein NM 024841.1 J BQ919225.1 'ATTGTTGAACTGGATgcggctgttg FLJ14213 1.4 aagag 291 hypothetical protein NM 024841.1 AK055042.1 0.8 GATCAACGTTTTCAAAG GGGG FLJ14213 TGGCTTGCAAAGCAACGAGCT CTATGCCCT 292 ring finger protein 34 NM 025126.2 NM_194271 0,9 GTCGCGGCCATGAAGgtggggga .1 gtggtac 293 t-complex 1 NM 030752.1 AA160249.1 0.7 TTCTTC IIII CCTAGgggtctcggg aacag 294 RAB34, member NM 031934.3 W32152.1 1.6 AAGAAG GAT CTGAGTg tg ag tg tg c RAS oncogene cagtg family 295 zinc finger, CCHC NM 032226.1 BG530408.1 0.8 ACTGGTCCATCAGTGACAAAG domain containing 7 ACATTGAG 296 guanylate binding NM 052942.2 AA164465.1 1.5 AAAAAAAGAAGAAAGaggagacagainte protein 5 tgaaag 297 ubiquitin-conjugating NM 058167.2 BG766070.1 1,4 TGCGCGGAACCCGAGatgagcag enzyme E2, J2 0.8 CCTGAGTCCAACACAGCTGGG channel 1 CTGGACATATTTGCCAAAIIII CTGCCTACATCAAGAATTCAAA CCCAGCACTCAATGACA 299 chl caccagc 298 chloride intracellular NM 001288.3 AAl26087.1 intracellular orine intracellular NM 1 021 031 0171 ccagggtagctcgggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggg responsive NM 134442.2 BI831922.1 0.8 GCCACATTAGCCCAGgtatctatgc element binding cagca protein 1 303 heat shock 70kDa NM 153201.1 CD655642.1 0.8 GCCTACCTTGGGAAGactgttacca protein 8 atgst 304 E74 like factor 1 (and NM 172373.2 AA251399.1 0.8 GCCAAGAAGCTTGAGAGAAGA domain transcription AAAATTTCAGAAAAATTGTCTC factor) AATTTGACTAGAATATCAATGA ACCAGGAAAACTGAAGCACCT TCCCTAAAGAAAACTTGGGTAT ACAATTACTCCACAGACAGAGC TGAGGG 1 1 1 1 1 1 ACCCAAATCA GTCACTGGATTTTGCTGCCTGA TACGTGAATCTTCTTGGAATTT TTCTCATGTGGATCTAAGGGGA CTTTATTATG G ATG GTC CTGTT GTCCAACAGAACGACCTAGTAT TTGAATTTGCTAGTAACGTCAT G 305 o eukaryotic lion NM 001402.4 BX454657.1 0.8 GGCTTCACTGCTCAG t attatcct elongation factor r is 1 gg alpha 1 GAAC 0.8 AGCTTCTCAGACTATccacctttggg elongation factor 1 taag alpha 1 307 arachidonate 5- 0,9 AAGTGGAGCACGAAAGCAGGA lipoxygenase-CCCAGAATGGGAGGAGCTTCC activating protein NMAGGACCGGAACACTTGCCT TTGAGCGGGTCTACACTGCCA A 308 ribosomal protein NM 021104.1 EXH-001 0.7 AAGAAAGATGAGGCAGAGGTC L41 ribosomal protein CAAGTAAACCGCTAGCTTGTTG 309 NM 021104.1 EXH-002 0.6 GAAGCGAATGCGCAGgctgaagc L41 gcaaaag 310 translationally NM 003295.1 EXH-003 0.5 AATGCATATTTAAACTAAATTGA controlled tumor protein 1 TCCTGTAGTGTTCCTGGAGAA GCTAGAGCCTGATTGTAGGCT ACTACTCATCAATTAACTTCTA CAGTGGAGACTACTTCTGGGA CTGGAATATAAAAA 311 G1 to S phase of NM 002094.1 EXH004 1.5 ATTACCGTTTATTCCATATCTG transition 1 / G1 to S GATAATTTGCCGAACTTCAATA transition phase 1 GATCAGTTGATGGACCAATCA GGCTGCCAATTGTGG 312 cyclin T2 NM 001241.2 EXH-005 0.5 ttgtgtgagctattcaaactcttcaacccctga 313 cyclin T2 NM 001241.2 EXH-006 0.7 AGCCAGTTGTCATTTttacaggattg tgtq 314 zinc finger protein NM 133476. 2 EXH-007 1,5 AGTTCAGGAGCCCTGGAAAGG 384 AGAAGGAATAAGACGGCAGGA GGAAGAGA 315 TBC1 domain NM 020773.1 EXH-008 CTACCTAATTGATTGcccggggcc family, member 14 0.7 ctgatt 316 F-box protein 7 NM 012179.2 EXH-009 GGAAGCGCGGGTGGTCGGCT GGGGTCCGGCTCCTGGAGAAC ATGGCCCGGCCTCCCGGGGG 1,3 CT 317 F-box EXH-010 CTGGTCCCCTCCTCGTTctaatacc 1,4 cgatt 318 maltase- GTAATTCAACTGCCAAGTGGTG glucoamylase (alpha-GAAGAGGGAAATAGAAGAACT glucosidase) NM 004668.1 EXH-011 ATACAACAATCCACAGAATCCA 1,4 GAGAG SEQ ID NO: 308-318 variants correspond to new ESTs Table 2 where List of 100 transcripts expressed differentially during the development of breast cancer SEQ Description of the N Genbank N Genbank C 1 / II Sequence Target ID N sequence (reference) (variant) vs.. Healthy cDNA DKFZp451G151 (Leucinerich repeat GAATGAATTTTCTTGctgctatgcct 3 kinase 2) AL832453.2 BU634341.1 0.8 ttct cDNA DKFZp667I093 AL832878.1 Al223156.1 0.7 TGCAGATTTGATGGCctactgtga (Guanine nucleotide agcaca binding protein, gamma 2) 7 Homo sapiens B0009917. 1; BCO28225.1 1.4 ATGAAGAAAAACAAAgtgcacag hypothetical protein agacccg DKFZp761AO52 12 Microtubule associated BC048206.1 AF052170.1 1.4 TGGGAGGGTCGACCTTGATC monoxygenase, calponin and LIM ATGAAACAATACCATGAGGGG GCCTCTGTCACCTTTGAAAAG domain containing 2 AACACTTTTTGAGCAGCCTCA AAAAGCTCATACATACCAGCG CCTTCTTAAATTGGCTCTAATG TAAAGATTGTTAATGTCATTTA TCAAAACCATAGGTGATTATTT GGAGGGATTTAAAAAACTTAA TTACTCTCAGGCCTCATCCCA AGCTTGACACATGCTCTGTAG 1GTTGAACACATAATCACAAAT ATTCTAGCAAATGCTGCCTTG GTTGCAGCCTGCACTGTAGAC CCAAGGGTTTTGCTGTGGCTC TTCTTATCTCCCTTGGCTCATA AAGCCCCAGATGATGCCAGA GCTTCAATTAGAGCCATCATC AT CC CAG G CAG G GATATCTTT GAGAAATGACTCAGTTCAGCC CCAGGCCCCTGTGACTCTGCT TAAAGCACACATTTCTGCTGA CTCTTGTACCTGGGGCAGCA GGATAATCACCAACAC 14 cellular homolog of NM 001997.2 W17004.1 0.6 GGCCGCATGCTTGGAaggtaaa the fox sequence in the gtccatgg Finkel-Biskis-Reilly murine sarcoma virus 16 cellular homolog of NM 001997.2 AA063591.1 0.7 TGACCGGCCAGGAAAcggtcgcc the fox sequence in the cagatca Finkel-Biskis-Reilly murine sarc oma virus 17 cellular homolog of NM 001997.2 AA094898.1 0.6 CAGGCCGCATGCTTGaggtaaa the fox sequence in the gtccatgg Finkel-Biskis-Reilly murine sarcoma virus 18 cellular homolog of NM 001997.2 AA187006.1 0.7 AGGCCGCATGCTTGGaggtaaa the fox sequence in the gtccatgg Finkel- Biskis-Reilly murine sarcoma virus 19 cellular homolog of NM 001997.2 AA225636.1 0.6 GGCCAGGAAACGGTCgcccaga the fox sequence in the tcaaggta Finkel-Biskis-Reilly murine sarcoma virus 23 cellular homolog of NM 001997.2 BU603086.1 0.6 g gg the fox sequence in the GAAGTAGCAGGCCGCat cttFinkel-Biskis-Reill aggtaaa y murine sarcoma virus 24 cellular homolog of NM 001997.2 BF218408.1 0,6 AGGCCGATGCTTGGA taaa t the fox sequence in the gg Finkel-Biskis-Reilly ccatggt murine sarcoma virus 25 cellular homolog of NM 001997.2 AI499403.1 0.7 CCCGCATGCTTGGAGgtaaagtc the fox sequence in the catggtt Finkel-Biskis-Reilly murine sarcoma virus 26 cellular homolog of NM 001997.2 AW795076.1 0.6 CGGTCGCCCAGATCAaggctcat the fox sequence in t he gtagcct Finkel-Biskis-Reilly murine sarcoma virus 35 SEC14-like 1 (S. NM 003003.1 AK130317.1 1.3 TAG TAG GG GG G CT CTAGTAG cerevisiae) AGTAGGTAGGGCTAGTAGGTA CTAG GGG TAG G TAG GG GG CTAG TAGGTAGGGCTAGTAGGTAG CTAGTAG GTAG G GTTCGTA GGTAGGGTTCGTAGGTAGGG TTCGTAGGTAGGGTTAGTAGC GCGTCTGTGCTGCTTCCACCT GGTGCTTCCTGTTCCCAAATC ACAAGGGCCTGAAGGTGGTC CCTGCTTTCTCTTTCTCTTTCT CTGTGTCTCAGATGGCGATTT TGCTGACAGCTGCCAAGAAAA TGCTTCACTCAACAGTCCTCA TGTGCCCAGAGATGTTTATAG AACTGTTTGAATTGCAGCCAT CCCCTGCCCCCTCCCAGGCT GAAGATCTGTTCIIIiIAAGTT GATTCG G G GAGTG CATTCTTT TATACCCAAAGACTGTAGTGC CTFGAAGAG CTCAAAG CAC ATGACCGCACAAATGCTTACA GGGTTTCCTCCCGAGTAATCC AATCTCACTCCCCTTGTAAGG 43 nuclear factor NM 003204.1 BM973053.1 1.5 CGGGTCAGTGTACAGgaagagg (erythroid-derived 2) - caggcact like 1 44 nuclear factor NM 003204.1 BM973053.1 1.5 TGCTGTGAGGCAGAGgaatgatg (erythroid-derived 2) - gagaatc like Synuclein, alpha (non-NM000345.2 NM 0031308.1 1,4-CCACAGGAAGGAATTCTGGAA A4 component of GATATGCCTGTGGATCCTGAC amyloid precursor) AATGAGGCTTAT synuclein, alpha (non-NM 000345.2 NM 007308. 1 1.5 GACCAGTTGGGCAAGaatgaag A4 component of aaggagcc amyloid precursor) 1 translationally- NM 003295.1 CA848049.1 0.7 AGAtcgcggacgggttgtgcctggaggT controlled tumor GG protein 1 52 translationally- NM 003295.1 CA848049.1 0.5 TCCGACATCTACAAGatccgga controlled tumor gatcgcg protein 1 53 translationally- NM 003295.1 BCO22436.1 0.6 CCGACATCTACAAGATCCGGG AGATCGCGGACGGGTTGTGC controlled tumor protein 1 CTG 54 translationally- NM 003295.1 BC040008.1 0.5 GCGCCGCTCCGGCTGCACCG CGCTCGCTCCGAGTTTCAGG controlled tumor protein 1 CTCGTGCTAAGCTAGCGCCGT CGTCGTCTCCCTTCAGTCGCC ATCATGATTATCTACC 55 TYRO protein tyrosine NM 003332.1 BF092099.1 0.8 GAGGGGCTGCGGAGGcagcga kinase binding protein CCCAACAGAATACAGgctggtga protein A gattgga 64 beta-2-microglobulin NM 004048.2 AV734235.1 0.7 ATTTG GATTG GATGAATTCCA AATT CT G CTT G CTT G CTTTTTA ATATTGATATGCTTATACACTT ACACTTTATGCACAAAATGTA GGGTTATAATAATGTTAACAT G GACATGATCTTCTTTATAATT CTACTTTGAGTGCTGTCTCCA TGT TTGATGTATCTGAGCAGG TTGCTCCACAGGTAGCTCTAGGAGGGCTGGCAAC 69 SEC24 NM 004922.1 GCAGCTGTCTGGAATgcagagg family, member C C ((S. AW449995.1 1.8 cagctgga cerevisiae) 71 hemoglobin, alpha 1/2 NM 000517.3 H78334.1 CAOT CGGT CTTT CAA G and c ct ag 1.4 ccactg 72 hemoglobin, alpha 1/2 NM 000517.3 H55830.1 TCAAGGCCGCCTGGGgatgttcct 1.4 .gtCCTT 80 hemoglobin, alpha 1/2 NM 000558.3 R91899.1 ACCAAGACCTACTTCcggggca 1.7 ttcaag 81 hemoglobin, alpha 1/2 NM 000558.3 H58664.1 GGAGGCCCTGGAGAGctcctaag 1.7 CCaCtgC 85 CD164 antigen, NM 006016.

3 AF299342.I CTGTGACTCCAACCTCACAAC Sialomucin CTGTGCGAAAGTCTACCTTTG ATG CAG GAG CCAGTTTCATTG GAATTGTCCTGGTCTTGGGTG TG CT CA GG G CT TAATTTT CTTT TTATAAATTCTGCAAATCTAAA GAACGAAATTACCACACTCTG TAAACAGACCCATTGAATTAAT AAGGACTGGTGATTCATTTGT GTAACTCACTGAAGCCAAAAT ACTATCTTTTAAGATGTCCCAC ATGGAAGACGCTATTCCAGGA T CTTTAAATTT CC GG AT AT G CA TATAGGATGTTTGGGAGCATC 0.8 ATCCGTGAAGAAAAAATCAAT TAAATCATTGTGTTCAACAGG AATATTTAAAATATTCTGCATG AATCCTGTGGCTGTCTTAIIII AAATAGCTGCTGCTGTGGGAT TATA 1 1 1 1 1 ITCCTTAACATG CCAAATATAACTTTCTGAAAGT GATGGAAAATGTTGTCTTGTG CAGACAACATCATGGCTCTTG GCAGTTTA 86 CD164 antigen, NM 006016.3 AF299343.1 0.8 CAGCCAATTCTACAGctaaaccc Sialomucin acagttc CCCAGAGTATTAACGCTCCAA GAGTATTATTAACGCTGCTGT ACCTCGATCTGAATCTGCCGG GGCCCCAGCCCACTCCACCC TGCCAGCAGCTTCCAGCCAGT CCCCACAGCCTCATCAGCTCT CTTCACCGIIIIIIGATACTAT CTTCCCCCACCCCCAGCTACC CATAGGGGCTGCAGAGTTATA AGCCCCAAACAGGTCATGCTC CAATAAAAATGATTCTACCTAC 88 talin 1 NM 006289.2 AI393487.1 1.4 AA 89 talin 1 NM 006289.2 AI393487. 1 TGCTTCGGAAGGAACg agagctg 1,4 gaagagg 90 talin 1 AGGAAGAAATGCTTCggaagga 1,4 acgagaqc acidic (leucine-rich) NMAGGAGAGGAGGAG aa aa nuclea rggg hosphoprotein 32 1,5 aatttgga phosp family, member B 102 soluble galactoside- CTCCAGTGGAACCAGgtttgctgtg binding lectin 9 BG698264.1 0.8 aactt (galectin 9) Homocysteine-NM 014685.1 BG828243.

1 GGAAAACATCTCAAGgcctgaag inducible, endoplasmic 0.7ctqccca stress-inducible reticulum, ubiquitin-like domain member 1 120 ring finger protein 10 NM 014868.3 BU626650.1 CGAGAGCGCAGGATTGAGAT 1.5 AGAGGAGAACA 121 ring finger protein 10 NM 014868.3 BU626650.1 AGAAACAGGGCAAGTaccaccia 1.5 agtccaca 125 ribosomal protein L4 NM 000968.2 CB141160.1 GTCATCAGACTAGTGCTGAGT CTTGGGGTACTGGCAGAGCT GTGGCTCGAATTCCCAGAGTT CGAGGTGGTGGGACTCACCG CTCTGGCCAGGGTGCTTTTGG 0.7 AAACatgtgtcgtg 126 ribosomal protein L4 NM 000968.2 CD686462.1 0.6 GCGTGTGCTCGCCCACTGATA TCGGTGTACTCCGAAAAGGG GGAGTCATCTGGCAAAAATGT CACTTTGCCTGCTGTATTCAA GGCTCCTATTCGACCAGATAT TGTGAACTTTGTTCACACCAA CTTGCGCAAAAACAACAGACA GCCCTATGCTG ubiquitin B 137 NM 018955.2 1.4 AA206538.1 CAG GTCAAAATG CAG atcttcgtg aaaacc 138 ubiquitin B NM 018955.2 AA206538.1 1,3 CAG GTCAAAATG CAG atcttcg tg aagacc 139 ubiquitin B NM 018955.2 AA340917.1 1.4 AGATCTTCGTGAAGACCCTGA CCGGCAAGACCATCACTCTG GAGGTGGAGCCCAGTGACAC CATCGAAAATGTGAAGGCCAA GATCCAAGATAAAGAAGGCAT CCCCC CCGACCAGCAGAGGC CTTTG T CAT CAG G C CAAG CAG TG GAAGATG G CGC CACTCTTT CTGACTACAACATCCAGAAAG AGTCGACCCTGCACCTGGTC CTGCGCCTGAGGGGTGGCTG TTAATTCTTCAGTCATGGCATT CGCAGTGCCCAGTGATGGCA TTACTCTGCACTATAGCCATTT GCCCCAACTTAAGTTTAGAAA TTACAAGTTTCAGTAATAGCT GAACCTGTTCAAAATGTTAATA AAGG ubiquitin B 140 NM 018955.2 BU661443.1 1.4 TCCCTGTGGGTGGACGTGGT TGGTGATTGGCAGGATCCT ubiquitin B 141 NM 018955.2 BU661443.1 1.5 GGTTGGCTTTGTTGGgtgagcttg tttgtg Major TCAGAGACAGTCTTCCTGCCC AGGGAAGACCACCTTTTCCGC AAGTTCCACTATCTCCCCTTC CTGCCCTCAACTGAGGACGTT TACGACTGCAGGGTGGAGCA CTGGGGCTTGGATGAGCCTC 145 c, DR NM 019111.2 CD686254.1 0.7 TTCTCAAGCACTGGGagtttgatg Amplex, c1 class ass II, I ctccaagccctctc omp 147 KIAA1191 protein alpha NM 020444.2 BI254429. 1 1.5 GCAGCAGGATCACAGaacagac ccaggaaa mesoderm induction TTTCTCACACAGGCAtactccaaa 148 earlyresponse 1 NM 020948.1 AY124186.1 0.7 tgcttc myelin protein zero TGCCCTGGCATTCTGGCAGA GAATCCTCACCAGTTCTCACC AACCTTCCCCCCAGGCAAGG GCAGCTGCCAGCATGGTGCT CTGCCAGGACAGGTTTCCCTG AAGGAAGCTGCTCACACTGAG ATGAGCCTCTCAGGGCAGGA CCTCTTCCCAAGCCCTGCACA CCCACCCCTGCAGCCCTTTTG like 1 151 NM 024569.2 AI693779.1 0.9 GCTC Likely ortholog of GCTTCAGTCCGCCGAgagcagta mold limb-bud and 152 heart! eue 'NM 030915.1 W45195.1 1,1 ccgtgtg 155 caspase 4, apoptosis-NM 033306.1 NM 001225.2 1,2 TGTTCCCTATGGCAGaaggcaac related cysteine cacagaa protease 158 major NM 033554.2 BU621846.1 0.7 AAGGAGCCTGTGGAGctgggcca histocompatibility gcccaac complex , clans II, DP alpha 1 159 FK506 binding protein NM 04014.1 NM 000801.2 0.8 GCTCCCTGTTCTTGGatctgccat 1A, 12kDa ggaggg 160 intracellular chloride NM 001288.3 BG491600.1 0.8 CCAGGGACGGCCACTTCCTG channel 1 GTCCCCGACGCAACCATGGC TGAAGAACAACCGCAGGTCG AATTGTTCGTGAAG 161 intracellular chloride NM 001288.3 AV683308.1 0.7 GGGCAGCTCCCATTCctgctgtat channel 1 ggcact 164 chromosome 19 open NM 138774.2 AI375989.1 1,4 ACCTCATCTCGGCCAgtgctgacc reading frame 22 tggagg 177 tropomyosin 3 NM 153649.1 BM006741.1 1,3 TGATGAGAGTGAGAGgcagaga cccgtgct 184 eukaryotic translation NM 001404.3 AA206367.1 0.7 CTGAGTCCAGATTGGCAGGT elongation factor 1 gamma GGACTACGAGTCATACACATG GCGGAAACTGGATCCTGGCA GCGAGGAGACCCAGACGCTG eukaryotic translation GTT 185 NM 001404.3 AA206367.1 0.6 CAGCATGTGGGCAAAGCCTTC elongation factor 1 gamma AATCAGGGCAAGATCTTCAAG TGAACATCTCTTGCCATCACC TAG 187 NM 001404.3 eukaryotic translation elongation factor BU783548.1 0.6 ATTTAAGCGCAAGTACTCCAA the TGAGGACACACTCTCTGTGGC gamma ACT GC CATATTT GAG CTG G CA CTTTGATAAG GACG G CTG GTC CCTGTGGTACTCAGAGTATCG CTTCCCTGAAGAACTCACTCA GACCTTCATGAGCTGCAATCT CATCACTG 188 eukaryotic translation NM 001404.3 BE502067.1 0.6 TGGACAAGCTGAGGAAGAAT elongation factor 1 gamma GCCTTCGCCAGTGTCATCCTT TTTGGAACCAACAATAGCAGC TCCATTTCTGGAGTCTGGGTC TTCCGAGGCCAG 18 9 eukaryotic translation NM 001404.3 BE502067.1 0.6 CAGGTGGACTACGAGTCATAC elongation factor 1 gamma ACATGGCGGAAACTGGATCCT GGCAGCGAGGAGACCCAGAC GCTGGTTCGAGAGTACTTTTC CTGGGAGGGGGCCTTCCAGC ATGTGGGCAAAGCCTTCAA 190 eukaryotic translation NM 001404.3 BE502067.1 0.6 GAGCTTGCCTTTCCGctgagtcca elongation factor 1 gamma 191 gattgg eukaryotic translation Ij 0.8 AAGGAGGAGAAAAAGGCGGC elongation factor 1 NM 001404.3 BG533219.1 TGCCCCTGCTCCTGAGGAGG gamma AGATGGATGAATGTGAGCAG GCGCTGGCTGCTGAGCCCAA GGCCAAGGACCCCTTCGCTC ACCTGCCCAAGAG 203 calpain, small subunit NM 001749.1 BE907701.1 1.4 _ 1 / calpain, small subunit 1 CCTTTGAGGCAGCAGatgaaagt gggaaca 204 NM 001751.3 cysteinyl-tRNA synthetase AK125503.1 1.5 AAACAGGAACAAGAAgcagcaaa gctggcc 222 prohibitin NM 002634.2 BE536369.1 1,4 GCGAGGAGAGTGCGTgtgtgaga gggtcca 225 translationally- NM 003295.1 BG284235.1 0.6 TTCTTTATTGGTGAAAACATGA controlled tumor ATCCAGATG G CATG GTTG CTC protein 1 TATTGGACTACCGTGAGGATG GTGTGACCCCATATATGATTT TCTTTAAGGATGGTTTA translationally- TTATTTTGGATCTATCACCTGT controlled tumor CATCATAACTG G CTTCTG CTT GTCATCCACACAACACCAGGA CTTAAGACAAATGGGACTGAT GTCATCTTGAGCTCTTCATTTA TTTTGACTGTGATTTATTTG GA GTGGAGGCATTG II 1 1 1 AAGA AAAACATGTCATGTAGGTTGT CTAAAAATAAAATGCATTTAAA 227 protein 1 _ NM 003295.1 CD641954.1 0.7 C 228 translationally- NM 003295.1 AV749932.1 0.6 CGTCGTCTCCCTTCAGTCGCC ATCATGATTATCTACC controlled tumor protein 1 _1609 translationally 0 NMG_CATCAGCCacgatgag controlled tumor atgttct protein 1 232 cold shock domain NM 003651.3 BE935120.1 1.5 AATAACCCACGGAAATATCTG protein A CGCAGTGTAGGAGATGGAGA AACTGTAGAGTTTGATGTGGT TGAAGGAGAGAA 236 Homo sapiens vesicle- NM 003761.2 BG623073.1 0.7 GATCTGGAAGCCACAtctgagca associated membrane cttcaag protein 8 (endobrevin) 237 CASP8 and FADD-NM 003879.3 BI871546.1 1,3 AGTACAAGCAGTCTGgtggatgg like apoptosis aatggaa regulator 239 beta-2-microglobulin NM 004048.2 BM831738.1 0.7 TG GAG G CTATCCAG nucleotide NM 004125.2 BC015206. 1 0.6 GTGGAGAGGATCAAGgtctctctctctcag binding protein, gamma gcagct 10 242 c-src tyrosine kinase NMG BG953215.1 1.1 CCTCAAGTTCTCGCTagatgtctg cgaggc 248 hemoglobin, alpha 1/2 NM 000517.3 AA343446.1 1.7 TGCTTCTCCCCGCAGgatgttcct gtcctt 253 membrane component, NM 005898.2 AA437165.1 0.8 AACAGCTTCAAACAGt99tt9gÇa chromosome e 1 111,, cttacc surface marker 1 254 capping protein (actin NM 006136.1 BG702980.1 0.7 filament) z-fine muscle, alpha 2 AGCAAAAAATTTTTGgaatggtcgt tggag 258 acidic (leucine-rich) NM 006401.1 AI446778.1 1,3 AGGAGGAGGACGAAGaaggag nuclear phosphoprotein 32 aagatgagg family, member B 261 lysosomal associated NM 006762.1 BQ006415.1 1.5 AAGATGCTCCAGAAGgtgagtgtg multispanning gctgca membrane protein 5 266 chromosome 11 open NM 014206.

1 BE041814.1 0.8 TCGCGGGGCAAAATGgagctcga reading frame 10 ggccatg 269 ribosomal protein L4 NM 000968.2 CB164625.1 0.7 G GTGCTTTTG GAAACatgtgtcgtg gaggc 276 ankyrin repeat domain NM 017664.1 BCO39715.1 0, 7 GGAGCATTCCATATAGAAACT 10 GCTGAAACTGCCACAGGTGCT TCTCCGAAAACCTTACAGTTG TGGCATTGAATGTTCAGTATC GCTTCCTTTCTGCACACG 280 ribosomal protein S17 NM 001021.2 BE731466.1 0.5 AATTATGTTCCTGAGgtctcagcct tggat 281 ribosomal protein S17 NM 001021.2 AV752729.1 0.6 GCCGCGTTCCACCAAAACCGT GAAGAAAGCGGCCCGGGTCA TCATAGAAAAGTACTACACGC GCCTGGGCAACGACTTCCAC ACGAACAAGCGCGTGTGCGA GGAGATCGCCATTATCCCCAG CAAAAAGCTCCG 282 sulfatase 2 NM 018837.1 AB033073.2 1.5 GCGAGAGTGTGTCGAgtgagtgt gcgtctg ubiquitin B 283 NM 018955.2 BG286180.1 1.6 GAAGGCGGAAAAGAGgtcaaaat gcagatc 284 ubiquitin B NM 018955.2 BG286180.1 1,4 GGTATCCGCTAACAGgtcaaaat gcagatc 290 hypothetical protein NM 024841.1 BQ919225.1 1,4 ATTGTTGAACTGGATgcggctgttg FLJ14213 aagag 298 intracellular chloride NM 001288.3 AAl26087.1 0.8 CCTGAGTCCAACACAGCTGG channel 1 G CTG G ACATATTTG C CAAATT TTCTGCCTACATCAAGAATTC AAACCCAGCACTCAATGACA 299 NM 001288.3 AAl26087.1 chloride intracellular channel 1 0.7 CCCAGGTACCCCAAGctggcagc tctgaac 300 NM 001288.3 AAl26087.1 chloride intracellular channel 1 0.8 GCTGTGCCCTCCCAGgtacccca agctggc 307 arachidonate 5- NM 001629.2 BF892107.1 0.9 AAGTGGAGCACGAAAGCAGG 1ipoxygenase ACCCAGAATGGGAGGAGCTT activating protein CCAGAGGACCGGAACACTTG CCTTTGAGCGGGTCTACACTG CCAA 309 ribosomal protein L41 NM 021104.1 EXH-002 0.6 312 GAAGCGAATGCGCAGgctgaag cgcaaaaq cyclin T2 NM 001241.2 EXH-005 0.5 ttgtgtgagctattcaaactcttcaacccctga 314 zinc finger protein 384 NM 133476.2 EXH-007 1.5 Table AGTTCAGGAGCCCTGGAAAG GAGAAGGAATAAGACGGCAG GAGGAAGAGA 3-panel of 66 differentially expressed genes in breast cancers of R and NR patients SEQ Description of N Genbank N Genbank CI / 11 Sequence Target ID N sequence (reference) (variant) vs. Healthy TGDNA DKFZp667I093 AL832878.1 Al223156.1 0.7 TGCAGATTTGATGGCctactgtga (Guanine nucleotide agcaca binding protein, gamma 2) 7 Homo sapiens BO009917.1 BCO28225.1 1,4 ATGAAGAAAAACAAAgtgcacag hypothetical protein agacccg DKFZp761A052 13 cellular homolog of NM 001997.2 NM 001997.2 0, 5 GTCGCCCAGATCAAGgctcatgta the fox sequence in the gcctca Finkel-Biskis-Reilly murine sarcoma virus 14 cellular homolog of NM 001997.2 W17004.1 0.6 GGCCGCATGCTTGGAaggtaaa the fox sequence in the gtccatgg Finkel-Biskis-Reilly murine sarcoma virus 16 cellular homolog of NM 001997.2 AA063591 .1 0.7 TGACCGGCCAGGAAAcggtcgcc the fox sequence in the cagatca Finkel-Biskis-Reilly murine sarcoma virus 17 cellular homolog of NM 001997.2 AA094898.1 0.6 CAGGCCGCATGCTTGaggtaaa the fox sequence in the gtccatgg Finkel-Biskis-Reilly murine sarcoma virus 18 cellular homolog of NM 001997.2 AA187006.1 0.7 AGGCCGCATGCTTGGaggtaaa the fox sequence in the gtccatgg Finkel-Biskis-Reilly murine sarcoma virus 19 cellular homolog of NM 001997.2 AA225636.1 0.6 GGCCAGGAAACGGTCgcccaga the fox sequence in the tcaaggta Finkel-Biskis-Reilly murine sarcoma virus 20 cellular homolog of NM 001997.2 I 0.5 GGTCGCCCAGATCAAgctcatgta the fox sequence in the BM820687.1 gcctca Finkel-Biskis-Reilly murine sarcoma virus 23 cellular homolog of NM 001997.2 BU603086.1 0.6 GAAGTAGCAGGCCGCatgcttgg the fox sequence in the 9g Finkel-Biskis-Reilly murine aggtaaa sarcoma virus 24 cellular homolog of NM 001997.2 BF218408. 1 0.6 AGGCCGATGCTTGGAggtaaagt the fox sequence in the ccatggt Finkel-Biskis-Reilly murine sarcoma virus 25 cellular homolog of NM 001997.2 AI499403.1 0.7 CCCGCATGCTTGGAG9taaa9tc the fox sequence in the catggtt Finkel-Biskis-Reilly murine sarcoma virus 26 cellular homolog of NM 001997.2 AW795076.1 0.6 CGGTCGCCCAGATCAaggctcat the fox sequence in the gtagcct Finkel-Biskis-Reilly murine sarcoma virus 27 cellular homolog of NM 001997.2 D52122.1 0.6 GGCCGCATGCTTGGggtaaagtc the fox sequence in the Finkel-Biskis-Reilly catggtt murine sarcoma virus 28 cellular homolog of NM 001997.2 BE535673.1 0.6 GCCGCATGCTTGGAGgtaacagt the fox sequence in the ccatggt Finkel-Biskis-Reilly murine sarcoma virus 47 synuclein, alpha (not NM 000345.2 NM 007308.1 1.5 GACCAGTTGGGCAAGaatgaag A4 component of aaggagcc amyloid precursor) 51 translationally - NM 003295.1 CA848049.1 0, 7 AGAtcgcggacgggttgtgcctggaggT controlled tumor GG protein 1 52 translationally- NM 003295.1 CA848049.1 0.5 TCCGACATCTACAAGatccggga controll ed tumor gatcgcg protein 1 53 translationally- NM 003295.1 BCO22436.1 0.6 CCGACATCTACAAGATCCGGG AGATCGCGGACGGGTTGTGC controlled tumor protein 1 CTG 54 translationally- NM 003295.1 BC040008.1 0.5 GCGCCGCTCCGGCTGCACCG controlled tumor protein 1 CGCTCGCTCCGAGTTTCAGG CTCGTGCTAAGCTAGCGCCGT CGTCGTCTCCCTTCAGTCGCC ATCATGATTATCTACC 55 TYRO protein tyrosine NM 003332.1 BF092099 .1 0.8 GAGGGGCTGCGGAGGcagcga kinase binding protein cccggaaac 58 NM 000374.2 uroporphyrinogen decarboxylase BQ008745.1 1.5 GTGTGCCGCTGATTGtggaccct gatgaca 64 beta-2-microglobulin NM 004048.2 AV734235.1 0.7 ATTTG GATTG GATGAATTC CA AATTCTGCTTGCTTGC IIII 1A ATATTGATATGCTTATACACTT ACACTTTATGCACAAAATGTA GGGTTATAATAATGTTAACAT GGACATGATCTTCTTTATAATT CTACTTTGAGTGCTGTCTCCA TGTTTGATGTATCTGAGCAGG TTGCTCCACAGGTAGCTCTAG GAGGGCTGGCAAC 69 SEC24 related gene NM 004922.1 AW449995.1 1.8 GCAGCTGTCTGGAATgcagagg family, member C (S. cagctgga cerevisiae) 80 hemoglobin, alpha 1/2 NM 000558.3 R91899.1 1.7 ACCAAGACCTACTTCccggtcaac ttcaag 81 hemoglobin, alpha 1/2 NM 000558.3 H58664.1 1.7 GGAGGCCCTGGAGAGctcctaag ccactgc 88 talin 1 NM 006289.2 AI393487.1 1.4 CCCAGAGTATTAACGCTCCAA GAGTATTATTAACGCTGCTGT ACCTCGATCTGAATCTGCCGG GGCCCCAGCCCACTCCACCC TGCCAGCAGCTTCCAGCCAGT CCCCACAGCCTCATCAGCTCT CTTCACCGIIIIIIGATACTAT CTTCCCCCACCCCCAGCTACC CATAGGGGCTGCAGAGTTATA AGCCCCAAACAGGTCATGCTC CAATAAAAATGATTCTACCTAC AA 89 talin 1 NM 006289.2 A1393487.1 1.4 TGCTTCGGAAGGAACgagagctg gaagagg 90 talin 1 NM 006289.2 A1417760.1 1.4 AGGAAGAAATGCTTCggaagga acgagagc 116 homocysteine NM 014685.1 BG828243.1 0.7 GGAAAACATCTCAAGgcctgaag inducible, endoplasmic ctgccCa ulum stress-inucible, ubiquitin-ind like domain member 1 121 ring finger protein 10 NM 014868.3 BU626650.1 1.5 AGAAACAG GG CAAGTaccagal agtccaca 125 ribosomal protein L4 NM 000968.2 CB141160.1 0.7 GTCATCAGACTAGTGCTGAGT CTTGGGGTACTGGCAGAGCT GTGGCTCGAATTCCCAGAGTT CGAGGTGGTGGGACTCACCG CTCT GGCCAGGGTGCTTTTGG AAACatgtgtcgtg ubiquitin B SL 137 018955.2 AA206538.1 1.4 GT CAAAATG CAG CAG at cttcg tg YYYYCC ubiquitin B SL 139 018955.2 AA340917.1 1.4 AGATCTTCGTGAAGACCCTGA CCGGCAAGACCATCACTCTG GAGGTGGAGCCCAGTGACAC CATCGAAAATGTGAAGGCCAA GATCCAAGATAAAGAAGGCAT CCCCCCCGACCAGCAGAGGC TCATCTTTGCAGGCAAGCAGC TGGAAGATGGCCGCACTCTTT CTGACTACAACATCCAGAAAG AGTCGACCCTGCACCTGGTC CTGCGCCTGAGGGGTGGCTG TTAATTCTTCAGTCATGGCATT CGCAGTGCCCAGTGATGGCA TTACTCTGCACTATAGCCATTT GCCC CAA AAA CTTAAGTTTAG TTACAAGTTTCAGTAATAGCT GAACCTGTTCAAAATGTTAATA AAGG 145 Major NM 019111.2 CD686254.1 0.7 TCAGAGACAGTCTTCCTGCCC omplexplex class II, c I, DR o, ciasslI alpha AGGGAAGACCACCTTTTCCGC AAGTTCCACTATCTCCCCTTC CTGCCCTCAACTGAGGACGTT TACGACTGCAGGGTGGAGCA CTGGGGCTTGGATGAGCCTC TTCTCAAGCACTGGGagtttgatg ctccaagccctctc 148 NM 020 948 mesoderm induction.

1 AY124186.1 0.7 TTTCTCACACAGGCAtactccaaa early response 1 tgcttc 158 major NM 033554.2 BU621846.1 0.7 AAGGAGCCTGTGGAGctgggcca histocability gcccaac II, complexex, cl class DP alpha 1 160 intracellular chloride NM 001288.3 BG491600.1 0.8 CCAGGGACGGCCACTTCCTG channel 1 GTCCCCGACGCAACCATGGC TGAAGAACAACCGCAGGTCG AATTGTTCGTGAAG 161 intracellular chloride NM 001288.

3 AV683308.1 0.7 GGGCAGCTCCCATTCctgctgtat channel 1 ggcact 164 NM 138774.2 chromosome 19 open reading frame ACCTCATCTCGGCCAgtgctgacc AI375989.1 1.4 22 188 tggagg eukaryotic translation NM 001404.3 BE502067.1 0.6 TGGACAAGCTGAGGAAGAAT elongation factor 1 gamma GCCTTCGCCAGTGTCATCCTT TTTGGAACCAACAATAGCAGC TCCATTTCTGGAGTCTGGGTC eukaryotic TTCCGAGGCCAG 189 translation NM 001404.3 BE502067.1 0.6 CAGGTGGACTACGAGTCATAC elongation factor 1 gamma ACATGGCGGAAACTGGATCCT GGCAGCGAGGAGACCCAGAC GCTGGTTCGAGAGTACTTTTC CTGGGAGGGGGCCTTCCAGC ATGTGGGCAAAGCCTTCAA 190 eukaryotic translation NM 001404.3 BE502067.1 0.6 GAGCTTGCCTTTCCGctgagtcca elongation factor 1 gamma 191 gattgg NM 001404.3 eukaryotic translation elongation factor BG533219.1 0.8 AAGGAGGAGAAAAAGGCGGC 1 TGCCCCTGCTCCTGAGGAGG gamma AGATGGATGAATGTGAGCAG GCGCTGGCTGCTGAGCCCAA GGCCAAGGACCCCTTCGCTC ACCTGCCCAAGAG 208 ferritin, heavy NM 002032.1 BG248923.1 0.6 TGTCTCTGGGGATCCCTAGTA polypeptide 1 TAACACATGCA 222 prohibitin NM 002634.2 BE536369.1 1.4 GCGAGG AGCTTGCGTgtgtgaga gggtcca 225 translationally- NM 003295.1 BG284235.1 0.6 TTCTTTATTGGTGAAAACATGA controlled tumor AT C CAGATG G CATG G TTG CT C controlled GTGTGACCCCATATATGATTT protein 1 TCTTTAAGGATGGTTTA 228 translationally- NM 003295.1 AV749932.1 0.6 CGTCGTCTCCCTTCAGTCGCC controlled tumor ATCATGATTATCTACC protein 1 229 translationally ## STR1 ## GGGACCTCATCAGCCacgatgag controlled tumor atgttct protein 1 236 Homo sapiens vesicle- NM 003761.2 BG623073.1 0.7 GATCTGGAAGCCACAtctgagca associated membrane cttcaag protein 8 (endobrevin) 240 Guanine nucleotide NM 004125.2 BC015206.1 0.6 GTGGAGAGGATCAAGgtctctcag binding protein , gcagct gamma, 242 c-src tyrosine kinase NMCT. CCTCAAGTTCTCGCTagatgtctg cgaggc 245 family with sequence NM 58/461 A.184911.1 1.6 TCAAGAGTGAGTGTTtgcggagtc similarity 50, member agacgc A 248 hemoglobin, alpha 1/2 NM 000517.3 AA343446. 1 1.7 TGCTTCTCCCCGCAGgatgttcct gtcctt 252 putative translation NM 005801.2 BG655736.1 0.7 CCTTTGT GCTTGCAGaagtttgcctinitiation factor gcaat 280 ribosomal protein S17 NM 001021.2 BE731466.1 0.5 AATTATGTTCCTGAGgtctcagcct tggat 281 ribosomal protein S17 NM 001021.2 AV752729.1 0.6 GCCGCGTTCCACCAAAACCGT GAAGAAAGCGGCCCGGGTCA TCATAGAAAAGTACTACACGC GCCTGGGCAACGACTTCCAC ACGAACAAGCGCGTGTGCGA GGAGATCGCCATTATCCCCAG CAAAAAGCTCCG ubiquitin B 284 NM 018955.2 BG286180.1 1.4 GGTATCCGCTAACAGgtcaaaat gcagatc 290 NM 024841.1 hypothetical protein FLJ14213 BQ919225.1 1.4 ATTGTTGAACTGGATgcggctgttg aagag 298 NM 001288.3 AAl26087.1 chloride intracellular channel 1 0.8 CCTGAGTCCAACACAGCTGG G CTG GACATATTTG C CAAATT TTCTGCCTACATCAAGAATTC AAACCCAGCACTCAATGACA 299 NM 001288.3 AAl26087.1 chloride intracellular channel 1 0.7 CCCAGGTACCCCAAGCtggCagC tctgaac 300 intracellular chloride NM 001288.3 AAI26087.1 0.8 GCTGTGCCCTCCCAGgtacccca channel 1 agctggc 309 ribosomal protein L41 NM 021104.1 EXH-002 0.6 GAAGCGAATGCGCAGgctgaag cgcaaaag 310 translational NM 003295.1 EXH-003 0.5 AATGCATATTTAAACTAAATTG controlled tumo r ATCCTGTAGTGTTCCTGGAGA protein 1 AGCTAGAGCCTGATTGTAGGC TACTACTCATCAATTAACTTCT ACAGTGGAGACTACTTCTGGG ACTGGAATATAAAAA 311 G1 to S-phase transition ATTACCGTTTATTCCATATCTG 1 / Gl to S-phase transition GATAATTTGCCGAACTTCAAT 1 AGATCAGTTGATGGACCAATC NM 002094.1 EXH-004 1.5 312 AGGCTGCCAATTGTGG cyclin T2 NM 001241.2 EXH-005 0.5 ttgtgtgagctattcaaactcttcaacccctga

Claims (18)

  A method for detecting the presence or risk of developing breast cancer in a mammal, comprising detecting, in a mammalian blood sample, the following target molecules: a) nucleic acids comprising the sequences shown in SEQ ID NOs 18, 19, 23, 26, 51, 52, 53, 54, 55, 69, 80, 125, 145, 148, 225, 228, 240 and 312 or a distinctive fragment thereof having at least 15, preferably at least 16, 17, 18, 19, 20, 25 or 30 consecutive bases, and / or b) the nucleic acids having a sequence complementary to sequences according to a), and / or c) the functional analogues of the nucleic acids according to ) or b) from another species, and / or d) the polypeptides encoded by the nucleic acids according to a) to c), the presence, absence or (relative) amount of these target molecules in the sample being an indication of the presence or risk of developing breast cancer in this mammal.   2. Method according to claim 1, characterized in that the nucleic acids according to a) comprise the sequences represented in SEQ ID NOs: 18, 19, 23, 26, 27, 51, 52, 53, 54, 55, 69, 80 , 125, 145, 148, 161, 188, 225, 228, 240, 280 and 312 or a distinctive fragment thereof having at least 15, preferably at least 16, 17, 18, 19, 20, 25 or 30 consecutive bases.   3. Method according to claim 1, characterized in that the nucleic acids according to a) comprise the sequences represented in SEQ ID NOs: 13, 16-19, 23, 26-28, 47, 51-55, 58, 69, 80 , 81, 89, 116, 121, 125, 145, 148, 158, 160, 161, 164, 189, 190, 225, 229, 240, 248, 280, 281, 284, 299, 300, 310 and 312 or a a distinctive fragment thereof having at least 15, preferably at least 16, 17, 18, 19, 20, 25 or 30 consecutive bases.   4. Method according to claim 1, characterized in that the nucleic acids according to a) comprise the sequences represented in SEQ ID NOs: 7, 13, 14, 16-19, 23-28, 47, 51-55, 58, 69. , 80, 81, 89, 116, 121, 125, 137, 139, 145, 148, 158, 160, 161, 164, 189, 190, 225, 228, 229, 240, 245, 248, 252, 280, 281 , 284, 290, 298-300, 310 and 312 or a distinctive fragment thereof having at least 15, preferably at least 16, 17, 18, 19, 20, 25 or 30 consecutive bases.   5. Method according to claim 1, characterized in that the nucleic acids according to a) comprise the sequences represented in SEQ ID NOs: 5, 7, 13, 14, 16-20, 23-28, 47, 51-55, 58 ,,,,,,,, , 240, 242, 245, 248, 252, 280, 281, 284, 290, 298-300 and 309-312 or a distinctive fragment thereof having at least 15, preferably at least 16, 17, 18, 19 , 20, 25 or 30 consecutive bases.   The method according to any one of claims 1 to 5, characterized in that the nucleic acids according to a) further comprise the additional sequences shown in SEQ ID NOs: 1-318 or a distinctive fragment thereof having at least 15, preferably at least 16, 17, 18, 19, 20, 25 or 30 consecutive bases.   7. A method according to any one of the preceding claims comprising detecting the presence or absence of a nucleic acid according to a) to c) by selective hybridization or selective amplification.   The method of claim 1 for detecting the presence or risk of developing breast cancer in a mammal, comprising contacting, under conditions allowing hybridization between complementary sequences, nucleic acids derived from a sample of mammalian blood and a set of probes specific for the following target molecules: a) nucleic acids comprising the sequences shown in SEQ ID NOs: 18, 19, 23, 26, 51, 52, 53, 54, 55, 69, 80, 125, 145, 148, 225, 228, 240 and 312 or a distinctive fragment thereof having at least 15, preferably at least 16, 17, 18, 19, 20, 25, or 30 consecutive bases, and / or b) nucleic acids having a sequence complementary to sequences according to a), and / orc) the functional analogues of the nucleic acids according to a) or b) from another species, to obtain a hybridization profile, the profile of hybridization being characteristic of the presence or risk to develop breast cancer in this mammal.   9. Method according to claim 8, characterized in that the probes are immobilized on a support.   The method according to any one of claims 1 to 6, comprising detecting the presence or absence of a polypeptide according to d) using a specific antibody or a fragment or derivative thereof. this.   11. Method according to any one of the preceding claims, characterized in that the blood sample is a whole blood sample.   12. Use of a nucleic acid probe specific for a target nucleic acid as defined in one of claims 1 to 6, said probe comprising from 15 to 400 bases, for the in vitro detection of breast cancer in a patient. human subject. 20   13. Use of a nucleic primer allowing the amplification of all or part of a target nucleic acid as defined in one of claims 1 to 6, said primer being single-strand, of a length of between 5 and 50 bases, for the in vitro detection of breast cancer in a human subject. 25   14. A product comprising a support on which at least 18 distinct nucleic acid probes comprising a complementary and / or specific sequence of 18 distinct target nucleic acids selected from SEQ ID NO: 1-318, preferably 18 nucleic acid targets, are immobilized. as defined in claim 1.   15. Use of a product according to claim 14 for the in vitro or ex vivo detection of the presence or risk of developing breast cancer in a mammal. 15   A method for detecting the presence or risk of developing cancer in a mammal, comprising detecting, in a sample of the mammal, one or more target molecules selected from: a) nucleic acids comprising the sequences shown in SEQ ID NOs: 1-318 or a distinctive fragment thereof having at least 15, preferably at least 16, 17, 18, 19, 20, 25 or 30 consecutive bases, and / or b) the nucleic acids having a complementary sequence sequences according to a), and / or c) the functional analogues of the nucleic acids according to a) or b) from another species, and / or d) the polypeptides encoded by the nucleic acids according to a) to c), the the presence, absence or (relative) amount of these target molecules in the sample being an indication of the presence or risk of developing cancer in that mammal.   17. A product comprising a support on which at least two distinct nucleic acid probes comprising a complementary and / or specific sequence of two distinct target nucleic acids selected from SEQ ID NO: 1-318 are immobilized.   18. A method for detecting the presence or risk of developing cancer in a mammal, comprising contacting, under conditions allowing hybridization between complementary sequences, nucleic acids from a mammalian blood sample and a probe set specific for at least two distinct molecules selected from the following targets: a) nucleic acids comprising the sequences shown in SEQ ID NOs: 1-318 or a distinctive fragment thereof having at least 15, preferably at least at least 16, 17, 18, 19, 20, 25 or 30 consecutive bases, and / or b) the nucleic acids having a sequence complementary to sequences according to a), and / or c) the functional analogues of the nucleic acids according to a) or b) from another species, to obtain a hybridization profile, the hybridization profile being characteristic of the presence or risk of developing cancer in this mammal.