CN114480654A - Application of CypA as marker in preparation of tool for diagnosing ovarian cancer - Google Patents

Application of CypA as marker in preparation of tool for diagnosing ovarian cancer Download PDF

Info

Publication number
CN114480654A
CN114480654A CN202210200829.0A CN202210200829A CN114480654A CN 114480654 A CN114480654 A CN 114480654A CN 202210200829 A CN202210200829 A CN 202210200829A CN 114480654 A CN114480654 A CN 114480654A
Authority
CN
China
Prior art keywords
cypa
ovarian cancer
cells
gene
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210200829.0A
Other languages
Chinese (zh)
Inventor
蓝婷
杨惠雯
王悦
王忠诚
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Xuzhou Medical University
Original Assignee
Xuzhou Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Xuzhou Medical University filed Critical Xuzhou Medical University
Priority to CN202210200829.0A priority Critical patent/CN114480654A/en
Publication of CN114480654A publication Critical patent/CN114480654A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/573—Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57449—Specifically defined cancers of ovaries
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • G01N33/57488—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites involving compounds identifable in body fluids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90—Enzymes; Proenzymes
    • G01N2333/99—Isomerases (5.)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Oncology (AREA)
  • General Physics & Mathematics (AREA)
  • Hospice & Palliative Care (AREA)
  • Food Science & Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Epidemiology (AREA)
  • Biophysics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The invention discloses application of CypA serving as a marker in preparation of a tool for diagnosing ovarian cancer and application of an inhibitor of CypA gene or CypA protein in preparation of a medicament for treating ovarian cancer. In the invention, ELISA and western blot techniques are used for detecting the expression level of CypA in the serum, tissues and cells of ovarian cancer patients. Analyzing and verifying the content difference of CypA in the serum of normal people, ovarian cyst patients and ovarian cancer patients, and the expression difference of CypA in normal ovarian epithelial cells and ovarian cancer cells. The result shows that CypA plays an important role in the occurrence and development of ovarian cancer and is closely related to the invasion, proliferation and metastatic capacity of ovarian cancer cells. The invention provides a molecular marker for early diagnosis of ovarian cancer, which can be used for judging at the early stage of ovarian cancer, and improves the survival rate of patients.

Description

Application of CypA as marker in preparation of tool for diagnosing ovarian cancer
Technical Field
The invention relates to the field of disease diagnosis and treatment, in particular to application of CypA as a marker in preparation of a tool for diagnosing ovarian cancer.
Background
Ovarian cancer (OVCA) is one of three gynecological malignancies, the incidence of which is lower than that of cervical cancer and endometrial cancer, but the mortality rate of which exceeds the sum of cervical cancer and endometrial cancer, and is high in the first gynecological cancer. Because of the lack of specific symptoms in the early stage of ovarian cancer and the limited screening effect, the early diagnosis is difficult, so that most ovarian cancer patients are diagnosed at an advanced stage and are called as female 'invisible killers'. Clinical data indicate that 5-year survival rates of advanced ovarian cancer patients are less than 30%. At present, the diagnosis of ovarian cancer mainly depends on vaginal ultrasound detection, and serological markers such as human epididymis protein 4(HE4) and carbohydrate antigen 125(CA125) can also provide a basis for the diagnosis of ovarian cancer, however, the specificity and sensitivity of the two to the early diagnosis of ovarian cancer are low, so that the early diagnosis of ovarian cancer becomes a great clinical problem at present. Therefore, the search for effective early diagnosis markers of ovarian cancer and the intensive research on molecular mechanisms related to the markers are crucial to improving the early diagnosis rate and the clinical treatment and prognosis of ovarian cancer.
The cyclophilin family is a highly conserved protein ubiquitous in humans and was first extracted from bovine thymus. The peptidyl-proline cis-trans isomerase (PPIase) structure forms a highly conserved structural domain in the whole family and can regulate the folding and transportation of proteins, and cyclophilin A (CypA) is a protein only composed of PPIase and is an important member of the cyclophilin family. CypA is mainly present in the cytoplasm of eukaryotes and prokaryotes, and accounts for about 0.4% of cytoplasmic proteins. Although an intracellular protein, its molecular weight is only 18 Kd. At present, the role played by CypA in ovarian cancer and the specific mechanism of action thereof are rarely reported.
Disclosure of Invention
The invention aims to provide application of CypA as a marker in preparation of a tool for diagnosing ovarian cancer, namely a novel serological marker for early diagnosis of ovarian cancer, discusses the expression level, biological effect and action mechanism of CypA in ovarian cancer, and provides an effective technical means for further improving the early diagnosis rate of ovarian cancer.
In order to achieve the purpose, the following technical scheme is adopted in the research:
provides the application of CypA as a marker in the preparation of a tool for diagnosing ovarian cancer.
Preferably, the tool is used in products for detecting the expression level of the CypA gene or CypA protein.
Preferably, the means comprises a nucleic acid capable of binding the CypA gene or a substance capable of binding the CypA protein; the nucleic acid can detect the expression level of CypA gene; the substance is capable of detecting the expression level of the CypA protein.
Preferably, the tool is a chip, a kit, a test strip or a high-throughput sequencing platform.
On the other hand, the invention also provides application of an inhibitor of the CypA gene or the CypA protein in preparing a medicament for treating ovarian cancer.
Further, the inhibitor is used for inhibiting the expression or activity of CypA gene.
Further, the inhibitors are useful for inhibiting the expression or activity of a factor involved in the upstream or downstream pathway of the CypA gene.
Preferably, the inhibitor is a CypA lentivirus knock-down vector constructed by the CypA gene based on the CRISPR/Cas9 technology.
In another aspect, the invention provides a pharmaceutical formulation for treating ovarian cancer comprising (1) an effective amount of an inhibitor of the CypA gene or CypA protein as an active ingredient, and (2) optionally a pharmaceutically acceptable carrier.
The medicine of the present invention may be prepared into various preparation forms. Preferably, the pharmaceutical dosage form is a capsule, tablet, granule, solution, patch, ointment, aerosol or suppository for transdermal, mucosal, nasal, buccal, sublingual or oral use.
The pharmaceutical preparation described in the present invention can be administered alone or together with other drugs as a medicine. The other drug that can be administered together with the drug of the present invention is not limited as long as it does not impair the effect of the therapeutic or prophylactic drug of the present invention.
The route of administration of the pharmaceutical preparation described in the present invention is not limited as long as it exerts the desired therapeutic or prophylactic effect, and may be systemic or local administration at some site, including, but not limited to, through the skin, through the pleura, through the mucosa, intravenously, intraperitoneally, intraocularly, intra-arterially, intrapulmonary, orally, intravesicularly, intramuscularly, intratracheally, subcutaneously, gastrointestinal, intraarticularly, intraventricularly, rectally, vaginally, intracranially, intraurethrally, intrahepatically, local inhalation.
The dosage of the pharmaceutical preparation of the present invention is not limited as long as the desired therapeutic effect or prophylactic effect is obtained, and can be appropriately determined depending on the symptoms, sex, age, and the like.
The dose of the therapeutic agent or prophylactic agent of the present invention can be determined using, for example, the therapeutic effect or prophylactic effect on a disease as an index.
The method is applied to the diagnosis of early ovarian cancer, and specifically comprises the following steps:
(1) obtaining a sample from a subject with ovarian cancer;
(2) detecting the expression level of the CypA gene or protein in a sample from the subject;
(3) correlating the measured expression level of the CypA gene or protein with the presence or absence of disease in the subject.
(4) (ii) an increase in the expression of the CypA gene or protein compared to a normal control, then the subject is diagnosed with ovarian cancer, or the subject is diagnosed as at high risk of future ovarian cancer; if the expression level of the CypA gene or protein is increased as compared to an ovarian cyst patient, the subject is diagnosed with ovarian cancer.
In the present invention, "diagnosing ovarian cancer" includes both determining whether a subject has ovarian cancer and determining whether a subject is at risk for having ovarian cancer.
The information on NCBI of the "CypA gene" in the present invention is: chromosome7, NC _000007.14(44795960.. 44803117).
Clinical data analysis shows that the level of serum CypA in ovarian cancer patients is obviously higher than that of healthy people and ovarian benign disease patients, the expression level of CypA in ovarian cancer tissues is also higher than that of normal ovarian cancer tissues, and compared with clinical common ovarian cancer serum diagnosis markers HE4 and CA125, the serum CypA has higher diagnosis efficiency on early stage (stage II) ovarian cancer.
Cell experiments show that the level of CypA protein, the level of CypA mRNA and the level of CypA secreted into cell supernatant in ovarian cancer cells are obviously higher than those of normal ovarian epithelial cells. After CypA in the ovarian cancer cells is knocked out, CypA secreted outside the cells by the ovarian cancer cells is reduced, the proliferation, migration and invasion capacities of the cells are obviously inhibited, and the result is opposite after CypA is over-expressed. Thus, CypA has a regulation effect on the biological function of the ovarian cancer cells at the in vitro level.
In vivo studies indicate that CypA knockout can significantly reduce the level of ovarian cancer progression in vivo and inhibit ovarian cancer metastasis in vivo. This indicates that inhibition of CypA expression inhibits the progression of ovarian cancer.
Mechanism research shows that after CypA is knocked down, the expression level of related proteins of an AKT/PI3K signal channel is obviously inhibited, the EMT epithelial cell-mesenchymal transition (EMT) process is reversed, the E-cadherin level is increased, and the expression levels of N-cadherin, Vimentin and snail are reduced; conversely, after CypA is overexpressed, the AKT/PI3K signaling pathway is activated, facilitating the EMT process. Indicating that CypA can regulate EMT process through AKT/PI3K signaling pathway in ovarian cancer cells.
Compared with the prior art, the invention has the following beneficial effects:
in the present invention, ELISA and western blot techniques are used to detect the expression level of CypA in the serum, tissue and ovarian cancer cells of ovarian cancer patients. Analyzing and verifying the content difference of CypA in the serum of normal people, ovarian cyst patients and ovarian cancer patients, and the expression difference of CypA in normal ovarian epithelial cells and ovarian cancer cells. The results show that cyclophilin A (CypA) plays an important role in the occurrence and development of ovarian cancer and is closely related to the invasion, proliferation and transfer capacity of ovarian cancer cells. The invention provides a new application of serum CypA in ovarian cancer diagnosis, in particular a new application in ovarian cancer early diagnosis, which carries out new exploration on mechanism research of ovarian cancer occurrence and provides a new strategy for early noninvasive diagnosis of ovarian cancer. The invention provides a serum marker for early diagnosis of ovarian cancer, and the molecular marker can be used for judgment at the early stage of ovarian cancer, so that the survival rate of patients is improved. The invention also provides a substance for inhibiting the expression of the CypA gene, which can be used as a novel therapeutic drug for ovarian cancer and provides a novel therapeutic method for clinically treating ovarian cancer.
Drawings
FIG. 1 is a result chart of the content of CypA in serum of patients with ovarian cancer, ovarian cyst and normal persons; healthy stands for Healthy people, Benign for ovarian cyst patients, OVCA for ovarian cancer patients;
FIG. 2 is a graph showing the results of immunohistochemical staining of CypA in tissues of ovarian cancer patients and ovarian cyst patients, Benign for ovarian cyst patients and OVCA for ovarian cancer patients;
FIG. 3 is a graph showing the results of the contents of CypA (panel A), HE4 (panel B) and CA125 (panel C) in the serum of patients with ovarian cyst (Benign), early stage ovarian cancer (stage II), and normal persons (health);
FIG. 4 is a Western blot analysis of CypA expression levels in normal ovarian epithelial cells and ovarian cancer cells with GAPDH as the internal reference;
FIG. 5 is a graph of the results of qPCR measurements of CypA mRNA levels in normal ovarian epithelial cells (IOSE80) and ovarian cancer cells (A2780, SKOV3, HO 8910);
FIG. 6 is a graph showing the results of the CypA content level in the supernatant of normal ovarian epithelial cells (IOSE80) and ovarian cancer cells (A2780, SKOV3, HO8910) after 48 hours of culture;
FIG. 7 is a Western blot result graph and a statistical graph of CypA content in cells after CypA knockdown in ovarian cancer A2780 cells (panel A, panel B) and CypA overexpression in SKOV3 cells (panel C, panel D), wherein NC is a no-load virus control group and Vector is a control virus group;
FIG. 8 is a graph showing the results of measuring the proliferation potency of CCK-8 cells after depletion (Panel A) and overexpression (Panel B) of CypA in ovarian cancer cells, and Relative cellvitality represents the proliferation potency of the cells;
FIG. 9 is a result diagram of the cell proliferation ability of plate clone detection after the knockdown and overexpression of CypA in ovarian cancer cells, wherein, a diagram A is an appearance diagram of the plate clone result, a diagram B is a cell result statistical diagram after the knockdown of CypA in ovarian cancer cells A2780, and a diagram C is a cell result statistical diagram after the overexpression of CypA in ovarian cancer cells SKOV 3;
fig. 10 is a result diagram of cell migration ability detection by a scratch test after CypA knockdown and overexpression in ovarian cancer cells, fig. a is an appearance diagram of a scratch test result after CypA knockdown in ovarian cancer cells a2780, fig. B is an appearance diagram of a scratch test result after CypA overexpression in ovarian cancer cells SKOV3, fig. C is a statistical diagram of a cell result after CypA knockdown in ovarian cancer cells a2780, and fig. D is a statistical diagram of a cell result after CypA overexpression in ovarian cancer cells SKOV 3;
FIG. 11 shows the results of Trans-well detecting cell migration and invasion ability after CypA knockdown and overexpression in ovarian cancer cells, FIGS. A and B are the appearance map and statistical map of cell migration after CypA knockdown, FIGS. C and D are the appearance map and statistical map of cell migration after CypA overexpression, FIGS. E and F are the appearance map and statistical map of cell invasion ability after CypA knockdown, and FIGS. G and H are the appearance map and statistical map of cell invasion ability after CypA overexpression;
FIG. 12 is the result of the apoptosis ability of CypA knockdown cells in ovarian cancer cells, panel A shows the apoptosis rate of the cells measured by flow cytometry, and panel B shows the statistical graph of the apoptosis rate;
FIG. 13 shows the change of tumor volume after subcutaneous tumorigenicity of nude mice with CypA-knocked-down A2780 cells; panel A shows the change in tumor volume over time, and panel B shows the appearance of tumor volume after nude mice have died;
FIG. 14 is a statistical graph of tumor weight after subcutaneous tumorigenesis of nude mice with CypA-knockdown A2780 cells;
FIG. 15 is an appearance graph of tumors in vivo showing liver metastasis (panel A) and intestinal metastasis (panel B) after subcutaneous tumorigenicity of nude mice with CypA-knocked-down A2780 cells, showing ovarian cancer liver metastasis (panel C) by liver HE staining and ovarian cancer intestinal metastasis (panel D) by intestinal HE staining;
FIG. 16 is a result chart of Western blot analysis of the expression of proteins related to AKT/PI3K signal pathway in ovarian cancer cells after CypA knockdown and overexpression in the cells, wherein beta-actin is an internal reference;
FIG. 17 is a Western blot result chart (A) of EMT pathway-associated protein expression in ovarian cancer cells after CypA knockdown and overexpression, E-cadherin represents E-cadherin, N-cadherin represents N-cadherin, Vimentin represents Vimentin, Snail represents transcription factor Snail, beta-actin is an internal reference, the chart (B) is an appearance chart of the cell morphology after CypA knockdown of ovarian cancer cells, and the chart (C) is an appearance chart of the cell morphology after CypA overexpression of ovarian cancer cells.
Detailed Description
The invention is described in further detail below with reference to the figures and specific examples.
Unless otherwise indicated, reagents, methods and equipment used in the present invention are conventional in the art, and materials of kits used in the following examples are commercially available.
The experimental procedures, the conditions of which are not specified in the examples, are generally carried out according to conventional conditions or according to the conditions recommended by the manufacturers.
The data related to the invention are analyzed by using SPSS16.0 software, the data are expressed by Mean + -SEM, the data comparison between two groups is analyzed by Independent sample t Test (Independent-Samples Test), and the data comparison between multiple groups is analyzed by One-factor analysis of variance (One-WayANOVA). Differences were considered statistically significant with a <0.05 as the test level. Mapping was performed using graphpadprism5.0 Software (Graph Pad Software, CA, USA).
Example one
Clinical research
1. The experiment was divided into 3 experimental groups in total:
experimental group 1: normal person
Experimental group 2: patients with benign ovarian disease, ovarian cyst
Experimental group 3: patients with ovarian cancer
Experimental group 3 can be further divided into early stage ovarian cancer (FIGO II) and late stage ovarian cancer (FIGO III/IV).
2. Detection of CypA content in serum and tissue
(1) This example collected patients and healthy women who were diagnosed and physical examined at the Xuzhou City gynecological health Care institute from 1 month 2020 to 12 months 2021, including 44 female patients diagnosed with Ovarian cancer (OVCA) (average age: 54 years), 53 female patients diagnosed with Ovarian cyst (Ovarian cysts) (average age 40 years) and 30 healthy female volunteers (average age: 47 years). The information was analyzed and the samples were stored at-80 ℃ until experimental analysis.
(2) CypA ELISA Kit (Shanghai Jinning practice Co., Ltd.) and immunohistochemistry were used to detect the CypA content in serum and tissue, and the procedures were performed strictly according to the instructions.
3. Results of the experiment
The experiment detects the content of CypA in the serum and tissues of a sample to be detected through ELISA and immunohistochemistry, as shown in figure 1, the content of CypA in the serum of an ovarian cancer patient is obviously different from that of healthy people and ovarian cyst patients, and the content of CypA in the serum of an OVCA patient is obviously higher than that of the other two groups; as shown in fig. 2, immunohistochemical results show that CypA expression in tumor tissues of ovarian cancer patients is significantly higher than that of ovarian cyst patients, i.e., benign tumor patients: as shown in figure 3, ELISA results show that the expression of CypA in the serum of patients with early stage (stage II) ovarian cancer is obviously higher than that of the serum of normal people and patients with ovarian cyst, and the content of the current clinical common ovarian cancer serum markers HE4 and CA125 in the serum of the patients with early stage ovarian cancer is slightly different from that of the serum of the patients with normal people and patients with ovarian cyst.
The analysis shows that compared with ovarian cyst patients or healthy people, CypA has obvious high expression in the serum and tissues of ovarian cancer patients, and the ability of CypA in diagnosing early ovarian cancer is obviously superior to HE4 and CA125, which indicates that CypA can be used as a potential serum and histological biomarker for early diagnosis of ovarian cancer.
Example two
Protein expression and mRNA levels of CypA in normal ovarian epithelial cells and ovarian cancer cells
1. Western blot
Human ovarian cancer cell lines (a2780, SKOV3, HO8910) and human normal ovarian epithelial cells (IOSE80) were provided by cell banks of the chinese academy of sciences (shanghai, china).
(1) Protein extraction and concentration determination
a) Cell: placing a six-hole plate for culturing cells on ice, sucking off a culture medium, adding 100ul of cell lysate into each hole, standing on ice for 3-5min, scraping the cells by using a cell scraper, collecting the cell lysate in a 1.5ml centrifuge tube, oscillating on a vortex mixer for 20s, and standing on ice for 30 min;
b) placing the standing EP tube in a low-temperature centrifuge, and centrifuging at 4 ℃ (15000rpm is multiplied by 18 min);
c) gently sucking the supernatant into another standard EP tube to obtain total protein solution;
d) and (3) detecting the protein concentration: 5ul of protein solution was added to 20ul of ddH for each sample2Diluting O by 5 times, taking 10ul of the diluted O in a 96-well plate, and making 2 multiple wells for each sample;
e) adding protein standard substances A-H into the foremost column of a 96-well plate, wherein the concentration is from high to low;
f) a BCA reaction working solution was prepared under a dark condition (a: b is 50: 1) mixing, adding 100ul of working solution into each well, shaking gently, mixing, and incubating in a dark 37 deg.C incubator for 30 min;
g) detecting the Optical Density (OD) value of each hole and the concentration of the protein sample under the wavelength of 562nm by using an enzyme-labeling instrument;
h) packaging unused protein, and storing at-80 deg.C.
(2) SDS-PAGE gel electrophoresis
a) Preparation of 10% polyacrylamide separation gel (2 gel portions): taking a special bottle for preparing the glue, adding the following reagents respectively, and carefully and uniformly mixing: ddH204 ml; 30% Acr-Bis3.3ml; 1.5M Tris-HCl buffer (pH8.8)2.5 ml; 10% SDS buffer 0. lml; 0.1m1 of 10 percent Ammonium Persulfate (AP) and 0.004ml of TEMED, evenly mixing, sucking separation glue by a 1ml gun, injecting into a glass plate interlayer of an electrophoresis tank, taking care not to form bubbles, adding the glue with the amount of about 2/3 small glass plate height, slowly adding about 1ml of isopropanol liquid, sealing a pressure line, and polymerizing at room temperature for about 30 min;
b) preparation of 5% polyacrylamide concentrated gum (2 gum portions): taking a special bottle for preparing the glue, adding the following reagents respectively, and carefully and uniformly mixing: ddH2O 2.7ml；30％Acr-Bis0.67ml；1.0MT0.5ml of ris-HCl buffer (pH 6.8); 0.04ml of 10% SDS buffer; 0.04ml of 10% ammonium persulfate; 0.004ml of TEMED, and mixing uniformly;
c) pouring off isopropanol on top of the gel, sucking residual liquid with filter paper, injecting the concentrated gel on top of the interlayer, inserting into comb, and polymerizing at room temperature for 30 min;
d) loading: after the gel is solidified, taking out the plate, putting the plate into an electrophoresis tank, pulling out a comb, uniformly mixing protein samples, and loading according to the quantity of 20-30 ug/hole to ensure that the loading quantity of each hole is consistent: adding protein rainbow markers on two sides of the sample hole;
e) electrophoresis: pouring the electrophoresis solution, and setting the electrophoresis apparatus to 80V electrophoresis for 30min and 110V electrophoresis for 90 min;
f) wet rotation: and cutting the PVDF film with the corresponding size in advance, and marking. Soaking in methanol, activating for 30s, pouring into membrane transferring solution, balancing for 10min, covering PVDF membrane on gel, removing air bubbles, assembling membrane transferring tank, and pouring into membrane transferring solution. The film rotating groove is arranged in the ice box, and the film rotating condition is set as follows: 280mA, 120 min;
g) and (3) sealing: sealing the sealing liquid for 2 hours in a shaking table at room temperature;
h) antibody incubation: after sealing, washing the membrane by TBST, incubating the primary antibody at 4 ℃ overnight, washing the membrane by TBST, and incubating the secondary antibody at room temperature for 2 hours;
i) exposure: covering the protein surface with exposure liquid, and exposing with a chemiluminescence imager;
j) and (3) analysis: image Lab software analysis of gray values.
The experiments involved antibodies which were predominantly CypA (affinity), beta-actin (affinity).
2. Real-time fluorescent quantitative PCR
The mRNA expression was determined by the aforementioned method using Trizol (Invitrogen corporation) to extract tissue total RNA and synthesizing cDNA using RT kit (Servicebio), quantitative reverse transcriptase PCR analysis using qPCR kit (Servicebio corporation) and LC 96 (Roche, switzerland), and the primer sequences are detailed in table 1.
TABLE 1 qRT-PCR reaction primer sequences
Name (R) Primer sequence 5 '-3'
Homo ppia-F GGTAAGGGGCCTGGATACCAA
Homo ppia-R CCTTGTCTGCAAACAGAAGGCAA
human GAPDH-F AGAAGGCTGGGGCTCATTTG
human GAPDH-R AGGGGCCATCCACAGTCTTC
3、ELISA
Respectively inoculating the same number of cells A2780, SKOV3, HO8910 and IOSE80 in a six-well plate, culturing the cells after the adherence in a serum-free culture medium for 24 hours, collecting cell supernatants, and determining the content of CypA in the cell supernatants by using an ELISA (CypA) kit.
4. Results of the experiment
The experiment detects the expression level of CypA protein and CypA mRNA level in cells through western blotting and real-time fluorescent quantitative PCR, and detects the CypA content in cell supernatant through ELISA. The results are shown in FIGS. 4-6, where CypA is expressed at a significantly higher level in ovarian cancer cells than in normal ovarian epithelial cells (FIG. 4); CypA mRNA levels in IOSE80 cells were significantly different from CypA mRNA levels in a2780, SKOV3, HO8910 cells (fig. 5); ELISA results showed that CypA content in the supernatant of IOSE80 cells was lower than that in the supernatant of A2780, SKOV3 and HO8910 cells (FIG. 6).
The analysis shows that the expression level and mRNA level of CypA in ovarian cancer cells are obviously higher than those of normal ovarian cancer cells, and CypA secreted into cell supernatant by the ovarian cancer cells is also higher than those of the normal cells, which indicates that CypA can be used as a potential ovarian cancer diagnosis biomarker.
EXAMPLE III
Effect of CypA on proliferation, migration and invasion of ovarian cancer
1. Verification of CypA knock-down experiment
(1) Cell culture
A2780 and SKOV3 cells were cultured in DMEM medium containing 10% fetal bovine serum (Gibco, USA) and 1% penicillin, 1% streptomycin, 5% CO2And culturing in a constant-temperature incubator at 37 ℃.
(2) Transfection
The expression of CypA was knocked down by the cripper cas9 technique at the GTACCCTTACCACTCAGTCT, CypAKO plasmid and its control plasmid provided by Nanjing Kerries Biotech, Inc. CypApLVX-IRES-Pure and pLVX-IRES-Pure plasmids were provided by Changsha Youbao Bio Inc. After the 293T cells are plated, a serum-free and antibiotic-free culture medium is replaced, core plasmids, helper plasmids and PEI packaging viruses are added, a normal culture medium is replaced after 6 hours for continuous culture, cell supernatants are collected for 24 hours, 48 hours and 72 hours, and virus liquid is concentrated. A2780 and SKOV3 cells are plated, virus solution is added to transfect the cells, the solution is changed after 12 hours, and puromycin is used for screening the cells which are successfully knocked down (A2780KO) or over-expressed (SKOV 3-CypA). The total cellular protein was extracted using the method described above and the CypA expression level was verified.
(3) Results of the experiment
The results are shown in FIG. 7, where CypA expression is significantly reduced in A2780-KO cells compared to A2780-NC cells (Panel A and Panel B); CypA was significantly elevated in SKOV3-CypA cells compared to SKOV3-vector (panels C and D). Indicating successful knock-down or overexpression of CypA.
2. Effect of knockdown and overexpression of CypA on proliferation, migration and invasion capacity of ovarian cancer cells
(1) The experiment was divided into 4 groups, which were:
experimental group 1: A2780-NC cells
Experimental group 2: A2780-KO cell
Experimental group 3: SKOV3-vector cell
Experimental group 4: SKOV3-CypA
(2)CCK-8
a) Plate paving: selecting cells with good growth state, counting cells, and adjusting the number of cells to 4 x 104And ensuring the cell number of each group is consistent, and each cell is provided with 6 multiple wells. Adding a proper amount of water into holes around the cell holes to prevent the culture medium from evaporating;
b) termination and measurement: after 48h of culture, 10ul of CCK8 reagent is added into each well, the mixture is placed in an incubator for 1-2h in a dark place, and then the absorbance is read at 450nm of an enzyme-labeling instrument.
(3)Trans-well
a) The difference between the invasion and migration experiments of the Transwell experiment is that the invasion experiment is characterized in that the upper layer of the chamber is coated with matrigel with a certain concentration, and the culture time is correspondingly prolonged;
b) coating a basement membrane: taking out matrigel from-20 deg.C in the first night, melting at 4 deg.C overnight, and placing the small chamber into 24-well plate; on the following day, the incomplete medium was used as 1: diluting matrigel in a proportion of 8, dripping 100ul of diluted matrigel in the center of each small chamber to avoid bubbles, cooling an EP (EP) tube and a gun head involved in operation in advance, and placing a culture plate in a 37 ℃ culture box for 3 hours;
c) plate paving: selecting cells with good growth state, washing the cells for 3 times by PBS, and taking out residual serum in the cells. Resuspend cells with incomplete medium, count cells, adjust cell density about 3 x 105/ml per well, suspend 200ul cell suspension drop by drop per chamber, set up three replicate wells per sample. The chamber was placed in a 24-plate chamber to avoid air bubbles, with 600ul of complete medium in the lower layer and incomplete medium in the upper layer. Carrying out migration experiment culture for 12h and carrying out invasion experiment culture for 24 h;
d) fixing and dyeing: the chamber was removed and placed on another 24 plates, the upper layer of liquid was discarded, PBS was washed 3 times, 600ul of 4% paraformaldehyde was added to the lower layer of the chamber, fixation was performed for 10min, PBS was washed 3 times, crystal violet was added to the lower layer and stained for 10min, and PBS was washed 3 times. Gently wipe the upper chamber off with a cotton swab without passing through the cells;
e) and (4) photographing and analyzing, photographing under a 200-time microscope, and analyzing by using ImageJ software.
(4) Scratch test
a) Plate paving: taking six orifice plates, marking straight lines of transverse holes on the back of each orifice by a marking pen, wherein the line spacing is 5mm, and each orifice is divided into seven parts. Selecting cells with good growth state, counting the cells, adjusting the number of the cells, ensuring the number of the cells in each group to be consistent, and preferably ensuring that the cell density is 90 percent on the next day of plating;
b) scratching: scratching the plate with 10ul of a gun head at the same angle and force as compared with the straight ruler after autoclaving, and washing away floating cells with PBS (phosphate buffer solution) by using three vertical lines in each hole;
c) and (3) photographing: pictures were taken at the same location at 0h, 24h, 48h, respectively, and the wound healing distance was analyzed at each time point using ImageJ software.
(5) Plate cloning
a) Paving a plate: selecting cells with good growth state, counting cells, and adjusting the number of cells to 1 x 103The number of each group of cells is consistent, and each cell is provided with 3 compound holes;
b) cell culture: culturing in 37 deg.C incubator for 10-15 days, and culturing when cell colony number is greater than 50;
c) fixing and dyeing: washing the culture dish with PBS for 3 times, fixing with 4% paraformaldehyde for 15min, washing with PBS for 3 times, dyeing with crystal violet for 10min, washing with deionized water, and air drying;
d) and (3) analysis: photographs were taken on white paper and analyzed using Image J software.
(6) Results of the experiment
The results of CCK8 and clone formation show that the proliferation capacity of the cells is obviously reduced after the CypA is knocked down, and the proliferation capacity of the cells is enhanced after the CypA is over-expressed, and the results are shown in FIGS. 8-9. Results of Transwell and scratch experiments show that CypA knockdown can inhibit migration and invasion capacity of ovarian cancer cells as shown in FIG. 10, and CypA overexpression promotes migration and invasion capacity of ovarian cancer cells. The above results indicate that CypA promotes the proliferation, migration and invasion ability of ovarian cancer in ovarian cancer cells, and can be a potential target for the treatment of ovarian cancer.
Example four
Effect of CypA on apoptosis Capacity of ovarian cancer cells
1. The experiment was divided into 2 groups, which were:
experimental group 1: A2780-NC cells
Experimental group 2: A2780-CypA KO cells
2. Detection of apoptosis rate using flow cytometry
a) When the cells were in the logarithmic growth phase, the cells were washed twice with PBS and then trypsinized without EDTA and collected.
b) Centrifuging at 2000rpm for 5min, and collecting 2 × 105And (4) cells.
c) The cells were resuspended by adding 200. mu.l of Binding Buffer.
d) Transferring into a flow tube, and setting a blank group, a single label group, an NC group and a KO group. Blank group: the cells are not added with any reagent; single standard group (annexin V-APC): adding 5 μ l Annexin V-APC; single label group (7-AAD): adding 5 μ l Annexin 7-AAD; add 5. mu.l Annexin 7-AAD and 5. mu.l Annexin V-APC to NC and KO groups, respectively.
e) And (5) incubating the coated tinfoil paper for 15min in the dark at room temperature.
f) Within 1h, detection is carried out by using a flow cytometer
3. Results of the experiment
The experiment detects the change of the apoptosis rate of the cells before and after the CypA is knocked down by flow cytometry, and the result is shown in figure 12. Thus indicating that CypA is able to inhibit the apoptotic capacity of ovarian cancer cells.
EXAMPLE five
Establishment of mouse model of ovarian cancer transplantable tumor
1. The experiment was divided into 4 groups of 8 nude mice each
Experimental group 1: A2780-NC subcutaneous tumorigenic group
Experimental group 2: A2780-CypA KO subcutaneous tumorigenic group
Experimental group 3: A2780-NC abdominal cavity tumorigenic group
Experimental group 4: A2780-CypA KO abdominal cavity tumorigenic group
2. Female nude mice were purchased from Shanghai Witonglihua company, and the selected nude mice were aged at 5-8 weeks and weighed about 18-20 g. Mice were kept under controlled temperature, humidity and light conditions. All animal studies were approved by the animal ethics committee of xu university of medical science and have been conducted according to the declaration of helsinki.
Abdominal inoculation of tumor cells in nude mice
3. Abdominal inoculation of tumor cells in nude mice
(1) When the density of A2780-NC and A2780-CypA KO cells reaches about 80-90%, replacing a fresh culture medium at night before collecting the cells;
(2) pancreatin the cells after digestion with pre-cooled PBS two times, in order to remove the cell serum;
(3) the cell pellet is blown with PBS or serum-free medium to a suitable concentration, and the amount of the inoculated cells is (1-5) multiplied by 106One cell/one, inoculation volume of 0.1ml, so the concentration of cell suspension is (1-5). times.107Individual cells/ml;
(4) after the cells are digested, the cells are inoculated to the abdominal cavity and the subcutaneous cavity of a nude mouse as soon as possible and are generally completed within half an hour, and the cell suspension is placed on ice in the process to reduce the metabolism of the cells;
(5) before inoculation, the cell suspension is blown off fully by a gun, so that cell agglomeration is prevented, and the cell survival rate is reduced;
(6) cell suspension and matrigel 1: 1, diluting, inoculating 200ul of each mouse into the left subcutaneous dorsal or abdominal part, detecting the state of the nude mouse every day and recording related data;
(7) nude mice were sacrificed: after about 4 weeks, when the tumor volume had grown to an appropriate volume, the nude mice were sacrificed and organ metastasis was observed.
4. Results of the experiment
The experiment adopts a nude mouse in-vivo tumor formation experiment to detect the inhibition effect of CypA on the growth of an ovarian epithelial cancer cell strain A2780 in vivo.
As shown in fig. 13-15, the tumor volume growth rate of nude mice after cyp knockdown was significantly reduced compared to the control group; after 21 days, the tumor bodies of the nude mice were taken out after the nude mice were killed by tendon breaking, as shown in fig. 13-14, the tumor volume and weight of the nude mice in the cypra knock-down group were significantly smaller than those of the control group. Then, the status of the metastatic tumor bodies in the liver and intestinal tissues was detected by HE staining, as shown in FIG. 15, after the knockdown of CypA, the ovarian cancer metastasis to the liver and intestinal metastasis ability in nude mice were significantly impaired. Indicating that CypA knockdown significantly reduced ovarian cancer proliferation and metastasis.
The results show that CypA knockdown can obviously inhibit the proliferation and invasion capacity of ovarian cancer in vivo, and CypA can promote the metastasis capacity of ovarian cancer in vivo.
EXAMPLE six
Detection of inhibition of ovarian cancer EMT activity by CypA through AKT/PI3K signal pathway
1. The experiment was divided into 4 groups, grouped as follows:
experimental group 1: A2780-NC cells
Experimental group 2: A2780-CypA KO cells
Experimental group 3: SKOV3-vector cell
Experimental group 4: SKOV3-CypA
2. In the experiment, western blot is used for verifying the expression conditions of the AKT/PI3K signal path marker protein and EMT signal path related protein, and the specific experimental method is as described above.
3. Results of the experiment
The experiment uses western blot to verify the expression conditions of the AKT/PI3K signal pathway marker protein and EMT signal pathway related protein, and the result is shown in figure 16, after the ovarian cancer cell CypA is knocked down, the phosphorylation level of the AKT/PI3K signal pathway related protein is obviously inhibited; after the ovarian cancer cell CypA is over-expressed, the phosphorylation level of the protein related to the AKT/PI3K signal pathway is obviously increased. As shown in FIG. 17, after the ovarian cancer cells CypA are knocked down, the expression of EMT-related protein E-cadherin is increased, and the expression of N-cadherin, Vimentin and Snail is decreased; after overexpression of CypA, the results were reversed.
The analysis shows that the inhibition of CypA expression can inhibit the AKT/PI3K signal channel and further reverse the EMT process of ovarian cancer cells.

Claims (10)

  1. Application of CypA as a marker in preparation of a tool for diagnosing ovarian cancer.
  2. 2. Use of CypA as a marker in the manufacture of a tool for diagnosing ovarian cancer according to claim 1, wherein said tool is a product for detecting the expression level of the CypA gene or CypA protein.
  3. 3. Use of CypA as a marker in the manufacture of a tool for diagnosing ovarian cancer according to claim 1 or 2, wherein the tool comprises a nucleic acid capable of binding to the CypA gene or a substance capable of binding to the CypA protein; the nucleic acid can detect the expression level of CypA gene; the substance is capable of detecting the expression level of the CypA protein.
  4. 4. The use of CypA as a marker in the preparation of a tool for diagnosing ovarian cancer according to claim 1 or 2, wherein the tool is a chip, a kit, a strip or a high throughput sequencing platform.
  5. Use of an inhibitor of the CypA gene or CypA protein in the preparation of a medicament for the treatment of ovarian cancer.
  6. 6. Use of an inhibitor of the CypA gene or CypA protein according to claim 5 for the preparation of a medicament for the treatment of ovarian cancer, wherein the inhibitor is for inhibiting the expression or activity of the CypA gene.
  7. 7. Use of an inhibitor of the CypA gene or CypA protein according to claim 5 for the manufacture of a medicament for the treatment of ovarian cancer, wherein the inhibitor is for inhibiting the expression or activity of a factor involved in the upstream or downstream pathway of the CypA gene.
  8. 8. The application of the inhibitor of the CypA gene or the CypA protein in the preparation of the medicine for treating ovarian cancer according to claim 5, 6 or 7, wherein the inhibitor is a CypA lentivirus knock-down vector constructed by the CypA gene based on the CRISPR/Cas9 technology.
  9. 9. A pharmaceutical preparation for treating ovarian cancer, which comprises (1) an effective amount of an inhibitor of the CypA gene or CypA protein as an active ingredient, and (2) an optional pharmaceutically acceptable carrier.
  10. 10. The pharmaceutical preparation for treating ovarian cancer according to claim 9, wherein the pharmaceutical dosage form is capsule, tablet, granule, solution, patch, paste, aerosol or suppository.
CN202210200829.0A 2022-03-02 2022-03-02 Application of CypA as marker in preparation of tool for diagnosing ovarian cancer Pending CN114480654A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210200829.0A CN114480654A (en) 2022-03-02 2022-03-02 Application of CypA as marker in preparation of tool for diagnosing ovarian cancer

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210200829.0A CN114480654A (en) 2022-03-02 2022-03-02 Application of CypA as marker in preparation of tool for diagnosing ovarian cancer

Publications (1)

Publication Number Publication Date
CN114480654A true CN114480654A (en) 2022-05-13

Family

ID=81485001

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210200829.0A Pending CN114480654A (en) 2022-03-02 2022-03-02 Application of CypA as marker in preparation of tool for diagnosing ovarian cancer

Country Status (1)

Country Link
CN (1) CN114480654A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116790759A (en) * 2023-08-08 2023-09-22 潍坊医学院 Application of PLEC in early diagnosis and treatment of epithelial ovarian cancer
CN116908457A (en) * 2023-09-01 2023-10-20 潍坊医学院 Application of TNS2 in preparation of kit and medicament for early diagnosis and treatment of epithelial ovarian cancer
CN118240936A (en) * 2024-03-19 2024-06-25 上海市第一人民医院 Molecular marker related to ovarian cancer and screening method and application thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050095592A1 (en) * 2002-02-13 2005-05-05 Jazaeri Amir A. Identification of ovarian cancer tumor markers and therapeutic targets
US20060281091A1 (en) * 2003-07-07 2006-12-14 Lavedan Christian N Genes regulated in ovarian cancer a s prognostic and therapeutic targets
CN101365802A (en) * 2005-10-28 2009-02-11 生物梅里埃股份公司 Method for detecting cancer
CN110951879A (en) * 2019-12-24 2020-04-03 四川大学 Application of 18S RNA in qRT-PCR detection of gene expression before and after ovarian cancer cell hypoxia stimulation

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050095592A1 (en) * 2002-02-13 2005-05-05 Jazaeri Amir A. Identification of ovarian cancer tumor markers and therapeutic targets
US20060281091A1 (en) * 2003-07-07 2006-12-14 Lavedan Christian N Genes regulated in ovarian cancer a s prognostic and therapeutic targets
CN101365802A (en) * 2005-10-28 2009-02-11 生物梅里埃股份公司 Method for detecting cancer
CN110951879A (en) * 2019-12-24 2020-04-03 四川大学 Application of 18S RNA in qRT-PCR detection of gene expression before and after ovarian cancer cell hypoxia stimulation

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
ZHI-YING等: "CYPA promotes the progression and metastasis of serous ovarian cancer (SOC) in vitro and in vivo", JOURNAL OF OVARIAN RESEARCH, vol. 12, no. 1, pages 118 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116790759A (en) * 2023-08-08 2023-09-22 潍坊医学院 Application of PLEC in early diagnosis and treatment of epithelial ovarian cancer
CN116790759B (en) * 2023-08-08 2023-12-01 潍坊医学院 Application of PLEC in early diagnosis and treatment of epithelial ovarian cancer
CN116908457A (en) * 2023-09-01 2023-10-20 潍坊医学院 Application of TNS2 in preparation of kit and medicament for early diagnosis and treatment of epithelial ovarian cancer
CN116908457B (en) * 2023-09-01 2023-12-12 潍坊医学院 Application of TNS2 in preparation of kit and medicament for early diagnosis and treatment of epithelial ovarian cancer
CN118240936A (en) * 2024-03-19 2024-06-25 上海市第一人民医院 Molecular marker related to ovarian cancer and screening method and application thereof

Similar Documents

Publication Publication Date Title
CN114480654A (en) Application of CypA as marker in preparation of tool for diagnosing ovarian cancer
Wang et al. Elevated Expression of Zinc Finger Protein 703 Promotes Cell Proliferation and Metastasis through PI3K/AKT/GSK-3β Signalling in Oral Squamous Cell Carcinoma.
CN112867495B (en) Gastric cancer therapeutic composition comprising SYT11 inhibitor as active ingredient
Wang et al. Effects of miR-214 on cervical cancer cell proliferation, apoptosis and invasion via modulating PI3K/AKT/mTOR signal pathway.
Shi et al. CAF-derived exosomes deliver LINC01410 to promote epithelial-mesenchymal transition of esophageal squamous cell carcinoma
CN110244056B (en) Application of ZNF521 gene in preparation of liver cancer treatment drug, diagnosis and prognosis evaluation reagent
Li et al. Renal Fibrosis Is Alleviated through Targeted Inhibition of IL-11–Induced Renal Tubular Epithelial-to-Mesenchymal Transition
WO2019237688A1 (en) Application of niemann-pick c1 protein in diagnosis and treatment of cancer
WO2024061385A1 (en) Use of selonsertib in preparation of drug for treating cancer
Liu et al. Effect of LGR4/EGFR signaling on cell growth and cancer stem cell-like characteristics in liver cancer
CN116115759A (en) Application of substances for jointly inhibiting NAT10/KIF23 in preparation of colorectal cancer prevention and treatment medicines
CN115990191A (en) Antitumor pharmaceutical composition
CN110613847B (en) Application of substance for inhibiting angiopoietin-like protein 8
CN108714149A (en) Purposes of the garden burnet active constituent in preparing anti-tumor drug
CN110283825B (en) SiRNA capable of knocking down SRC-1 gene expression and application thereof
CN113244378B (en) Application of FGF21 in preparation of medicine for improving sensitivity of liver cancer cells to sorafenib
CN114164270B (en) Application of CRIP2 in detecting resistance of prostate cancer to docetaxel and reversing resistance of prostate cancer to docetaxel
CN115094134B (en) Application of PCSK9 in macrophage M2 type polarization and related diseases thereof
CN116212019B (en) Application of KIAA1429 in preparation of gefitinib anti-non-small cell lung cancer sensitizer
CN114107507B (en) Application of ZSWIM1 protein in regulation and control of lung adenocarcinoma cell proliferation and metastasis
CN116919960A (en) Anti-tumor compound based on JWA gene and application thereof
CN115737645B (en) Application of AT56 combined with sorafenib in peripheral T cell lymphoma
CN115590861B (en) Application of tripterygium wilfordii chlorolide
CN113116917B (en) Application of 8-Br-cGMP as PKG I activator in preparation of medicine for preventing or treating ovarian epithelial cancer
CN115804844B (en) Application of inhibitor for targeted inhibition of PAK4 in preparation of tumor prevention and treatment medicament

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination