CN109055599B - Molecular marker primer for identifying Jinmei variety of kiwi fruit and application thereof - Google Patents
Molecular marker primer for identifying Jinmei variety of kiwi fruit and application thereof Download PDFInfo
- Publication number
- CN109055599B CN109055599B CN201811157305.8A CN201811157305A CN109055599B CN 109055599 B CN109055599 B CN 109055599B CN 201811157305 A CN201811157305 A CN 201811157305A CN 109055599 B CN109055599 B CN 109055599B
- Authority
- CN
- China
- Prior art keywords
- jinmei
- variety
- primer
- kiwi fruit
- geo13
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of molecular biology and genetic breeding, and particularly relates to a molecular marker primer for identifying a Kiwi 'Jinmei' variety and application thereof, wherein the primer comprises the following components in parts by weight: geo13-84-F: TGAACGAAAGTGGTGCTTTG and Geo13-84-R: AGCCTTCATCGTCTCCTGAA. The primer provided by the invention is used for amplifying Jinmei DNA, and only the Jinmei can specifically amplify a 161bp strip; depending on the size and number of different strips, it is also possible to pair: kiwi fruits such as 'Brunou', 'Cuiyu', 'Guichang', 'Huaguan No. 2', 'Jinkui', 'Jinnong', 'Jinxia', 'Jinyan', 'Jinyu', 'Jinyuan', 'Kumi', 'Longshan red', 'MBR', 'Miliang No. 1', 'Moshan No. 4', 'Qingyuan Qiu Qicui', 'WH-No. 1', 'Xiangma No. 6' and 'xi Kao No. 1' are distinguished.
Description
Technical Field
The invention belongs to the technical field of molecular biology and genetic breeding, and particularly relates to a molecular marker primer for identifying Jinmei varieties of kiwi fruits and application of the molecular marker primer.
Background
China is the origin of the plant of the genus Actinidia and the origin of the genetic resource of Actinidia chinensis. In recent years, the kiwi fruit industry in China is steadily expanded, and the cultivation area reaches 240 million mu in the whole country and the yield reaches 290 million tons as long as 2017, which all live at the first place in the world. On the aspect of variety pattern, China is based on the research of local kiwi fruit genetic resources, breeds new kiwi fruit varieties such as 'Jinyan', 'Donghong', and the like, is widely cultivated in the global range, thoroughly changes the single pattern of the world kiwi fruit industry Wei 'Haowder' variety, and promotes the diversification of kiwi fruit market and consumption.
With the increasing introduction of new kiwi fruit varieties, the identification of new varieties is a great problem to be solved urgently. At present, the patent varieties of the kiwi fruits are only identified by traditional means such as tree vigor, leaf shape, flowering phase, flower shape, fruit appearance and the like, and are difficult to avoid the influence of environment and other human factors. The uncertainty of the kiwi fruit variety limits the healthy and continuous development of the industry, and the economic benefit of the fruit grower is seriously damaged due to impure seedling varieties and even mistakes.
The molecular marker technology can quickly, accurately and efficiently identify the variety, and has important significance for ensuring the correctness of the variety in agricultural production. The method selects proper molecular markers and matched detection technology thereof, establishes a set of simple, convenient, economic, accurate and efficient variety identification and fingerprint spectrum technical system, is a method for striking the legal rights and interests of counterfeit seedlings and protecting plant genetic breeding workers and farmers, and standardizes the urgent needs of the agricultural market in China.
The molecular marker technology distinguishes different individuals by detecting variation of biological individuals on genomes, and is an ideal genetic marker developed after morphological markers and biochemical markers. The application of molecular markers in plant germplasm resource identification and breeding is becoming more mature. The SSR molecular markers are abundant in quantity, randomly and uniformly distributed in a genome, co-dominant, high in allelic variation, simple and convenient to operate and good in stability, and have been applied to the identification of varieties such as soybeans, apples and grapes. In the kiwi fruit, the molecular marker technology is applied to identification of male series varieties of kiwi fruit, so that a pollination male plant is accurately provided for a plurality of excellent kiwi fruit varieties, and the breeding efficiency of kiwi fruit is improved.
The 'Jinmei' kiwi fruit is oval, has the average single fruit weight of 60-80 g, is densely covered with yellow brown bristles and is easy to fall off in the storage process. Yellow or yellow green pulp, thick and sweet flavor, tender and succulent texture, 20 to 25 percent of average soluble solid of soft and ripe fruit, 15 percent of total sugar, 1.2 percent of total acid, 115 percent of vitamin C and 158mg/100g of fresh pulp. And obtaining a new variety right certificate of the plant of Ministry of agriculture in 2018. The development of the molecular identification marker suitable for the Kiwi berry Jinmei variety is beneficial to definitely defining the patent variety from the molecular level and is beneficial to identifying and protecting the Kiwi berry variety.
Disclosure of Invention
The invention aims to provide a molecular marker primer for identifying a Jinmei variety of kiwi fruits by using a molecular marker technology, wherein the molecular marker is named as Geo13-84, and primers designed aiming at the molecular marker are Geo13-84-F: TGAACGAAAGTGGTGCTTTG and Geo13-84-R: AGCCTTCATCGTCTCCTGAA.
The invention also aims to provide the application of the molecular marker primer for the 'Jinmei' variety identification of the kiwi fruit in the kiwi fruit breeding.
In order to achieve the purpose, the invention adopts the following technical measures:
obtaining a molecular marker primer for identifying kiwi fruit Jinmei varieties: applicants downloaded the ` Hongyang ` kiwi whole gene sequence from the Actinidia chinensis genomic sequence website (http:// bioinfo. bti. corn. edu/kiwi). SSR markers are developed in the whole genome range through SSR Finder software, and gene loci are selected to design SSR marker primers according to gene structure annotation results. PCR amplification is carried out on the Kiwi 'Jinmei' variety by using a designed and synthesized primer, a molecular marker Geo13-84 is obtained by screening, and the designed primer is Geo13-84-F: TGAACGAAAGTGGTGCTTTG and Geo13-84-R: AGCCTTCATCGTCTCCTGAA.
The application of the molecular marker primer for the 'Jinmei' variety identification of the kiwi fruit in the kiwi fruit breeding comprises the following steps of utilizing the primer to breed the kiwi fruit, or utilizing the primer to identify the kiwi fruit variety, particularly the 'Jinmei' variety, or according to the size and the number of different strips, carrying out the following steps of: the method comprises the following steps of distinguishing a bouunou, a jade, a long and expensive part, a Huaguang No. 2, a Jinkui, a Jinnong, a Jinxia, a Jinyan, a Jinyu, a Jinyuan, a Kumi, a Longshan red part, an MBR, a Miliang No. 1, a Moshan No. 4, a Qingyuan autumn, a WH-No. 1, a Xiangma No. 6, a Xichong No. 1, a slow fragrance, a Yuhuang No. 3, a Chuanxian No. 3, a Chuhong, an east hong, a Jiangyu No. 4, an Guihai No. 15, a Huayou, a JinMei, a Mantianhong, a Tongshan No. 5, a Wuzhan No. 3, a Xiya No. 1, a Kiwi No. 2 and a Xinguan Kiwi.
Compared with the prior art, the invention has the advantages that:
1. morphological markers are simple and intuitive, but are small in number, poor in polymorphism, and susceptible to environmental conditions. The molecular marker is simple and convenient to operate, can be detected in each tissue and development period of the plant body, and is not limited by seasons and environments. In large numbers, throughout the genome. The polymorphism is high, and a plurality of allelic variation exists among varieties.
2. The primer of the invention can be used for amplifying in kiwi fruit series varieties to obtain DNA fragments with different sizes. The molecular marker has amplification stability and can be used for identifying the Jinmei variety of the kiwi fruit.
3. The molecular marker primer provided by the invention has high specificity and wide application range, can identify Jinmei varieties from more than 40 kiwi varieties, and can specifically amplify a 161bp strip by amplifying DNA by using the molecular marker Geo13-84 primer.
4. In addition to identification of 'jinmei' varieties based on specific bands, distinction of 'brunao', 'deluxe', 'nobu long', 'huaguang No. 2', 'jinkui', 'jinnong', 'jinxia', 'jinyan', 'jinyu', 'gold round', 'kumi', 'dragon' red, MBR ',' mianlang No. 1 ',' Moshan No. 4 ',' Qingyuan autumn ',' WH-No. 1 ',' Xiangma No. 6 ',' Xichou No. 1 ',' xuxiang ',' Yu No. one ',' Chuanhong ',' Donghong ',' Fengyue ',' Guihai No. 4 ',' H-15 ',' Huayou ',' Jinmei ',' Jintian red ',' Tongjiang No. 5 ',' Wujiangya '3', 'Wujian', 'Xinjiang No. 2', 'jiangya' and 'jianghai' can be distinguished according to the size and number of the bands.
Detailed Description
The technical schemes of the invention are conventional schemes in the field if not particularly stated; the reagents or materials, unless otherwise specified, are commercially or publicly available.
Example 1:
obtaining a molecular marker primer for identifying kiwi fruit Jinmei varieties:
applicants downloaded the ` Hongyang ` kiwi whole gene sequence from the Actinidia chinensis genomic sequence website (http:// bioinfo. bti. corn. edu/kiwi). SSR markers are developed in the whole genome range through SSR Finder software, and gene loci are selected to design SSR marker primers according to gene structure annotation results. PCR amplification is carried out on the Kiwi 'Jinmei' variety by using a designed and synthesized primer, a molecular marker Geo13-84 is obtained by screening, and the designed primer is Geo13-84-F: TGAACGAAAGTGGTGCTTTG and Geo13-84-R: AGCCTTCATCGTCTCCTGAA.
Example 2:
the application of the molecular marker primer for the 'Jinmei' variety identification of the kiwi fruit in variety identification comprises the following steps:
(1) DNA samples of more than 40 different varieties of kiwi fruits are respectively extracted according to a CTAB method (the specific variety names are shown in Table 1).
(2) A mixture of 990ul HIDI and 10ul ROX500 or LIZ500 was pipetted using a sample applicator and added to a 96 well reaction plate at 10ul per well.
(3) The 96-well plate was placed in a plate centrifuge and centrifuged at 500g immediately.
(4) The sample DNA was added to each well of a 96-well plate at 50pg per sample.
(5) The corresponding reagents were added to a 96-well plate according to the following PCR reaction system, the 96-well plate was sealed with a sealing membrane, shaken, and the 96-well plate was placed in a plate centrifuge and centrifuged at 500 g. The PCR reaction was carried out according to the following procedure.
PCR reaction System
Preparation of 25. mu.l System
The primer F and the primer R are as follows: geo13-84-F: TGAACGAAAGTGGTGCTTTG and Geo13-84-R: AGCCTTCATCGTCTCCTGAA.
PCR reaction conditions
(6) Immediately after the program is finished, the 96-well plate is placed on an ice-water mixture for quick cooling, and then the 96-well plate is placed in a plate centrifuge, and the centrifugation is stopped at 2000 g.
(7) The amplified fragments were detected using a 3730xl sequencing analyzer (ABI, USA).
(8) Analyzing SSR amplification data by using Genemapper software, and detecting amplified fragment peaks by using STR capillary electrophoresis, wherein the abscissa is the size of the fragment and the ordinate is the fluorescence intensity value.
(9) The marker Geo13-84 is used for amplifying the kiwi variety, only 'Jinmei' can specifically amplify a 161bp band, and simultaneously, according to the size and the number of different bands, different varieties comprise: the kiwi fruit wine is characterized by comprising the following components of ' brununo ', ' jade ', ' noble long ', ' huaguang No. 2 ', ' jinkui ', ' jinnong ', ' Jinxia ', ' Jinyan ', ' gold jade ', ' gold round ', ' kumi ', ' dragon mountain red ', ' MBR ', ' Miliang No. 1 ', ' Qingyuan Qiuchun ', ' WH-1 ', ' Xiangma No. 6 ', ' xi selection No. 1 ', ' Xuxiang ', ' Yuhuang No. one ', ' Chuanjun No. 3 ', ' Chuhong ', ' east hong ', ' Fengye ', ' Guihai No. 4 ', ' H-15 ', ' Huayou ', ' gold plum ', ' Mantianhong ', ' Tongshan No. 5 ', ' Wuzhu plant No. 3 ', ' Xiya No. 1 ', ' new Jiangshan ' and ' kiwi fruit Kiwi. Specific amplification results are shown in table 1.
TABLE 1 names of different varieties of Kiwi fruits and Geo13-84 primer PCR amplification results
Sequence listing
<110> Wuhan plant garden of Chinese academy of sciences
<120> molecular marker primer for identifying Kiwi Jinmei variety and application
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
tgaacgaaag tggtgctttg 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
agccttcatc gtctcctgaa 20
Claims (4)
1. A molecular marker primer for identifying Kiwi fruit Jinmei variety is as follows: geo13-84-F: TGAACGAAAGTGGTGCTTTG and Geo13-84-R: AGCCTTCATCGTCTCCTGAA.
2. The use of the primer of claim 1 in the identification of Kiwi fruit Jinmei variety.
3. The primer of claim 1 is applied to the identification of kiwi fruit ' brunao ', ' emerald ', ' noble long ', ' huaguang No. 2 ', ' kui ', ' jinnong ', ' jinxia ', ' jinyan ', ' jinyu ', ' golden round ', ' kumi ', ' dragon mountain red ', ' milan No. 1 ', ' Moshan No. 4 ', ' Qingyuan guokui ', ' Xiangma No. 6 ', ' xi chong No. 1 ', ' xuxiang ', ' Yuhuang No. one ', ' Chuanxian No. 3 ', ' Chuhong ', ' east hong ', ' Fengye ', ' Guihai No. 4 ', ' H-15 ', ' Huayou ', ' Jinmei ', ' Mantianhong ', ' Tongshan No. 5 ', ' Wuzhu No. 3 ', ' Xiyai No. 1 ', ' Xia No. 2 ', or ' jiangshan.
4. A kit for identifying Jinmei variety of kiwi fruit comprises primers: geo13-84-F: TGAACGAAAGTGGTGCTTTG and Geo13-84-R: AGCCTTCATCGTCTCCTGAA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811157305.8A CN109055599B (en) | 2018-09-30 | 2018-09-30 | Molecular marker primer for identifying Jinmei variety of kiwi fruit and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811157305.8A CN109055599B (en) | 2018-09-30 | 2018-09-30 | Molecular marker primer for identifying Jinmei variety of kiwi fruit and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109055599A CN109055599A (en) | 2018-12-21 |
| CN109055599B true CN109055599B (en) | 2021-06-11 |
Family
ID=64767086
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811157305.8A Active CN109055599B (en) | 2018-09-30 | 2018-09-30 | Molecular marker primer for identifying Jinmei variety of kiwi fruit and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109055599B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110122335B (en) * | 2019-06-27 | 2022-03-22 | 西南林业大学 | Induction method of salt-tolerant mutant of slow-fragrant kiwi fruit tissue culture seedling |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104313019A (en) * | 2014-09-30 | 2015-01-28 | 中国科学院武汉植物园 | SSR molecular marker A002 for identifying males and females of kiwi fruit hybrid populations |
| CN107338318A (en) * | 2017-08-25 | 2017-11-10 | 中国科学院武汉植物园 | Molecular labeling Geo101 primers and application for Kiwi berry mill mountain system row Male cultivar identification |
| CN107385071A (en) * | 2017-08-25 | 2017-11-24 | 中国科学院武汉植物园 | Molecular labeling primer and application for Kiwi berry mill mountain system row Male cultivar identification |
-
2018
- 2018-09-30 CN CN201811157305.8A patent/CN109055599B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104313019A (en) * | 2014-09-30 | 2015-01-28 | 中国科学院武汉植物园 | SSR molecular marker A002 for identifying males and females of kiwi fruit hybrid populations |
| CN107338318A (en) * | 2017-08-25 | 2017-11-10 | 中国科学院武汉植物园 | Molecular labeling Geo101 primers and application for Kiwi berry mill mountain system row Male cultivar identification |
| CN107385071A (en) * | 2017-08-25 | 2017-11-24 | 中国科学院武汉植物园 | Molecular labeling primer and application for Kiwi berry mill mountain system row Male cultivar identification |
Non-Patent Citations (3)
| Title |
|---|
| Development and Application of Transcriptome-Derived Microsatellites in Actinidia eriantha (Actinidiaceae);Rui Guo等;《Front Plant Sci》;20170825;第8卷;Article1383 第1-13页 * |
| Development of microsatellite markers in Actinidia arguta (Actinidiaceae) based on the NCBI data platform;Yuping Man等;《Am J Bot》;20111031;第98卷(第11期);e310-e315 * |
| 猕猴桃 EST-SSR 引物筛选及通用性分析;廖娇等;《果树学报》;20111110;第28卷(第6期);第1111-1116页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109055599A (en) | 2018-12-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107385071B (en) | Molecular marker primer for identifying male varieties of kiwi fruit Moshan series and application | |
| CN107338318B (en) | Molecular marker Geo101 primer for identifying male varieties of kiwi fruit Moshan series and application | |
| CN113637794B (en) | SSR molecular marker of new variety of mulberry, namely Guangdong mulberry 201, and core primer group, kit and application thereof | |
| CN107326091B (en) | Molecular marker Geo168 primer for identifying male varieties of kiwi fruit Moshan series and application | |
| CN112746124B (en) | SSR primer and method for purity identification of cauliflower hybrid seeds | |
| CN112442545B (en) | Construction method of corylus plant variety SSR molecular marker fingerprint | |
| CN113789408A (en) | Screening and application of SSR molecular marker primers for identifying varieties of non-heading Chinese cabbages | |
| CN109055599B (en) | Molecular marker primer for identifying Jinmei variety of kiwi fruit and application thereof | |
| CN111349717B (en) | SSR (simple sequence repeat) markers of sweet cherry stock resources and fingerprint spectrum database thereof | |
| Lin et al. | Development of a novel and efficient strategy for practical identification of Pyrus spp (Rosaceae) cultivars using RAPD fingerprints | |
| CN110804675B (en) | Microsatellite DNA marker fingerprint spectrum of non-heading Chinese cabbage and application thereof | |
| CN108796111B (en) | Molecular marker primer for identifying kiwi fruit and golden plum varieties and application | |
| CN105385768B (en) | Method for identifying millet variety by adopting SSR molecular marker technology and application | |
| CN108165652B (en) | Specific molecular marker TGMI001 for identifying sex of torreya grandis at seedling stage | |
| CN113151568B (en) | SNP (Single nucleotide polymorphism) site with closely linked capsaicin content, CAPS (cleaved amplified polymorphic sequence) molecular marker of SNP site and application of CAPS molecular marker | |
| CN108977575B (en) | Molecular marker primer for identifying kiwi fruit RC197 variety and application | |
| CN109055602B (en) | Molecular marker primer for identifying kiwi fruit-Dongfei variety and application thereof | |
| CN109055601B (en) | Molecular marker primer for identifying kiwi fruit and kiwi fruit 2 variety and application | |
| CN109055600B (en) | Molecular marker primer for identifying variety No. 2 of kiwi fruit Hongtianhong and application thereof | |
| CN108796115B (en) | Molecular marker primer for identifying kiwi fruit Jinyu variety and application thereof | |
| Bajpai et al. | Narrow genetic base of Indian litchi (Litchi chinensis) cultivars based on molecular markers | |
| CN108796116B (en) | Molecular marker primer for identifying golden round variety of kiwi fruit and application thereof | |
| CN105420354B (en) | Conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18 identification methods based on InDel label | |
| CN108165655A (en) | A kind of SSR marker SP_SSR19 with spinach male close linkage and its application in spinach sex identification | |
| CN109055597B (en) | Molecular marker primer for identifying kiwi fruit and kiwi fruit variety No. 1 and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |