CN107326091B - Molecular marker Geo168 primer for identifying male varieties of kiwi fruit Moshan series and application - Google Patents
Molecular marker Geo168 primer for identifying male varieties of kiwi fruit Moshan series and application Download PDFInfo
- Publication number
- CN107326091B CN107326091B CN201710740421.1A CN201710740421A CN107326091B CN 107326091 B CN107326091 B CN 107326091B CN 201710740421 A CN201710740421 A CN 201710740421A CN 107326091 B CN107326091 B CN 107326091B
- Authority
- CN
- China
- Prior art keywords
- moshan
- geo168
- varieties
- series
- molecular marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of molecular biology and genetic breeding, and particularly relates to a molecular marker Geo168 primer for identifying male varieties of a mountain milling series of kiwi fruits and application thereof. The molecular marker primers provided by the invention are Geo168-F: AAAATCTTACAAAAATATGCCGA and Geo168-R: TGATTTTCACGGGACTCTGC, and by utilizing the primers, male varieties of the Chinese gooseberry Moshan series can be accurately distinguished and identified, and other varieties except the male varieties of the Moshan series can be distinguished, so that the molecular marker primers have universality of identification and are suitable for large-scale popularization.
Description
Technical Field
The invention belongs to the technical field of molecular biology and genetic breeding, and particularly relates to a molecular marker Geo168 primer for identifying male varieties of a mountain milling series of kiwi fruits and application thereof.
Background
In recent years, the kiwi fruit industry in China is steadily expanded, the national cultivation area reaches 220 ten thousand mu, the yield is 260 ten thousand tons and the output value exceeds 200 million yuan in 2016. The kiwi fruit belongs to the species of the male and female alien plants, namely pollen abortion in the female flower, while ovary development in the male flower is incomplete and ovule abortion. Therefore, in kiwi fruit breeding and commercial orchard cultivation, pollen of a good male plant is usually selected for cross pollination, and kiwi fruit setting can be realized.
In recent years, 'Moshan' male series kiwi fruit varieties (namely, 'Moshan male No. 1', 'Moshan male No. 2', 'Moshan male No. 3', 'Moshan male No. 4' and 'Moshan male No. 5') bred in Wuhan plant gardens of Chinese academy of sciences have the characteristics of wide flowering phase coverage, large flower quantity, high pollen germination rate and the like, and become mating pollination male plants of a plurality of excellent kiwi fruit varieties. For example, the kiwi fruit of Moshanxiong No. 2 not only can pollinate Chinese kiwi fruit in early flowering stage and middle flowering stage, but also can promote the quality improvement of red heart series kiwi fruit and increase the red accumulation of endocarp. At present, the identification of 'Moshan' series varieties is only carried out by traditional means such as tree vigor, leaf morphology, flowering phase and flower morphology, and is difficult to avoid the influence of environment and other human factors. The uncertainty of identifying the 'Mount mountain' series varieties causes great difficulty to the kiwi breeding work, and the mixed or wrong male varieties also necessarily affect the fruit production and the fruit quality.
The application of the molecular marker technology provides an objective and accurate means for variety identification. The molecular marker technology distinguishes different individuals by detecting variation of biological individuals on genomes, and is an ideal genetic marker developed after morphological markers and biochemical markers. The application of molecular markers in plant germplasm resource identification and breeding is becoming more mature. The RAPD molecular marker has high polymorphic frequency and strong specificity, and is widely used for germplasm identification of gramineous plants such as wheat, rice, corn and the like. The SSR molecular marker has high allelic variation and good stability, and is applied to identification research of resources such as soybeans, apples and grapes. The SNP molecular markers have high polymorphism and wide distribution, and are suitable for variety identification and classification research. In kiwi fruit, SNP molecular markers have been developed to perform molecular assisted breeding on important agronomic traits such as kiwi fruit sugar, acid and fruit size. However, the molecular marker identification research on male series varieties of kiwi fruits is not carried out yet.
The molecular identification marker suitable for male kiwi fruit varieties is developed, the hybrid male parents can be selected and matched in a targeted manner, the breeding efficiency of kiwi fruits is improved, and the industrial economic benefit of kiwi fruits is improved.
Disclosure of Invention
The invention aims to provide a molecular marker Geo168 primer for identifying male varieties of mountain milling series of kiwi fruits by utilizing a molecular marker technology, wherein the molecular marker is named Geo168, and primers designed aiming at the molecular marker are Geo168-F: AAAATCTTACAAAAATATGCCGA and Geo168-R: TGATTTTCACGGGACTCTGC.
The invention also aims to provide application of the molecular marker Geo168 primer for identifying male varieties of the kiwi fruit Moshan series in kiwi fruit breeding.
In order to achieve the purpose, the invention adopts the following technical measures:
obtaining a molecular marker Geo168 primer for identifying male varieties of kiwi fruit Moshan series: applicants downloaded the ` Hongyang ` kiwi whole gene sequence from the Actinidia chinensis genomic sequence website (http:// bioinfo. bti. corn. edu/kiwi). And excavating SSR loci of different repeat units in the whole genome range, comparing gene structure annotation results, and selecting the SSR loci in the gene interval to design amplification primers. PCR amplification is carried out on kiwi fruit Mount mountain series varieties by using designed and synthesized primers, a molecular marker Geo168 is obtained by screening, and the primers designed aiming at the molecular marker Geo168-F: AAAATCTTACAAAAATATGCCGA and Geo168-R: TGATTTTCACGGGACTCTGC.
The application of the molecular marker Geo168 primer for identifying male varieties of kiwi fruit Moshan series in kiwi fruit breeding is characterized in that the primer disclosed by the invention is used for identifying the varieties of kiwi fruit, wherein the varieties of kiwi fruit include but are not limited to: the kiwi fruit wine comprises a kiwi fruit selection box, a kiwi fruit selection box and a kiwi fruit selection box.
Compared with the prior art, the invention has the advantages that:
1. morphological markers are simple and intuitive, but are small in number, poor in polymorphism, and susceptible to environmental conditions. The molecular marker is simple and convenient to operate, can be detected in each tissue and development period of the plant body, and is not limited by seasons and environments. In large numbers, throughout the genome. The polymorphism is high, and a plurality of allelic variation exists among varieties.
2. The primer of the invention can be used for amplifying in kiwi fruit Moshan male series varieties to obtain DNA fragments with different sizes. The molecular marker has amplification stability and can be used for identifying male series varieties of kiwi fruits, namely Moshan.
3. The primer provided by the invention can distinguish other varieties except the 'Moshan' series male varieties, has identification universality and is suitable for large-scale popularization.
Drawings
FIG. 1 is a peak diagram of different DNA fragments obtained by capillary electrophoresis amplification in male kiwi fruit Mount Sha series varieties by using a molecular marker Geo168 primer.
Detailed Description
The technical schemes of the invention are conventional schemes in the field if not particularly stated; the reagents or materials, unless otherwise specified, are commercially or publicly available.
Example 1:
obtaining a molecular marker Geo168 primer for identifying male varieties of kiwi fruit Moshan series:
applicants downloaded the ` Hongyang ` kiwi whole gene sequence from the Actinidia chinensis genomic sequence website (http:// bioinfo. bti. corn. edu/kiwi). And excavating SSR loci of different repeat units in the whole genome range, comparing gene structure annotation results, and selecting the SSR loci in the gene interval to design amplification primers. PCR amplification is carried out on kiwi fruit Mount mountain series varieties by using designed and synthesized primers, a molecular marker Geo168 is obtained by screening, and the primers designed aiming at the molecular marker Geo168-F: AAAATCTTACAAAAATATGCCGA and Geo168-R: TGATTTTCACGGGACTCTGC.
Example 2:
the application of the molecular marker Geo168 primer for identifying male varieties of kiwi fruit Mount Shaw lines in identifying kiwi fruit Moshan varieties comprises the following steps:
(1) DNA samples of kiwi fruits of 'Moshanxiong No. 1', 'Moshanxiong No. 2', 'Moshanxiong No. 3', 'Moshanong No. 4' and 'Moshanxiong No. 5' are respectively extracted according to a CTAB method.
(2) A mixture of 990ul HIDI and 10ul ROX500 or LIZ500 was pipetted using a sample applicator and added to a 96 well reaction plate at 10ul per well.
(3) The 96-well plate was placed in a plate centrifuge and centrifuged at 500g immediately.
(4) The DNA of 5 Shashanhong series samples, 50pg each, was added to the corresponding wells of a 96-well plate.
(5) The corresponding reagents were added to a 96-well plate according to the following PCR reaction system, the 96-well plate was sealed with a sealing membrane, shaken, and the 96-well plate was placed in a plate centrifuge and centrifuged at 500 g. The PCR reaction was carried out according to the following procedure.
PCR reaction System
Preparation of 25. mu.l System
Stencil (ul) | 1 |
Primer F (ul) | 0.5 |
Primer R (ul) | 0.5 |
dNTP 10mM(μl) | 0.5 |
Taq Buffer(μl) | 2.5 |
25mM MgCl2(μl) | 2.0 |
Taq enzyme (. mu.l) 5U/. mu.l | 0.2 |
Water (ul) | 17.8 |
The primer F and the primer R are as follows: geo168-F: AAAATCTTACAAAAATATGCCGA and Geo168-R: TGATTT TCACGGGACTCTGC.
PCR reaction conditions
(6) Immediately after the program is finished, the 96-well plate is placed on an ice-water mixture for quick cooling, and then the 96-well plate is placed in a plate centrifuge, and the centrifugation is stopped at 2000 g.
(7) The amplified fragments were detected using a 3730xl sequencing analyzer (ABI, USA).
(8) Analyzing SSR amplification data by using Genemapper software, and detecting amplified fragment peaks by using STR capillary electrophoresis, wherein the abscissa is the size of the fragment and the ordinate is the fluorescence intensity value.
(9) The marked Geo168 is used for amplifying Moshan series varieties, and Moshan male No. 1, Moshan male No. 2, Moshan male No. 3, Moshan male No. 4 and Moshan male No. 5 (figure 1) can be specifically distinguished. The result shows that the amplification of the Moshanxiong No. 1' obtains 2 bands which are 225bp and 247bp respectively; amplifying Moshanxiong No. 2' to obtain 2 bands which are 241bp and 249bp respectively; amplifying Moshanxiong No. 3' to obtain 1 band which is 261 bp; amplifying Moshan No. 4 to obtain 2 bands of 251bp and 257bp respectively; amplification of Mount Sha Male No. 5' yielded 2 bands, 241bp and 253bp, respectively.
Example 3:
the application of the molecular marker Geo168 primer for identifying male Mount Turing varieties of kiwi fruits in identifying the varieties of kiwi fruits comprises the following steps:
DNA samples of kiwi fruits of 'masculin No. 1', 'masculin No. 2', 'masculin No. 3', 'masculin No. 4', 'masculin No. 5', 'Chuhong', 'Huaguang No. 2', 'Xichou No. 1' or 'Huayou' were extracted using the method of example 2 using Geo168-F: AAAATCTTACAAAAATATGCCGA and Geo168-R: TGATTTTCACGGGACTCTGC. And identifying the molecular marker of the variety.
The marked Geo168 is utilized to amplify the mountain-milling series variety, so that the 'mountain-milling male No. 1', 'mountain-milling male No. 2', 'mountain-milling male No. 3', 'mountain-milling No. 4', 'mountain-milling male No. 5', 'Chuhong', 'Huaguang No. 2', 'Xichong No. 1' or 'Huayou' kiwi fruits can be specifically distinguished. The result shows that the amplification of the Moshanxiong No. 1' obtains 2 bands which are 225bp and 247bp respectively; amplifying Moshanxiong No. 2' to obtain 2 bands which are 241bp and 249bp respectively; amplifying Moshanxiong No. 3' to obtain 1 band which is 261 bp; amplifying Moshan No. 4 to obtain 2 bands of 251bp and 257bp respectively; amplifying Moshanxiong No. 5' to obtain 2 bands, which are 241bp and 253bp respectively; amplifying the Chu red to obtain 2 bands which are 241bp and 251bp respectively; amplifying to obtain 1 band of 255bp by 'Huaguang No. 2'; amplification of 'xi selection No. 1' obtains 2 bands which are 245bp and 249bp respectively; the 'Huayou' amplification yielded 1 band at 257 bp.
Sequence listing
<110> Wuhan plant garden of Chinese academy of sciences
<120> molecular marker Geo168 primer for identifying male varieties of kiwi fruit Mount mountain series and application
<160>2
<170>SIPOSequenceListing 1.0
<210>1
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
aaaatcttac aaaaatatgc cga 23
<210>2
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
Claims (3)
1. A male variety identification molecular marker primer of a kiwi fruit Moshan series is disclosed, wherein the primer comprises the following components: geo168-F: AAAATCTTACAAAAATATGCCGA and Geo168-R: TGATTTTCACGGGACTCTGC.
2. The use of the primer of claim 1 in the breeding of kiwi fruit, wherein the varieties of kiwi fruit comprise: moshan Xiong No. 1, Moshan Xiong No. 2, Moshan Xiong No. 3, Moshan Xiong No. 4, Moshan Xiong No. 5, Chuhong, Huaguang No. 2, West Chong No. 1 or Huayou kiwi fruit.
3. Use of the primers of claim 1 in the identification of a kiwi variety, said kiwi variety comprising: moshan Xiong No. 1, Moshan Xiong No. 2, Moshan Xiong No. 3, Moshan Xiong No. 4, Moshan Xiong No. 5, Chuhong, Huaguang No. 2, West Chong No. 1 or Huayou kiwi fruit.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710740421.1A CN107326091B (en) | 2017-08-25 | 2017-08-25 | Molecular marker Geo168 primer for identifying male varieties of kiwi fruit Moshan series and application |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710740421.1A CN107326091B (en) | 2017-08-25 | 2017-08-25 | Molecular marker Geo168 primer for identifying male varieties of kiwi fruit Moshan series and application |
Publications (2)
Publication Number | Publication Date |
---|---|
CN107326091A CN107326091A (en) | 2017-11-07 |
CN107326091B true CN107326091B (en) | 2020-10-16 |
Family
ID=60225014
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710740421.1A Active CN107326091B (en) | 2017-08-25 | 2017-08-25 | Molecular marker Geo168 primer for identifying male varieties of kiwi fruit Moshan series and application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN107326091B (en) |
Families Citing this family (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108796115B (en) * | 2018-06-19 | 2021-06-11 | 中国科学院武汉植物园 | Molecular marker primer for identifying kiwi fruit Jinyu variety and application thereof |
CN108796114A (en) * | 2018-06-19 | 2018-11-13 | 中国科学院武汉植物园 | Molecular labeling primer for the gorgeous cultivar identification of Kiwi berry gold and application |
CN109055597B (en) * | 2018-09-27 | 2021-08-03 | 中国科学院武汉植物园 | Molecular marker primer for identifying kiwi fruit and kiwi fruit variety No. 1 and application |
CN109055600B (en) * | 2018-09-30 | 2021-05-04 | 中国科学院武汉植物园 | Molecular marker primer for identifying variety No. 2 of kiwi fruit Hongtianhong and application thereof |
Family Cites Families (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104611443B (en) * | 2015-02-06 | 2016-02-24 | 中国科学院武汉植物园 | The molecular assay method that Interspecific Hybridization in Actinidia kind gold is gorgeous |
KR101719719B1 (en) * | 2015-09-16 | 2017-03-24 | 순천대학교 산학협력단 | Kit for detection of Pseudomonas syringae pv. actinidiae of Psa1 group |
CN106498075B (en) * | 2016-11-25 | 2019-12-10 | 中国农业科学院郑州果树研究所 | Kiwi InDel molecular marker and screening method and application thereof |
-
2017
- 2017-08-25 CN CN201710740421.1A patent/CN107326091B/en active Active
Also Published As
Publication number | Publication date |
---|---|
CN107326091A (en) | 2017-11-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN107385071B (en) | Molecular marker primer for identifying male varieties of kiwi fruit Moshan series and application | |
CN107338318B (en) | Molecular marker Geo101 primer for identifying male varieties of kiwi fruit Moshan series and application | |
CN107326091B (en) | Molecular marker Geo168 primer for identifying male varieties of kiwi fruit Moshan series and application | |
CN110791586B (en) | SSR (simple sequence repeat) marker primer group for identifying Chinese chestnut varieties and application thereof | |
CN112725503B (en) | Molecular marker closely linked with hypocotyl color related gene of American pumpkin and application | |
CN108220402B (en) | Method for identifying pedigree relationship between Chinese cabbage germplasm and variety | |
CN108359738B (en) | Torreya sinensis EST-SSR primer and variety fingerprint construction method | |
CN110951911A (en) | Tilia EST-SSR primer based on transcriptome as well as screening method and application thereof | |
CN113151567B (en) | SSR molecular marker and method for identifying Lepista sordida N006# strain | |
CN111394495B (en) | General molecular marker primer for sex identification of commercial varieties of kiwi fruits and application | |
CN112410462B (en) | SNP molecular marker closely linked with pumpkin semi-dwarf traits and application thereof | |
CN108796111B (en) | Molecular marker primer for identifying kiwi fruit and golden plum varieties and application | |
CN114807411A (en) | Method for detecting sex of kiwi fruits | |
CN111549170B (en) | Daylily microsatellite marker primer group and application thereof | |
CN109055599B (en) | Molecular marker primer for identifying Jinmei variety of kiwi fruit and application thereof | |
CN106048032B (en) | SCAR molecular marker for banana B genome identification and identification method thereof | |
CN115896331A (en) | SNP molecular marker and dCAPS molecular marker closely linked with eggplant peel color character and application thereof | |
CN112349347B (en) | Strawberry functional gene linkage SSR marker development method | |
CN109055601B (en) | Molecular marker primer for identifying kiwi fruit and kiwi fruit 2 variety and application | |
CN109055597B (en) | Molecular marker primer for identifying kiwi fruit and kiwi fruit variety No. 1 and application | |
CN109207629B (en) | SSR molecular marker BvRE049 for detecting granularity of beet seeds and application thereof | |
CN108796112B (en) | Molecular marker primer for identifying kiwi fruit golden peach variety and application | |
CN108998566B (en) | Molecular marker primer for identifying super-red kiwi variety and application thereof | |
CN108570517B (en) | Specific primer related to Ning-Mai No. 9 low protein of weak gluten wheat and application of specific primer | |
CN108796115B (en) | Molecular marker primer for identifying kiwi fruit Jinyu variety and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |