CN114807411A - Method for detecting sex of kiwi fruits - Google Patents
Method for detecting sex of kiwi fruits Download PDFInfo
- Publication number
- CN114807411A CN114807411A CN202210278580.5A CN202210278580A CN114807411A CN 114807411 A CN114807411 A CN 114807411A CN 202210278580 A CN202210278580 A CN 202210278580A CN 114807411 A CN114807411 A CN 114807411A
- Authority
- CN
- China
- Prior art keywords
- sex
- seq
- reagent
- primer
- kiwi fruits
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6879—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for sex determination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Mycology (AREA)
- Botany (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for detecting the sex of kiwi fruits. Detecting the molecular marker with the nucleotide sequence shown as SEQ ID NO. 3, wherein the male kiwi fruit contains the molecular marker, and the female kiwi fruit does not contain the molecular marker. The method is used for detecting 186 parts of Chinese kiwifruit single plants with known sex, the test accuracy can reach 100%, and the molecular marker and the method have the advantages of good universality, simple and quick operation, high identification accuracy and great application prospect.
Description
Technical Field
The invention relates to the technical field of molecular genetic breeding of kiwi fruits, and particularly relates to a method for detecting the sex of kiwi fruits.
Background
Kiwi fruit, as the king of fruit, is rich in nutrition, has high added value and is popular with consumers. At present, the types of kiwi fruits cultivated in production mainly comprise Chinese kiwi fruits and delicious kiwi fruits, and secondly comprise wild kiwi fruits and actinidia arguta. The kiwi fruit is a functional male and female heteroplant, the economic value of the female plant is obviously higher than that of the male plant, and the male plant is mostly used as a pollination pairing tree in production and is configured in a small amount. The actinidia plants have longer juvenile phase in the seedling breeding process, the difference of the female and male plants in form is smaller in the early stage, the plants cannot be identified by the conventional means, and the sex of the plants cannot be identified until the actinidia seedlings bloom for years after being planted. The planting of a large number of male plants with no fruiting wastes a large amount of manpower and material resources, and the breeding period is prolonged. Chinese gooseberry is one of the main types of Chinese gooseberry cultivated in production, so the development of molecular markers for early sex identification of Chinese gooseberry is an urgent problem to be solved.
In recent years, researchers at home and abroad successively develop molecular markers for sex identification of actinidia plants. Gill et al developed male specific marker SmY1 by group segregation Analysis (BSA), whose gender identification accuracy for Chinese kiwifruit was 88%. SSR (simple sequence repeats) markers developed by utilizing RAD-seq technology, such as the zhangong and the like, can effectively identify the sex of 174F 1 generation individuals in a sorb and Chinese kiwi fruit hybrid population used in the research, but have poor universality in other species. The related molecular marker with application number 201911407340.5 developed by Zhuliwu and the like can be used for accurately identifying male and female plants of eight varieties of Chinese gooseberries, delicious Chinese gooseberries, actinidia arguta and actinidia arguta. The related molecular marker with application number 202010136148.3 developed by Zhang Qiong and the like is suitable for sex identification of Chinese gooseberry, delicious kiwi fruit, large-seed kiwi fruit, actinidia arguta, fructus sorb kiwi fruit, actinidia arguta and actinidia nigricans. However, the accuracy of the two molecular markers with strong universality is not verified by a large number of groups in breeding practice. Therefore, the molecular marker for early sex identification of the Chinese gooseberry seedlings, which has the advantages of good universality, simple and quick operation and high identification accuracy, is of great significance to Chinese gooseberry breeding.
Disclosure of Invention
The invention aims to provide a method for detecting the sex of kiwi fruits, and solves the problems that in the prior art, male and female kiwi fruit plants have small morphological difference at the early stage and cannot be identified by conventional means.
The first purpose of the invention is to provide a reagent for detecting kiwi fruit sex-related molecular markers.
The second purpose of the invention is to provide the application of the reagent in the detection of the sex of the kiwi fruit or the preparation of a kit for detecting the sex of the kiwi fruit.
The third purpose of the invention is to provide a method for detecting the sex of the kiwi fruits.
The fourth purpose of the invention is to provide a kit for detecting the sex of the kiwi fruits.
The above purpose of the invention is realized by the following scheme:
the invention claims a reagent for detecting kiwi sex-related molecular markers, wherein the nucleotide sequence of the molecular marker is shown in SEQ ID NO. 3, male kiwi fruits contain the molecular marker, and female kiwi fruits do not contain the molecular marker.
Preferably, the reagent is a primer with a nucleotide sequence shown as SEQ ID NO 1-2.
The invention also claims application of the reagent in detecting the sex of the kiwi fruit or preparing a kit for detecting the sex of the kiwi fruit.
Preferably, the reagent is a primer with a nucleotide sequence shown as SEQ ID NO 1-2.
In one embodiment of the invention, the method for detecting the sex of the kiwi fruits is provided, and the molecular marker with the nucleotide sequence shown as SEQ ID NO. 3 is detected, wherein male kiwi fruits contain the molecular marker, and female kiwi fruits do not contain the molecular marker.
Preferably, the reagent is a primer with a nucleotide sequence shown as SEQ ID NO 1-2.
More preferably, the method comprises the following steps:
s1, sampling:
taking Chinese gooseberry DNA as template DNA;
s2 PCR amplification
And (3) PCR system: 1 mul of template DNA, 1 mul of each primer with the nucleotide sequence shown as SEQ ID NO 1-2, 37 mul of 1.1 XT 3SUPER PCR MIX,
PCR procedure: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 10s, annealing at 58 ℃ for 10s, and extension at 66 ℃ for 15s, and 35 cycles; extending for 10min at 66 ℃; storing at 4 deg.C;
s3 electrophoresis
The PCR amplification product was subjected to agarose gel electrophoresis.
Preferably, about 100mg of young leaves of Chinese gooseberry are ground by liquid nitrogen and then extracted with a plant genome extraction kit.
In another embodiment of the invention, a kit for detecting the sex of the kiwi fruits is provided, and the kit contains the reagent.
Preferably, the reagent is a primer with a nucleotide sequence shown as SEQ ID NO 1-2.
More preferably, the kit also contains 1 XT 3SUPER PCR MIX.
Compared with the prior art, the invention has the following beneficial effects:
the male and female Chinese gooseberry plants have small morphological difference in the early stage and cannot be identified by conventional means, so that the breeding time and cost can be greatly saved if the sex of the seedlings can be identified in the early stage. The invention provides a molecular marker for early sex identification of Chinese gooseberry seedlings, and establishes a Chinese gooseberry sex-assisted breeding kit and a Chinese gooseberry sex early quick identification method on the basis, the test accuracy can reach 100% by detecting 186 parts of Chinese gooseberry single plants with known sex, and the molecular marker and the method have the advantages of good universality, simple and quick operation, high identification accuracy and great application prospect.
Drawings
FIG. 1 shows the result of amplification of primers with a product fragment of 148bp (F1-F75 and M97-M111).
FIG. 2 shows the amplification results of primers with a product fragment of 148bp (M1-M96).
FIG. 3 is a schematic diagram of the sex identification of 186 kiwi fruits by using the molecular marker primer pair of example 3; the sizes of the DL2000Marker bands from top to bottom are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp respectively. The left panels F1-F75 are female samples Nos. 1-75 in sequence, M97-M111 are male samples Nos. 97-111, and the right panels M1-M96 are male samples Nos. 1-96 in sequence.
FIG. 4 is a schematic diagram of male and female identification of kiwi fruit by using the molecular marker primer of comparative example 1. M is DL2000 Marker. F1, F2 and F3 were 3 female samples of actinidia chinensis, and M1, M2 and M3 were 3 male samples of actinidia chinensis. A001, A002 and A003 were 3 different pairs of primers.
FIG. 5 is a schematic diagram of male and female identification of kiwi fruit by using the primer pair labeled by the molecule of comparative example 2. The sizes of the DL2000Marker bands from top to bottom are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp respectively. The top panels F1-F75 are female samples Nos. 1-75 in the order, M97-M111 are male samples Nos. 97-111, and the bottom panels M1-M96 are male samples Nos. 1-96 in the order.
Detailed Description
The present invention is further described in detail below with reference to specific examples, which are provided for illustration only and are not intended to limit the scope of the present invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.
Example 1 obtaining of molecular marker primers for sex determination of Actinidia chinensis
First, experiment method
And (2) carrying out genome sequencing on male and female kiwi fruit samples, and designing 4 pairs of specific primers in male and female kiwi fruit sample difference sections by sequence comparison and combining kiwi fruit gene annotation results in a related database:
first pair of specific primers:
an upstream primer F: TTGATTTGTATTGCTCTGGTGCT (SEQ ID NO: 1);
a downstream primer R: AGAGGCCACTTTAGCATTCTATTAG (SEQ ID NO: 2).
A second pair of specific primers:
an upstream primer F: CCTTTTCCAGTTGGTAGAACGTAT
A downstream primer R: CTGCTTCTCCGAATCTTGGTC
A third pair of specific primers:
an upstream primer F: GATCGGACCAATTAGTTCAACCA
A downstream primer R: GTTCTACCAACTGGAAAAGGGAG
A fourth pair of specific primers:
an upstream primer F: TTGGCTAGGCCAATGGAATAT
A downstream primer R: TCAGTCTACACCAAGTAAGAGCAAC
2. PCR amplification
PCR reaction system, template DNA 1. mu.l, upstream primer F and downstream primer R1. mu.l each, 1.1 XT 3SUPER PCR MIX 37. mu.l.
PCR procedure: pre-denaturation at 98 ℃ for 3min, denaturation at 98 ℃ for 10s, annealing at 58 ℃ for 10s, extension at 66 ℃ for 15s (35 cycles of the last three steps), extension at 66 ℃ for 10min, and storage at 4 ℃.
Second, experimental results
Four pairs of primers are used for amplifying kiwi fruit individuals respectively, theoretically, a male sample is amplified to obtain a specific band, and a female sample does not have a band. The theoretical amplification products of the four primer pairs are as follows:
theoretical amplification product of the first pair of specific primers, 329bp (SEQ ID NO: 3:): TTGATTTGTATTGCTCTGGTGCTTCTTTCCATTTGGTCCTCATGGATATGGAAATGCCTGTCATGGATGGTCCCAAGGTTAGCTCCCTCTTCATTCTTTTCATTTTTTCAAAAAAAAATGTCTAAAATATTTATTTGTTATTTTTTTTATAGATAAACATATAGCAACATACATATATATCTACAATATTGTTAAAATATGGAACATCTTAGAGCATCTTCAGTGGACTCACTAAAGAACTTTTTTTTGTTTACTCATTTGACTACACATGTTCAATTAACATATTTTTGTCATTTTTTTGCCTCTAATAGAATGCTAAAGTGGCCTCT are provided.
Theoretical amplification product of the second pair of specific primers 159 bp:
CCTTTTCCAGTTGGTAGAACGTATGATTTTAAAATATTTCCCTAGGGCTTAGCCTAATTATATTTAGTTTTTTCGCAGGCAACCAGGGAGCTAAGAGGCATGGAAGTGAGCAGCATGATTGTAGGGATGACTTCGCGGGACCAAGATTCGGAGAAGCAG
theoretical amplification product of the third pair of specific primers, 170 bp:
GATCGGACCAATTAGTTCAACCAAATGAACCGTCGATCGGTCCGACTTTCAGTCCTGTCTATTAGAATTATTAATGATATAATTATAACATAATGGTTTAATTATTCCAGTTTTATACGAAGTTTGAATCGGTGATTCGTCCACCAACTCCCTTTTCCAGTTGGTAGAAC
theoretical amplification product of the fourth pair of specific primers 148 bp:
TTGGCTAGGCCAATGGAATATCCAATGACTTTATAAATTATACAATATTTAGCACACAAAATTAGAATTCTTTTTGCTTATATGTACACTTCAACACATATTTTTTTTGTCTAGTGTATTAAAGTTGCTCTTACTTGGTGTAGACTGA
wherein, the 329bp of the amplification product of the first pair of specific primers is consistent with the theoretical product, and a male sample is amplified to obtain a specific band, while a female sample has no band; the lengths of the amplified fragments of the other 3 pairs of primers are 159bp, 170bp and 148bp respectively, and the fragments are shorter and are easy to be confused with primer dimers.
However, the amplification efficiency of these 3 pairs of primers is relatively low. The amplification result of the primer with the product fragment of 148bp is shown in the following figure, and partial fragments are not clear. The sizes of the DL2000Marker bands from top to bottom are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp respectively. F1-F75 in the figure 1 are female samples No. 1-75 in sequence, M97-M111 are male samples No. 97-111, and M1-M96 in the figure 2 are male samples No. 1-96 in sequence.
Example 2 method for identifying sex of Chinese gooseberry
1. Sampling
Taking about 100mg of young leaves of Chinese gooseberry, grinding by liquid nitrogen, extracting DNA by using a plant genome extraction kit, and extracting DNA by using ddH 2 O DNA was diluted to 20 ng/. mu.L as a template for PCR.
2. PCR amplification
And (3) PCR system: 1 mul of template DNA, 1 mul of each of an upstream primer F and a downstream primer R with nucleotide sequences shown as SEQ ID NO: 1-2, and 37 mul of 1.1 XT 3SUPER PCR MIX.
PCR procedure: performing pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 10s, annealing at 58 ℃ for 10s, extension at 66 ℃ for 15s, 35 cycles; extending for 10min at 66 ℃; storing at 4 ℃.
3. Electrophoresis
The PCR amplification product was subjected to agarose gel electrophoresis.
4. Interpretation of results
The male sample can be amplified to obtain a specific band of 329bp, and the female sample has no band.
Example 3 identification of the sex of Actinidia chinensis
First, experiment method
1. Sample(s)
Taking 75 parts of female and 111 parts of male young leaves of Chinese gooseberry resource from 6 prefectures in Zhejiang, freezing in liquid nitrogen, and storing in a refrigerator at-80 deg.C.
2. Sampling
Extracting DNA with plant genome extraction kit, extracting DNA with ddH 2 O DNA was diluted to 20 ng/. mu.L as a template for PCR.
3. PCR amplification
And (3) PCR system: 1 mul of template DNA, 1 mul of each of an upstream primer F and a downstream primer R with nucleotide sequences shown as SEQ ID NO: 1-2, and 37 mul of 1.1 XT 3SUPER PCR MIX.
PCR procedure: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 10s, annealing at 58 ℃ for 10s, extension at 66 ℃ for 15s, 35 cycles; extending for 10min at 66 ℃; storing at 4 ℃.
4. Electrophoresis
The PCR amplification product was subjected to agarose gel electrophoresis.
The same as in example 2.
Second, experimental results
As a result, as shown in FIG. 3, all male samples gave 329bp specific bands, while none of the female samples gave any band. The accuracy of the identification is 100%.
Example 4A kit for sex determination of Chinese gooseberry
A, make up
The nucleotide sequences are shown as SEQ ID NO 1-2, namely an upstream primer F, a downstream primer R and 1.1 XT 3SUPER PCR MIX.
Second, use method
1. Sampling
Collecting young leaves of fructus Actinidiae chinensis, freezing in liquid nitrogen, and storing in-80 deg.C refrigerator.
Taking about 100mg of young leaves of Chinese gooseberry, grinding by liquid nitrogen, extracting DNA by using a plant genome extraction kit, and extracting DNA by using ddH 2 O dilution of DNA to20 ng/. mu.L was used as template for PCR. .
2. PCR amplification
And (3) PCR system: mu.l of template DNA, 1. mu.l of each of the forward primer F and the reverse primer R, and 37. mu.l of 1.1 XT 3SUPER PCR MIX.
PCR procedure: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 10s, annealing at 58 ℃ for 10s, extension at 66 ℃ for 15s, 35 cycles; extending for 10min at 66 ℃; storing at 4 ℃.
3. Electrophoresis
The PCR amplification product was subjected to agarose gel electrophoresis.
Third, interpretation of results
The male sample can be amplified to obtain a 329bp specific band, and the female sample has no band.
Comparative example 1
First, experiment method
1. Sample(s)
Placing young leaves of 3 female (F1-F3) and 3 male (M1-M3) Chinese gooseberry resources in liquid nitrogen for freezing, and storing in a refrigerator at-80 deg.C.
2. Sampling
Extracting DNA with plant genome extraction kit, extracting DNA with ddH 2 O DNA was diluted to 20 ng/. mu.L as a template for PCR.
3. PCR amplification
10 μ L of reaction system comprising: f and R primers 0.2. mu.M each, 0.2mM dNTPs, 2mM MgCl 2 1. mu.l 10 XTaq buffer, 0.5units Taq polymerase, and 50ng DNA template.
The amplification primers of each group are shown in Table 1:
table 1:
the PCR amplification procedure was:
pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 35s, and extension at 72 ℃ for 50s, and 33 cycles; extending for 5-10 min at 72 ℃.
4. Electrophoresis
The PCR amplification products were electrophoresed on polyacrylamide gel (8%).
Second, experimental results
As shown in FIG. 4, no sex-specific band was found in any of the products obtained by the above-mentioned 3 pairs of primers (from ZHANG Q, LIU CY, LIU YF, et al. high-intensity sexual maps of human sexual identities and the identification of the sex-specific markers. DNA Research 2015,22(5): 367-375.).
Comparative example 2
First, experiment method
1. Sample(s)
The young leaves of 10 macaque samples of known sex were frozen in liquid nitrogen and stored in a freezer at-80 ℃.
2. Sampling
Extracting DNA with plant genome extraction kit, extracting DNA with ddH 2 O DNA was diluted to 20 ng/. mu.L as a template for PCR.
3. PCR amplification
PCR amplification was performed with universal molecular marker primers.
Universal molecular marker primers:
F：CGACACAATGCAACTCCTGC；
R：TGGTCGAGGTTAATCAAATAG。
4. electrophoresis
The PCR amplification product was subjected to agarose gel electrophoresis.
Second, experimental results
The universal molecular marker primer comes from Chinese patent application CN202010136148.3, theoretically Female has no amplification product, and Male: although the amplification product was 442bp, the inventors did not amplify the desired band by repeating PCR conditions such as annealing temperature.
Comparative example 3
First, experiment method
1. Sample(s)
Young leaves of 186 samples of Chinese gooseberry of known sex were frozen in liquid nitrogen and stored in a refrigerator at-80 ℃.
2. Sampling
Extracting DNA with plant genome extraction kit, extracting DNA with ddH 2 O DNA was diluted to 20 ng/. mu.L as a template for PCR.
3. PCR amplification
And (3) PCR system: 1. mu.l of template DNA, 2. mu.l of primers (SmY1 primers, 1. mu.l of each of the upstream and downstream primers), and 37. mu.l of 1.1 XT 3SUPER PCR MIX.
SmY1 primer:
F：TCGCAATTCGTTAGGGATGATGCG；
R：CATAATCAACCATCCATAAAAACCAT。
PCR procedure: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 10s, touchdown annealing at 58-54 ℃ for 11s, extension at 66 ℃ for 15s, and 35 cycles; extending for 10min at 66 ℃; storing at 4 ℃.
Female no amplification product, Male: the amplification product is 770bp in length,
second, experimental results
As a result, as shown in fig. 5, the band was not observed in all the female samples, and the detection rate of the male samples was 90.9% (fig. 5), and the secondary detection rate was 95.49%. SmY1 primers are from GILL GP, HARVEY CF, GARDNER RC, et al, development of a search-linked PCR markers for genetic analysis in analytical & Applied Genetics,1998,97(3):439-445. more bands are present during detection, which are easily confused with the target band and affect the detection efficiency.
It should be finally noted that the above examples are only intended to illustrate the technical solutions of the present invention, and not to limit the scope of the present invention, and that other variations and modifications based on the above description and thought may be made by those skilled in the art, and that all embodiments need not be exhaustive. Any modification, equivalent replacement, and improvement made within the spirit and principle of the present invention should be included in the protection scope of the claims of the present invention.
Claims (10)
1. A reagent for detecting kiwi sex-related molecular markers is characterized in that the nucleotide sequence of the molecular markers is shown in SEQ ID NO. 3, male kiwi fruits contain the molecular markers, and female kiwi fruits do not contain the molecular markers.
2. The reagent according to claim 1, wherein the reagent is a primer having a nucleotide sequence of SEQ ID NO. 1-2.
3. The use of the reagent of claim 1 in the detection of the sex of kiwi fruits or in the preparation of a kit for detecting the sex of kiwi fruits.
4. The use of claim 3, wherein the reagent is a primer having a nucleotide sequence as shown in SEQ ID NO. 1-2.
5. The method for detecting the sex of the kiwi fruits is characterized in that a molecular marker with a nucleotide sequence shown as SEQ ID NO. 3 is detected, male kiwi fruits contain the molecular marker, and female kiwi fruits do not contain the molecular marker.
6. The method according to claim 5, wherein the reagent is a primer having a nucleotide sequence as shown in SEQ ID NO. 1-2.
7. The method of claim 6, comprising the steps of:
s1, sampling:
chinese gooseberry DNA as template DNA;
s2 PCR amplification
And (3) PCR system: 1 mul of template DNA, 1 mul of each primer with the nucleotide sequence shown as SEQ ID NO 1-2, 37 mul of 1.1 XT 3SUPERPCR MIX,
PCR procedure: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 10s, annealing at 58 ℃ for 10s, extension at 66 ℃ for 15s, 35 cycles; extending for 10min at 66 ℃; storing at 4 deg.C;
s3 electrophoresis
The PCR amplification product was subjected to agarose gel electrophoresis.
8. A kit for sex determination of kiwi fruits comprising the reagent of claim 1.
9. The kit according to claim 8, wherein the reagent is a primer having a nucleotide sequence shown in SEQ ID NO. 1-2.
10. The kit of claim 9, further comprising 1.1 xt 3SUPER PCR MIX.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210278580.5A CN114807411A (en) | 2022-03-17 | 2022-03-17 | Method for detecting sex of kiwi fruits |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210278580.5A CN114807411A (en) | 2022-03-17 | 2022-03-17 | Method for detecting sex of kiwi fruits |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114807411A true CN114807411A (en) | 2022-07-29 |
Family
ID=82529922
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210278580.5A Pending CN114807411A (en) | 2022-03-17 | 2022-03-17 | Method for detecting sex of kiwi fruits |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114807411A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115838790A (en) * | 2022-09-16 | 2023-03-24 | 中国科学院武汉植物园 | Molecular marker for actinidia arguta sex identification and application of specific primer pair M4 |
-
2022
- 2022-03-17 CN CN202210278580.5A patent/CN114807411A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115838790A (en) * | 2022-09-16 | 2023-03-24 | 中国科学院武汉植物园 | Molecular marker for actinidia arguta sex identification and application of specific primer pair M4 |
| CN115838790B (en) * | 2022-09-16 | 2024-04-26 | 中国科学院武汉植物园 | Molecular marker for sex identification of actinidia arguta and application of specific primer pair M4 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107385071B (en) | Molecular marker primer for identifying male varieties of kiwi fruit Moshan series and application | |
| CN107557434B (en) | Characteristic sequence, labeled primer and identification method of Carya illinoensis variety Van Deman | |
| CN107338318B (en) | Molecular marker Geo101 primer for identifying male varieties of kiwi fruit Moshan series and application | |
| CN109609686B (en) | Molecular marker for early sex identification of actinidia arguta seedlings and application of molecular marker | |
| CN106498088B (en) | CAPs molecular marker for identifying amaranthus rugosus based on SNP (single nucleotide polymorphism) sites and application of CAPs molecular marker | |
| CN110791586B (en) | SSR (simple sequence repeat) marker primer group for identifying Chinese chestnut varieties and application thereof | |
| CN107326091B (en) | Molecular marker Geo168 primer for identifying male varieties of kiwi fruit Moshan series and application | |
| CN114807411A (en) | Method for detecting sex of kiwi fruits | |
| CN104846093A (en) | Brassica juncea EST-SSR (expressed sequence tag-simple sequence repeat) marker primer group based on development of transcriptome sequence | |
| CN113151567B (en) | SSR molecular marker and method for identifying Lepista sordida N006# strain | |
| CN107447036B (en) | Method for identifying fusarium cucurbitacearum | |
| CN107586866B (en) | Characteristic sequence, labeled primer and identification method of apocarya variety Moore | |
| CN111394495B (en) | General molecular marker primer for sex identification of commercial varieties of kiwi fruits and application | |
| CN106676176B (en) | Method for performing SSR (simple sequence repeat) analysis on tetraploid alfalfa by utilizing multiple PCR (polymerase chain reaction) | |
| CN105112557B (en) | The method of Rapid identification epidendrum | |
| CN111471787A (en) | PCR/L DR molecular marker and method for identifying rice high temperature resistant TT1 genotype | |
| CN113801959B (en) | Polymorphism primer of Phoebe chekiangensis nuclear genome SSR molecular marker and application thereof | |
| CN108588091A (en) | A kind of okra reference gene and its application | |
| CN103409414B (en) | Sugarcane genome endogenous reference gene acetolactate synthase gene PCR (polymerase chain reaction) primer sequences and amplification method | |
| CN110093436B (en) | SNP locus multicolor fluorescence detection primer, kit and detection method for identifying eucalyptus clone and application of SNP locus multicolor fluorescence detection primer | |
| CN113403417A (en) | SSR molecular marker AerM01 for sex identification of actinidia arguta and application thereof | |
| CN106755541B (en) | Molecular marker, primer and probe for identifying lyophyllum decastes | |
| CN113388696B (en) | SSR (simple sequence repeat) marker primer group for idesia genetic resource analysis and application thereof | |
| CN104017801A (en) | Micro-extraction method for extracting DNA (Deoxyribonucleic Acid) from single pepper seed | |
| CN115838790B (en) | Molecular marker for sex identification of actinidia arguta and application of specific primer pair M4 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |