CN108977575B - Molecular marker primer for identifying kiwi fruit RC197 variety and application - Google Patents
Molecular marker primer for identifying kiwi fruit RC197 variety and application Download PDFInfo
- Publication number
- CN108977575B CN108977575B CN201811158515.9A CN201811158515A CN108977575B CN 108977575 B CN108977575 B CN 108977575B CN 201811158515 A CN201811158515 A CN 201811158515A CN 108977575 B CN108977575 B CN 108977575B
- Authority
- CN
- China
- Prior art keywords
- variety
- geo27
- kiwi fruit
- kiwi
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of molecular biology and genetic breeding, and particularly relates to a molecular marker primer for identifying kiwi fruit 'RC 197' varieties and application thereof, wherein the primer comprises the following components in parts by weight: geo27-193-F: AATCCAGAAACAATCGTGCC and Geo27-193-R: CAAGGCCGTCTTCTCTATCG. The primer provided by the invention is used for amplifying RC197 DNA, and only RC197 can specifically amplify a 261bp band; depending on the size and number of different strips, it is also possible to pair: kiwi fruits such as 'brunao', 'chu hong', 'emerald', 'east hong', 'nobu long', 'H-15', 'huaguang No. 2', 'hewde', 'kumqu', 'jin yuan', 'kumi', 'dahurian rhodo', 'milan No. 1', 'qingyuan autumi', 'qinmei', 'tong shan No. 5', 'wuzhi No. 3' are distinguished.
Description
Technical Field
The invention belongs to the technical field of molecular biology and genetic breeding, and particularly relates to a molecular marker primer for identifying an RC197 variety of kiwi fruits and application thereof.
Background
China is the origin of the plant of the genus Actinidia and the origin of the genetic resource of Actinidia chinensis. In recent years, the kiwi fruit industry in China is steadily expanded, and the cultivation area reaches 240 million mu in the whole country and the yield reaches 290 million tons as long as 2017, which all live at the first place in the world. On the aspect of variety pattern, China is based on the research of local kiwi fruit genetic resources, breeds new kiwi fruit varieties such as 'Jinyan', 'Donghong', and the like, is widely cultivated in the global range, thoroughly changes the single pattern of the world kiwi fruit industry Wei 'Haowder' variety, and promotes the diversification of kiwi fruit market and consumption.
With the increasing introduction of new kiwi fruit varieties, the identification of new varieties is a great problem to be solved urgently. At present, the patent varieties of the kiwi fruits are only identified by traditional means such as tree vigor, leaf shape, flowering phase, flower shape, fruit appearance and the like, and are difficult to avoid the influence of environment and other human factors. The uncertainty of the kiwi fruit variety limits the healthy and continuous development of the industry, and the economic benefit of the fruit grower is seriously damaged due to impure seedling varieties and even mistakes.
The molecular marker technology can quickly, accurately and efficiently identify the variety, and has important significance for ensuring the correctness of the variety in agricultural production. The method selects proper molecular markers and matched detection technology thereof, establishes a set of simple, convenient, economic, accurate and efficient variety identification and fingerprint spectrum technical system, is a method for striking the legal rights and interests of counterfeit seedlings and protecting plant genetic breeding workers and farmers, and standardizes the urgent needs of the agricultural market in China.
The molecular marker technology distinguishes different individuals by detecting variation of biological individuals on genomes, and is an ideal genetic marker developed after morphological markers and biochemical markers. The application of molecular markers in plant germplasm resource identification and breeding is becoming more mature. The SSR molecular markers are abundant in quantity, randomly and uniformly distributed in a genome, co-dominant, high in allelic variation, simple and convenient to operate and good in stability, and have been applied to the identification of varieties such as soybeans, apples and grapes. In the kiwi fruit, the molecular marker technology is applied to identification of male series varieties of kiwi fruit, so that a pollination male plant is accurately provided for a plurality of excellent kiwi fruit varieties, and the breeding efficiency of kiwi fruit is improved.
The 'RC 197' fruit is oval, the average fruit weight is 30-50g, the peel is yellow brown, the pulp is dark green or light green, the average soluble solid of the soft and ripe fruit is 10.8% -13.2%, the flavor is light, fragrant and sweet, the cold resistance and waterlogging resistance are extremely strong, and the fruit is ripe in the middle and last ten days of 9 months in Wuhan region. New plant variety protection of Ministry of agriculture was applied in 2017. The development of the molecular identification marker suitable for the 'RC 197' variety of the kiwi fruit is beneficial to definitely defining the patent variety from the molecular level and is beneficial to identifying and protecting the kiwi fruit variety.
Disclosure of Invention
The invention aims to provide a molecular marker primer for identifying a Chinese gooseberry 'RC 197' variety by utilizing a molecular marker technology, wherein the molecular marker is named as Geo27-193, and primers designed aiming at the molecular marker are Geo27-193-F: AATCCAGAAACAATCGTGCC and Geo27-193-R: CAAGGCCGTCTTCTCTATCG.
The invention also aims to provide application of the molecular marker primer for identifying the 'RC 197' variety of the kiwi fruit in kiwi fruit breeding.
In order to achieve the purpose, the invention adopts the following technical measures:
obtaining of molecular marker primers for kiwi fruit 'RC 197' variety identification: applicants downloaded the ` Hongyang ` kiwi whole gene sequence from the Actinidia chinensis genomic sequence website (http:// bioinfo. bti. corn. edu/kiwi). SSR markers are developed in the whole genome range through SSR Finder software, and gene loci are selected to design SSR marker primers according to gene structure annotation results. PCR amplification is carried out on the 'RC 197' variety of kiwi fruits by using a designed and synthesized primer, a molecular marker Geo27-193 is obtained by screening, and the designed primer is Geo27-193-F: CAAGGCCGTCTTCTCTATCG and Geo27-193-R: CAAGGCCGTCTTCTCTATCG.
The application of the molecular marker primer for identifying the 'RC 197' variety of the kiwi fruit in the kiwi fruit breeding comprises the following steps of utilizing the primer to breed the kiwi fruit, or utilizing the primer to identify the kiwi fruit variety, particularly the 'RC 197' variety, or according to the size and the number of different strips, carrying out the following steps of: the kiwi fruit wine is characterized in that the kiwi fruit wine is divided into ' Brunano ', ' Chuhong ', ' Cuiyu ', ' east hong ', ' Guichang ', ' H-15 ', ' Huaguang No. 2 ', ' Hawaide ', ' Jinkui ', ' gold round ', ' Kuimi ', ' Mantianhong ', ' Miliang No. 1 ', ' Qingyuan Qiun ' Qimei ', ' Tongshan No. 5 ', ' Wuzhu No. 3 ', ' Xiangma No. 6 ', ' Xiya No. 1 ', ' Chuanxian No. 3 ', ' Fengyue ', ' GT815 ', ' YX-H8 ', ' gold plum ', ' Jinxia ', ' MBR ', ' Moshan No. 4 ', ' Moshan No. 5 ', ' QS-5 ', ' New Youxiang ' No. 2 ', and ' kiwi fruit.
Compared with the prior art, the invention has the advantages that:
1. morphological markers are simple and intuitive, but are small in number, poor in polymorphism, and susceptible to environmental conditions. The molecular marker is simple and convenient to operate, can be detected in each tissue and development period of the plant body, and is not limited by seasons and environments. In large numbers, throughout the genome. The polymorphism is high, and a plurality of allelic variation exists among varieties.
2. The primer of the invention can be used for amplifying in kiwi fruit series varieties to obtain DNA fragments with different sizes. The molecular marker has amplification stability and can be used for identifying the 'RC 197' variety of kiwi fruits.
3. The molecular marker primer provided by the invention has high specificity and wide application range, can identify 'RC 197' varieties from 40 kiwi fruits of different varieties, utilizes the molecular marker Geo27-193 primer to amplify DNA, and only RC197 can specifically amplify a 261bp band.
4. In addition to identification of the ' RC197 ' variety based on specific bands, differentiation can be made between ' brunao ', ' chu hong ', ' emerald ', ' east hong ', ' nobilis ', ' H-15 ', ' huaguang No. 2 ', ' seaford ', ' jinkui ', ' gold circle ', ' kui ', ' mantian hong ', ' milan No. 1 ', ' qingyuan autumn ', ' qimei ', ' tong shan No. 5 ', ' wu plant No. 3 ', ' xiang ma No. 6 ', ' xiaya No. 1 ', ' chuan kiwi No. 3 ', ' plenty ', ' GT815 ', ' YX-H8 ', ' golden plum ', ' golden xia ', ' gold jade ', ' MBR No. 4 ', ' moutain No. 5 ', ' QS-5 ', ' new kiwi fruit ' 2 ' based on band size and number.
Detailed Description
The technical schemes of the invention are conventional schemes in the field if not particularly stated; the reagents or materials, unless otherwise specified, are commercially or publicly available.
Example 1:
obtaining of molecular marker primers for kiwi fruit 'RC 197' variety identification:
applicants downloaded the ` Hongyang ` kiwi whole gene sequence from the Actinidia chinensis genomic sequence website (http:// bioinfo. bti. corn. edu/kiwi). SSR markers are developed in the whole genome range through SSR Finder software, and gene loci are selected to design SSR marker primers according to gene structure annotation results. PCR amplification is carried out on the 'RC 197' variety of kiwi fruits by using a designed and synthesized primer, a molecular marker Geo27-193 is obtained by screening, and the designed primer is Geo27-193-F: CAAGGCCGTCTTCTCTATCG and Geo27-193-R: CAAGGCCGTCTTCTCTATCG.
Example 2:
the application of the molecular marker primer for the kiwi fruit 'RC 197' variety identification in variety identification:
(1) DNA samples of more than 40 different varieties of kiwi fruits are respectively extracted according to a CTAB method (the specific variety names are shown in Table 1).
(2) A mixture of 990ul HIDI and 10ul ROX500 or LIZ500 was pipetted using a sample applicator and added to a 96 well reaction plate at 10ul per well.
(3) The 96-well plate was placed in a plate centrifuge and centrifuged at 500g immediately.
(4) The sample DNA was added to each well of a 96-well plate at 50pg per sample.
(5) The corresponding reagents were added to a 96-well plate according to the following PCR reaction system, the 96-well plate was sealed with a sealing membrane, shaken, and the 96-well plate was placed in a plate centrifuge and centrifuged at 500 g. The PCR reaction was carried out according to the following procedure.
PCR reaction System
Preparation of 25. mu.l System
The primer F and the primer R are as follows: geo27-193-F: CAAGGCCGTCTTCTCTATCG and Geo27-193-R: CAAGGCCGTCTTCTCTATCG.
PCR reaction conditions
(6) Immediately after the program is finished, the 96-well plate is placed on an ice-water mixture for quick cooling, and then the 96-well plate is placed in a plate centrifuge, and the centrifugation is stopped at 2000 g.
(7) The amplified fragments were detected using a 3730xl sequencing analyzer (ABI, USA).
(8) Analyzing SSR amplification data by using Genemapper software, and detecting amplified fragment peaks by using STR capillary electrophoresis, wherein the abscissa is the size of the fragment and the ordinate is the fluorescence intensity value.
(9) The marker Geo27-193 is used for amplifying kiwi fruit varieties, only 'RC 197' can specifically amplify a 261bp band, and simultaneously, according to the sizes and the number of different bands, the method comprises the following steps: brunano ', ' Chuhong ', ' emerald ', ' east hong ', ' Guichang ', ' H-15 ', ' Huaguang No. 2 ', ' Haiword ', ' Jinkui ', ' jin yuan ', ' Kumi ', ' Mantian hong ', ' Miliang No. 1 ', ' Qingyuan Qiun ' Qimei ', ' Tongshan No. 5 ', ' Wu plant No. 3 ', ' Xiangma No. 6 ', ' Xiyaya No. 1 ', ' Chuanxiao No. 3 ', ' Fengyue ', ' MBR GT815 ', ' YX-H8 ', ' Jinmei ', ' Xujinxia ', ' jin jade ', ' MBR ', ' Mount Hushan ' 4 ', ' Moisha Mount Zhenshan No. 5 ', ' QS No. 5 ', ' New Moxiong No. 2 ', ' ChuanXiongXiaxing ', ' Zuo ' No. 3 ', ' Yu ', ' MBR ', Yu-H8 ', a ' and ' Zhao Xianshan ' are ground, and the golden plum No. 5 ' is ground by differentiation is carried out. Specific amplification results are shown in table 1.
TABLE 1 names of different varieties of Kiwi fruits and PCR amplification results of Geo27-193 primers
Sequence listing
<110> Wuhan plant garden of Chinese academy of sciences
<120> molecular marker primer for kiwi fruit RC197 variety identification and application
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
aatccagaaa caatcgtgcc 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
caaggccgtc ttctctatcg 20
Claims (4)
1. A molecular marker primer for identifying an RC197 variety of kiwi fruits is as follows: geo27-193-F: AATCCAGAAACAATCGTGCC and Geo27-193-R: CAAGGCCGTCTTCTCTATCG.
2. The use of the primers of claim 1 in the identification of kiwi fruit RC197 varieties.
3. The primer of claim 1, for use in the identification of kiwi fruit varieties "brunao", "chuhong", "emerald", "east hong", "nighong", "H-15", "huaguang No. 2", "haworth", "kukui", "golden round", "kui honey", "chun tian red", "milan No. 1", "qingyuan kui", "qiumai", "qin", "tongshan No. 5", "wu zhu No. 3", "xiang ma No. 6", "xiaya No. 1", "chuan kiwi No. 3", "yue", "golden plum", "golden chard", "jinyu", "mo No. 4", "moyao 5", "new view No. 2", "xuxiang".
4. A kit for kiwi fruit RC197 variety identification comprises primers: geo27-193-F: AATCCAGAAACAATCGTGCC and Geo27-193-R: CAAGGCCGTCTTCTCTATCG.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201811158515.9A CN108977575B (en) | 2018-09-30 | 2018-09-30 | Molecular marker primer for identifying kiwi fruit RC197 variety and application |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201811158515.9A CN108977575B (en) | 2018-09-30 | 2018-09-30 | Molecular marker primer for identifying kiwi fruit RC197 variety and application |
Publications (2)
Publication Number | Publication Date |
---|---|
CN108977575A CN108977575A (en) | 2018-12-11 |
CN108977575B true CN108977575B (en) | 2021-05-11 |
Family
ID=64544317
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201811158515.9A Active CN108977575B (en) | 2018-09-30 | 2018-09-30 | Molecular marker primer for identifying kiwi fruit RC197 variety and application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN108977575B (en) |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106498070A (en) * | 2016-11-17 | 2017-03-15 | 中国科学院华南植物园 | A kind of method based on genome LoF site examination indirect association Kiwi berry kinds |
CN107164509A (en) * | 2017-06-19 | 2017-09-15 | 中国科学院武汉植物园 | A set of actinidia eriantha and the identification primer of Chinese gooseberry species intermolecular hybrid filial generation |
CN107164484A (en) * | 2017-06-06 | 2017-09-15 | 中国科学院武汉植物园 | Peasants who dig gold and the authentication method of exceedingly popular two Kiwifruit Cultivars hybrid generations |
CN107385071A (en) * | 2017-08-25 | 2017-11-24 | 中国科学院武汉植物园 | Molecular labeling primer and application for Kiwi berry mill mountain system row Male cultivar identification |
-
2018
- 2018-09-30 CN CN201811158515.9A patent/CN108977575B/en active Active
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106498070A (en) * | 2016-11-17 | 2017-03-15 | 中国科学院华南植物园 | A kind of method based on genome LoF site examination indirect association Kiwi berry kinds |
CN107164484A (en) * | 2017-06-06 | 2017-09-15 | 中国科学院武汉植物园 | Peasants who dig gold and the authentication method of exceedingly popular two Kiwifruit Cultivars hybrid generations |
CN107164509A (en) * | 2017-06-19 | 2017-09-15 | 中国科学院武汉植物园 | A set of actinidia eriantha and the identification primer of Chinese gooseberry species intermolecular hybrid filial generation |
CN107385071A (en) * | 2017-08-25 | 2017-11-24 | 中国科学院武汉植物园 | Molecular labeling primer and application for Kiwi berry mill mountain system row Male cultivar identification |
Non-Patent Citations (1)
Title |
---|
RC197;佚名;《2018年3月1日品种权申请公告》;20180301(第112期);1-2 * |
Also Published As
Publication number | Publication date |
---|---|
CN108977575A (en) | 2018-12-11 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN107385071B (en) | Molecular marker primer for identifying male varieties of kiwi fruit Moshan series and application | |
CN107338318B (en) | Molecular marker Geo101 primer for identifying male varieties of kiwi fruit Moshan series and application | |
CN113637794B (en) | SSR molecular marker of new variety of mulberry, namely Guangdong mulberry 201, and core primer group, kit and application thereof | |
CN107326091B (en) | Molecular marker Geo168 primer for identifying male varieties of kiwi fruit Moshan series and application | |
Yunli et al. | Genetic diversity of pumpkin based on morphological and SSR markers | |
CN113789408B (en) | Screening and application of SSR molecular marker primers for identifying variety of non-heading Chinese cabbage | |
CN110063253B (en) | Method for breeding high-yield shinyleaf yellowhorn strain | |
CN108796111B (en) | Molecular marker primer for identifying kiwi fruit and golden plum varieties and application | |
CN109055599B (en) | Molecular marker primer for identifying Jinmei variety of kiwi fruit and application thereof | |
CN111349717A (en) | SSR (simple sequence repeat) markers of sweet cherry stock resources and fingerprint spectrum database thereof | |
CN108707692B (en) | Method and primer for rapidly identifying purity of hybrid seed of watermelon variety' Hubei watermelon No. 16 | |
CN108977575B (en) | Molecular marker primer for identifying kiwi fruit RC197 variety and application | |
CN113637791B (en) | Molecular marker for simultaneously identifying restorability and authenticity of pepper male sterile three-line hybrid and identification method thereof | |
CN112746124B (en) | SSR primer and method for purity identification of cauliflower hybrid seeds | |
CN113151568B (en) | SNP (Single nucleotide polymorphism) site with closely linked capsaicin content, CAPS (cleaved amplified polymorphic sequence) molecular marker of SNP site and application of CAPS molecular marker | |
CN108796116B (en) | Molecular marker primer for identifying golden round variety of kiwi fruit and application thereof | |
CN109055601B (en) | Molecular marker primer for identifying kiwi fruit and kiwi fruit 2 variety and application | |
CN108796115B (en) | Molecular marker primer for identifying kiwi fruit Jinyu variety and application thereof | |
CN108796112B (en) | Molecular marker primer for identifying kiwi fruit golden peach variety and application | |
CN109055600B (en) | Molecular marker primer for identifying variety No. 2 of kiwi fruit Hongtianhong and application thereof | |
CN108998566B (en) | Molecular marker primer for identifying super-red kiwi variety and application thereof | |
CN109055602B (en) | Molecular marker primer for identifying kiwi fruit-Dongfei variety and application thereof | |
Guan et al. | Identification of superior clones by RAPD technology in Xanthoceras sorbifolia Bge. | |
CN109055597B (en) | Molecular marker primer for identifying kiwi fruit and kiwi fruit variety No. 1 and application | |
CN109207629B (en) | SSR molecular marker BvRE049 for detecting granularity of beet seeds and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |