CN108977575A - Molecular labeling primer and application for Kiwi berry RC197 cultivar identification - Google Patents
Molecular labeling primer and application for Kiwi berry RC197 cultivar identification Download PDFInfo
- Publication number
- CN108977575A CN108977575A CN201811158515.9A CN201811158515A CN108977575A CN 108977575 A CN108977575 A CN 108977575A CN 201811158515 A CN201811158515 A CN 201811158515A CN 108977575 A CN108977575 A CN 108977575A
- Authority
- CN
- China
- Prior art keywords
- kiwi berry
- primer
- geo27
- application
- identification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to molecular biology and Biotechnology in Genetic Breeding fields, it is more particularly to the molecular labeling primer and application for Kiwi berry ' RC197 ' cultivar identification, the primer are as follows: Geo27-193-F:AATCCAGAAACAATCGTGCC and Geo27-193-R:CAAGGCCGTCTTCTCTATCG.It is expanded using primer pair RC197 DNA provided by the invention, the band for amplifying 261bp that only RC197 can be specific；, can also be right according to the size and number of different bands: ' Bu Lunuo ', ' Chu Hong ', ' emerald ', ' east is red ', ' your length ', ' H-15 ', ' magnificent light 2 ', ' Hayward ', ' Jin Kui ', ' gold circle ', ' chief's honey ', ' all over the sky red ', ' summer millet ', ' Kiwi berrys such as Qingyuan Qiu Cui ', ' Qin Mei ', ' logical mountain 5 ', ' force plants No. 3 ' distinguish.
Description
Technical field
The invention belongs to molecular biology and Biotechnology in Genetic Breeding field, it is more particularly to for Kiwi berry RC197 kind
The molecular labeling primer and application of identification.
Background technique
China is the source area of actinidia and the original centre of origin of Kiwi berry genetic resources.In recent years, China
Kiwi berry industry expands steadily, and by 2017, national cultivated area 2,900,000 tons of yield, occupied first place in the world up to 2,400,000 mu.
In kind pattern, China is studied based on native country Kiwi berry genetic resources, and it is new to have selected the Kiwi berrys such as ' Jin Yan ', ' east is red '
Kind, cultivation extensively, revolutionizes the single pattern of world's Kiwi berry industry only ' Hayward ' kind in the world, pushes
The diversification of Kiwi berry market diversification and consumption.
With the increasingly release of Kiwi berry new varieties, the identification of new varieties is a great problem urgently to be resolved.Currently, to Mi
The identification of monkey peach patent kind only passes through the traditional means such as tree vigo(u)r, leaf morphology, florescence, floral shape, fruit appearance, inevitably by
The influence of environment and other human factors.To the uncertainty of Kiwifruit Cultivars, the healthy and sustainable development of industry, and seedling are limited
The wooden kind is impure or even wrong orchard worker's economic benefit will be caused to be badly damaged.
Molecular marking technique can quickly, it is accurate, efficiently kind is identified, to guaranteeing the correct of kind in agricultural production
Property has great importance.The suitable molecular labeling of selection and its mating detection technique, establish it is a set of easy, economical, accurate and
Efficient cultivar identification and fingerprint pattern technology system, be hit fake and forged seedling, protection plant genetics and breeding worker and
The legitimate rights and interests of peasant, specification China agricultural, commodities market there is an urgent need to.
The variation that molecular marking technique is generated in the genome by detecting bion, to carry out area to Different Individual
Point, it is the ideal genetic marker of one kind of development after morphological markers and biochemical marker.It is identified in plant germplasm resource
And in breeding, reach its maturity to the application of molecular labeling.SSR molecular marker quantity is abundant and is uniformly distributed in gene at random
Group is in codominance, and allelic variation is high, and easy to operate and stability is good, has been applied to the cultivar identifications sides such as soybean, apple and grape
Face.In Kiwi berry, it has been multiple excellent Kiwi berry product that molecular marking technique is applied to the identification of Kiwi berry male series of products
Kind is accurate to provide pollination staminiferous plant, promotes the breeding efficiency of Kiwi berry.
' RC197 ' fruit ellipse, Mean Fruit Weight 30-50g, pericarp yellowish-brown, pulp bottle green or light green color, soft ripe fruit
The real soluble solid 10.8%-13.2% that is averaged, flavor is light fragrant and sweet, resists cold waterlogging very competent, in the September of Wuhan Area under
Ten days is mature.Application Ministry of Agriculture's New species right in plant protection in 2017.Exploitation is suitable for the Molecular Identification of Kiwi berry ' RC197 ' kind
Label, is conducive to clearly define patent kind from molecular level, carries out identification and kind protection conducive to Kiwifruit Cultivars.
Summary of the invention
It is an object of the invention to utilize molecular marking technique, one kind is provided for Kiwi berry ' RC197 ' cultivar identification
Molecular labeling primer, the molecular labeling are named as Geo27-193, and the primer for its design is Geo27-193-F:
AATCCAGAAACAATCGTGCC and Geo27-193-R:CAAGGCCGTCTTCTCTATCG.
It is another object of the present invention to provide the molecular labeling primers for being used for Kiwi berry ' RC197 ' cultivar identification to exist
Application in Kiwi berry breeding.
In order to achieve the above object, the present invention takes following technical measures:
The acquisition of molecular labeling primer for Kiwi berry ' RC197 ' cultivar identification: applicant is from Kiwi berry genome sequence
It arranges website (http://bioinfo.bti.cornell.edu/kiwi) and downloads ' Red Male ' Kiwi berry complete genome sequence.Pass through SSR
Finder software developing SSR within the scope of full-length genome marks, and is annotated according to gene structure as a result, selecting gene loci design
SSR label primer.Using the primer of design synthesis, PCR amplification is carried out to Kiwi berry ' RC197 ' kind, screening obtains molecule mark
Remember Geo27-193, the primer for its design is Geo27-193-F:CAAGGCCGTCTTCTCTATCG and Geo27-193-R:
CAAGGCCGTCTTCTCTATCG。
Application of the molecular labeling primer in Kiwi berry breeding for Kiwi berry ' RC197 ' cultivar identification, including the use of
Primer of the invention is used for Kiwi berry breeding, or utilizes primer pair Kiwifruit Cultivars of the invention, especially ' RC197 ' kind
Identified, or according to the size and number of different bands, to different cultivars include: ' Bu Lunuo ', ' Chu Hong ', ' emerald ',
' east is red ', ' your length ', ' H-15 ', ' magnificent light 2 ', ' Hayward ', ' Jin Kui ', ' gold circle ', ' chief's honey ', ' all over the sky red ', ' rice good 1
Number ', ' Qingyuan Qiu Cui ', ' Qin Mei ', ' logical mountain 5 ', ' force plants No. 3 ', ' Hunan fiber crops No. 6 ', ' tall building is No. 1 sub- ', ' river Mi 3 ', ' rich
It is happy ', ' GT815 ', ' YX-H8 ', ' Jin Mei ', ' Jin Xia ', ' gold and jade ', ' MBR ', ' mill mountain 4 ', ' mill mountain hero 5 ', ' QS-5 ',
' new to see No. 2 ', ' Xu Xiang ' Kiwi berry distinguish.
Compared with prior art, advantages of the present invention:
1. morphological markers simple, intuitive, but quantity is few, polymorphism is poor, vulnerable to environmental influence.Molecular labeling operation
Simplicity, it is detectable in each tissue and developmental stage of plant, not by season and environmental restrictions.Quantity is more, throughout entire
Genome.Polymorphism is high, and there are many allelic variations between kind.
2. primer of the invention can expand in kiwi series kind and obtain different size of DNA fragmentation.The molecule mark
Note amplification stability, can be used to carry out the identification of Kiwi berry ' RC197 ' kind.
3. molecular labeling primer specificity provided by the invention is high, applied widely, can be from the Mi of 40 multiple and different kinds
' RC197 ' kind is identified in monkey peach, is expanded using molecular labeling Geo27-193 primer pair DNA, only RC197 can
The band for amplifying 261bp of specificity.
4. in addition to identifying ' RC197 ' kind according to specific band, can also according to stripe size and number to ' Bu Lunuo ',
' Chu Hong ', ' emerald ', ' east red ', ' your length ', ' H-15 ', ' magnificent light 2 ', ' Hayward ', ' Jin Kui ', ' gold circle ', ' chief's honey ',
' all over the sky red ', ' summer millet ', ' Qingyuan Qiu Cui ', ' Qin Mei ', ' logical mountain 5 ', ' force plants No. 3 ', ' Hunan fiber crops No. 6 ', ' tall building is No. 1 sub- ',
' river Mi 3 ', ' Feng Yue ', ' GT815 ', ' YX-H8 ', ' Jin Mei ', ' Jin Xia ', ' gold and jade ', ' MBR ', ' mill mountain 4 ', ' mill mountain is male
No. 5 ', ' QS-5 ', ' new to see No. 2 ', ' Xu Xiang ' Kiwi berry distinguishes.
Specific embodiment
Technical solution of the present invention is if not otherwise specified the conventional scheme of this field；The reagent or material,
If not otherwise specified, business or disclosed channel are derived from.
Embodiment 1:
The acquisition of molecular labeling primer for Kiwi berry ' RC197 ' cultivar identification:
Applicant downloads from Kiwi berry genome sequence website (http://bioinfo.bti.cornell.edu/kiwi)
' Red Male ' Kiwi berry complete genome sequence.By SSR Finder software, developing SSR is marked within the scope of full-length genome, according to gene
Structure annotation is as a result, selection gene loci designs SSR label primer.Using the primer of design synthesis, to Kiwi berry ' RC197 ' product
Kind carries out PCR amplification, and screening obtains molecular labeling Geo27-193, and the primer for its design is Geo27-193-F:
CAAGGCCGTCTTCTCTATCG and Geo27-193-R:CAAGGCCGTCTTCTCTATCG.
Embodiment 2:
Application of the molecular labeling primer in cultivar identification for Kiwi berry ' RC197 ' cultivar identification:
(1) DNA sample (the specific variety name such as table 1 of 40 multiple and different kind Kiwi berrys is extracted respectively according to CTAB method
It is shown).
(2) mixture that 990ul HIDI and 10ul ROX500 or LIZ500 are drawn using sample injector, it is anti-to be added to 96 holes
It answers in plate, every hole 10ul.
(3) 96 orifice plates are placed in plate centrifuge, centrifugation 500g stops.
(4) each sample DNA, each sample 50pg are separately added into the corresponding hole of 96 orifice plates.
(5) corresponding reagent is added to 96 orifice plates referring to following PCR reaction system, seals 96 orifice plates using sealing plate film, vibrates,
96 orifice plates are placed in plate centrifuge, centrifugation 500g stops.PCR reaction is carried out according to following procedure.
A.PCR reaction system
The preparation of 25 μ l systems
The primers F and primer R are as follows: Geo27-193-F:CAAGGCCGTCTTCTCTATCG and Geo27-193-R:
CAAGGCCGTCTTCTCTATCG。
B.PCR reaction condition
(6) 96 orifice plates are placed in rapid cooling on mixture of ice and water immediately after EP (end of program), then 96 orifice plates is placed in plate
In centrifuge, centrifugation 2000g stops.
(7) amplified fragments are detected using 3730xl sequencing analysis instrument (American AB I company).
(8) SSR amplification data is analyzed using Genemapper software, using STR capillary electrophoresis detection amplified fragments peak,
Abscissa is clip size, and ordinate is fluorescence intensity level.
(9) Kiwifruit Cultivars are expanded using label Geo27-193, the item for amplifying 261bp that only ' RC197 ' can be specific
Band, while according to the size and number of different bands, to different cultivars include: Bu Lunuo ', ' Chu Hong ', ' emerald ', ' east is red ',
' your length ', ' H-15 ', ' magnificent light 2 ', ' Hayward ', ' Jin Kui ', ' gold circle ', ' chief's honey ', ' all over the sky red ', ' summer millet ', ' celebrating
First autumn is emerald green ', ' Qin Mei ', ' logical mountain 5 ', ' force plants No. 3 ', ' Hunan fiber crops No. 6 ', ' tall building is No. 1 sub- ', ' river Mi 3 ', ' Feng Yue ',
' GT815 ', ' YX-H8 ', ' Jin Mei ', ' Jin Xia ', ' gold and jade ', ' MBR ', ' mill mountain 4 ', ' mill mountain is No. 5 male ', ' QS-5 ', ' new sight
No. 2 ', ' Xu Xiang ', ' river Mi 3 ', ' Feng Yue ', YX-H8, Jin Mei, Jin Xia, gold and jade, MBR, mill mountain 4, mill mountain be No. 5 male, QS-5,
New sight 2, Xu Xiang Kiwi berry distinguish.Specific amplification is as shown in table 1.
1 different cultivars Kiwi berry title of table and Geo27-193 primer PCR amplification
Sequence table
<110>Wuhan Botanical Garden, Chinese Acadmey of Sciences
<120>molecular labeling primer and application of Kiwi berry RC197 cultivar identification are used for
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
aatccagaaa caatcgtgcc 20
<210> 2
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
caaggccgtc ttctctatcg 20
Claims (6)
1. being used for the molecular labeling primer of Kiwi berry RC197 cultivar identification, the primer are as follows: Geo27-193-F:
AATCCAGAAACAATCGTGCC and Geo27-193-R:CAAGGCCGTCTTCTCTATCG.
2. application of the primer described in claim 1 in Kiwi berry breeding.
3. application of the primer described in claim 1 in Kiwifruit Cultivars identification.
4. application of the primer described in claim 1 in Kiwi berry RC197 cultivar identification.
5. primer described in claim 1 Kiwi berry ' Bu Lunuo ', ' Chu Hong ', ' emerald ', ' east red ', ' your length ', ' H-15 ',
' magnificent light 2 ', ' Hayward ', ' Jin Kui ', ' gold circle ', ' chief's honey ', ' all over the sky red ', ' summer millet ', ' Qingyuan Qiu Cui ', ' Qin Mei ',
' logical mountain 5 ', ' force plants No. 3 ', ' Hunan fiber crops No. 6 ', ' tall building is No. 1 sub- ', ' river Mi 3 ', ' Feng Yue ', ' GT815 ', ' YX-H8 ', ' gold
Plum ', ' Jin Xia ', ' gold and jade ', ' MBR ', ' mill mountain 4 ', ' mill mountain is No. 5 male ', ' QS-5 ', ' new to see No. 2 ', ' Xu Xiang ' Kiwi berry product
Application in kind identification.
6. a kind of kit for Kiwi berry RC197 cultivar identification, including primer: Geo27-193-F:
AATCCAGAAACAATCGTGCC and Geo27-193-R:CAAGGCCGTCTTCTCTATCG.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811158515.9A CN108977575B (en) | 2018-09-30 | 2018-09-30 | Molecular marker primer for identifying kiwi fruit RC197 variety and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811158515.9A CN108977575B (en) | 2018-09-30 | 2018-09-30 | Molecular marker primer for identifying kiwi fruit RC197 variety and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108977575A true CN108977575A (en) | 2018-12-11 |
| CN108977575B CN108977575B (en) | 2021-05-11 |
Family
ID=64544317
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811158515.9A Active CN108977575B (en) | 2018-09-30 | 2018-09-30 | Molecular marker primer for identifying kiwi fruit RC197 variety and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108977575B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106498070A (en) * | 2016-11-17 | 2017-03-15 | 中国科学院华南植物园 | A kind of method based on genome LoF site examination indirect association Kiwi berry kinds |
| CN107164484A (en) * | 2017-06-06 | 2017-09-15 | 中国科学院武汉植物园 | Peasants who dig gold and the authentication method of exceedingly popular two Kiwifruit Cultivars hybrid generations |
| CN107164509A (en) * | 2017-06-19 | 2017-09-15 | 中国科学院武汉植物园 | A set of actinidia eriantha and the identification primer of Chinese gooseberry species intermolecular hybrid filial generation |
| CN107385071A (en) * | 2017-08-25 | 2017-11-24 | 中国科学院武汉植物园 | Molecular labeling primer and application for Kiwi berry mill mountain system row Male cultivar identification |
-
2018
- 2018-09-30 CN CN201811158515.9A patent/CN108977575B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106498070A (en) * | 2016-11-17 | 2017-03-15 | 中国科学院华南植物园 | A kind of method based on genome LoF site examination indirect association Kiwi berry kinds |
| CN107164484A (en) * | 2017-06-06 | 2017-09-15 | 中国科学院武汉植物园 | Peasants who dig gold and the authentication method of exceedingly popular two Kiwifruit Cultivars hybrid generations |
| CN107164509A (en) * | 2017-06-19 | 2017-09-15 | 中国科学院武汉植物园 | A set of actinidia eriantha and the identification primer of Chinese gooseberry species intermolecular hybrid filial generation |
| CN107385071A (en) * | 2017-08-25 | 2017-11-24 | 中国科学院武汉植物园 | Molecular labeling primer and application for Kiwi berry mill mountain system row Male cultivar identification |
Non-Patent Citations (1)
| Title |
|---|
| 佚名: "RC197", 《2018年3月1日品种权申请公告》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108977575B (en) | 2021-05-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107385071A (en) | Molecular labeling primer and application for Kiwi berry mill mountain system row Male cultivar identification | |
| CN107338318A (en) | Molecular labeling Geo101 primers and application for Kiwi berry mill mountain system row Male cultivar identification | |
| CN104946640A (en) | Specificity labeling primer for tea-oil tree improved variety Chang Lin 18 and detection method | |
| CN107326091A (en) | Molecular labeling Geo168 primers and the application of mountain system row Male cultivar identification are ground for Kiwi berry | |
| CN109055599A (en) | Molecular labeling primer and application for the U.S. cultivar identification of Kiwi berry gold | |
| CN104673790A (en) | Molecular-specificity labeling primer for oil-tea good-variety longlin 18 and identification method | |
| CN110273020A (en) | For distinguishing the SNP marker and application of citrus summer orange and common sweet orange | |
| CN108796111A (en) | Molecular labeling primer for Kiwi berry gold plum cultivar identification and application | |
| CN108796113B (en) | Molecular labeling primer and application for the red cultivar identification in Kiwi berry east | |
| CN108977575A (en) | Molecular labeling primer and application for Kiwi berry RC197 cultivar identification | |
| CN106636325B (en) | A method of detection iris mutant | |
| CN109055601A (en) | Molecular labeling primer and application for No. 2 cultivar identifications of Kiwi berry Mi jujube | |
| CN104946641A (en) | Specificity labeling primer for camellia oleifera improved varieties changlin number three and twenty one and detection method | |
| CN112725521B (en) | Dendrobium chrysotoxum SSR molecular marker primer composition and application thereof | |
| CN108998566A (en) | Molecular labeling primer and application for the exceedingly popular cultivar identification of Kiwi berry | |
| CN109055600A (en) | Expire the molecular labeling primer and application of Tianhong No.2 cultivar identification for Kiwi berry | |
| CN108796116A (en) | Justify molecular labeling primer and the application of cultivar identification for Kiwi berry gold | |
| CN109055597A (en) | Molecular labeling primer and application for No. 1 cultivar identification of Kiwi berry Mi jujube | |
| CN108796114A (en) | Molecular labeling primer for the gorgeous cultivar identification of Kiwi berry gold and application | |
| CN105420354B (en) | Conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18 identification methods based on InDel label | |
| CN109055602A (en) | Molecular labeling primer and application for Kiwi berry east rose cultivar identification | |
| CN108796115A (en) | Molecular labeling primer for Kiwi berry gold and jade cultivar identification and application | |
| CN108796112A (en) | Molecular labeling primer for the identification of Kiwi berry gold Peach cultivars and application | |
| CN106755288B (en) | Molecular identification method of lotus leaf of tongshan | |
| KR101928567B1 (en) | Primer set for discrimination of Taxillus chinensis, Viscum articulatum, Viscum coloratum, Macrosolen tricolor and Taxillus sutchuenensis and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |