CN109055600A - Expire the molecular labeling primer and application of Tianhong No.2 cultivar identification for Kiwi berry - Google Patents
Expire the molecular labeling primer and application of Tianhong No.2 cultivar identification for Kiwi berry Download PDFInfo
- Publication number
- CN109055600A CN109055600A CN201811157326.XA CN201811157326A CN109055600A CN 109055600 A CN109055600 A CN 109055600A CN 201811157326 A CN201811157326 A CN 201811157326A CN 109055600 A CN109055600 A CN 109055600A
- Authority
- CN
- China
- Prior art keywords
- kiwi berry
- tianhong
- primer
- geo9
- jin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to molecular biology and Biotechnology in Genetic Breeding fields, it is more particularly to for Kiwi berry ' molecular labeling primer and application of full Tianhong No.2 ' cultivar identification, the primer are as follows: Geo9-231-F:CCATTTATTTTGTCCAGGCG and Geo9-231-R:GGGTGGTAATACTATCGCCATT.Expire Tianhong No.2 DNA using primer pair provided by the invention to be expanded, the band for amplifying 313bp that only completely Tianhong No.2 can be specific；, can also be right according to the size and number of different bands: the Kiwi berrys such as ' Bu Lunuo ', ' emerald ', ' GT815 ', ' your length ', ' Feng Yue ', ' YH-H8 ', ' Hua You ', ' Jin Kui ', ' Jin Tao ', ' Jin Xia ' distinguish.
Description
Technical field
The invention belongs to molecular biology and Biotechnology in Genetic Breeding field, it is more particularly to expire Tianhong No.2 for Kiwi berry
The molecular labeling primer and application of cultivar identification.
Background technique
China is the source area of actinidia and the original centre of origin of Kiwi berry genetic resources.In recent years, China
Kiwi berry industry expands steadily, and by 2017, national cultivated area 2,900,000 tons of yield, occupied first place in the world up to 2,400,000 mu.
In kind pattern, China is studied based on native country Kiwi berry genetic resources, and it is new to have selected the Kiwi berrys such as ' Jin Yan ', ' east is red '
Kind, cultivation extensively, revolutionizes the single pattern of world's Kiwi berry industry only ' Hayward ' kind in the world, pushes
The diversification of Kiwi berry market diversification and consumption.
With the increasingly release of Kiwi berry new varieties, the identification of new varieties is a great problem urgently to be resolved.Currently, to Mi
The identification of monkey peach patent kind only passes through the traditional means such as tree vigo(u)r, leaf morphology, florescence, floral shape, fruit appearance, inevitably by
The influence of environment and other human factors.To the uncertainty of Kiwifruit Cultivars, the healthy and sustainable development of industry, and seedling are limited
The wooden kind is impure or even wrong orchard worker's economic benefit will be caused to be badly damaged.
Molecular marking technique can quickly, it is accurate, efficiently kind is identified, to guaranteeing the correct of kind in agricultural production
Property has great importance.The suitable molecular labeling of selection and its mating detection technique, establish it is a set of easy, economical, accurate and
Efficient cultivar identification and fingerprint pattern technology system, be hit fake and forged seedling, protection plant genetics and breeding worker and
The legitimate rights and interests of peasant, specification China agricultural, commodities market there is an urgent need to.
The variation that molecular marking technique is generated in the genome by detecting bion, to carry out area to Different Individual
Point, it is the ideal genetic marker of one kind of development after morphological markers and biochemical marker.It is identified in plant germplasm resource
And in breeding, reach its maturity to the application of molecular labeling.SSR molecular marker quantity is abundant and is uniformly distributed in gene at random
Group is in codominance, and allelic variation is high, and easy to operate and stability is good, has been applied to the cultivar identifications sides such as soybean, apple and grape
Face.In Kiwi berry, it has been multiple excellent Kiwi berry product that molecular marking technique is applied to the identification of Kiwi berry male series of products
Kind is accurate to provide pollination staminiferous plant, promotes the breeding efficiency of Kiwi berry.
' full Tianhong No.2 ' Kiwi berry is that open interspecific hybridization Seedling tree unexpected mass incident forms.Pattern rose, fruit
True length is cylindrical, and fruit is beautiful and tidy, Mean Fruit Weight 65~75g, maximum fruit weight 109g, Beijing opera brown, pulp yellow, soft ripe to contain
Soluble solid content is up to 17%, total reducing sugar 10.5%, total acid 1.4%, Vitamin C content 78mg/100g, dry matter 18.5%
More than, flavor quality is excellent.In application Plant new variety protection in 2017.Exploitation, which is suitable for Kiwi berry, ' expires Tianhong No.2 ' kind
Molecular Identification label, is conducive to clearly define patent kind from molecular level, carries out identification and product conducive to Kiwifruit Cultivars
Kind protection.
Summary of the invention
It is an object of the invention to utilize molecular marking technique, provide a kind of for Kiwi berry ' full Tianhong No.2 ' kind mirror
Fixed molecular labeling primer, the molecular labeling are named as Geo9-231, and the primer for its design is Geo9-231-F:
CCATTTATTTTGTCCAGGCG and Geo9-231-R:GGGTGGTAATACTATCGCCATT.
It is another object of the present invention to provide for Kiwi berry, ' molecular labeling of full Tianhong No.2 ' cultivar identification draws
Application of the object in Kiwi berry breeding.
In order to achieve the above object, the present invention takes following technical measures:
For the Kiwi berry ' acquisition of the molecular labeling primer of full Tianhong No.2 ' cultivar identification: applicant is from Kiwi berry gene
Group sequence website (http://bioinfo.bti.cornell.edu/kiwi) downloads ' Red Male ' Kiwi berry complete genome sequence.It is logical
It crosses SSR Finder software developing SSR within the scope of full-length genome to mark, be annotated according to gene structure as a result, selecting gene loci
Design SSR label primer.Using the primer of design synthesis, to Kiwi berry, ' full Tianhong No.2 ' kind carries out PCR amplification, screens
To molecular labeling Geo9-231, the primer for its design is Geo9-231-F:CCATTTATTTTGTCCAGGCG and Geo9-
231-R:GGGTGGTAATACTATCGCCATT。
For Kiwi berry ' application of the molecular labeling primer of full Tianhong No.2 ' cultivar identification in Kiwi berry breeding, including
It is used for Kiwi berry breeding using primer of the invention, or utilizes primer pair Kiwifruit Cultivars of the invention, it is especially ' all over the sky red
No. 2 ' kind identified, or according to the size and number of different bands, to different cultivars include: ' Bu Lunuo ', ' emerald ',
' GT815 ', ' your length ', ' Feng Yue ', ' YH-H8 ', ' Hua You ', ' Jin Kui ', ' Jin Tao ', ' Jin Xia ', ' Jin Yan ', ' chief is close ', ' Longshan
Red ', ' summer millet ', ' mill mountain 4 ', ' Qin Mei ', ' No. WH-1 ', ' Hunan fiber crops No. 6 ', ' rivers and mountains is tender ', ' Hayward ', ' tall building Asia 1
Number ', ' mill mountain is No. 5 male ', ' gold circle ', ' new to see No. 2 ' Kiwi berry distinguish.
Compared with prior art, advantages of the present invention:
1. morphological markers simple, intuitive, but quantity is few, polymorphism is poor, vulnerable to environmental influence.Molecular labeling operation
Simplicity, it is detectable in each tissue and developmental stage of plant, not by season and environmental restrictions.Quantity is more, throughout entire
Genome.Polymorphism is high, and there are many allelic variations between kind.
2. primer of the invention can expand in kiwi series kind and obtain different size of DNA fragmentation.The molecule mark
Note amplification stability can be used to carry out the Kiwi berry ' identification of full Tianhong No.2 ' kind.
3. molecular labeling primer specificity provided by the invention is high, applied widely, can be from the Mi of 40 multiple and different kinds
To ' full Tianhong No.2 ' kind is identified, is expanded using molecular labeling Geo9-231 primer pair DNA, only over the sky in monkey peach
Red No. 2 the bands for amplifying 313bp that can be specific.
4. in addition to identifying that ' full Tianhong No.2 ' kind, can also be according to stripe size and number to ' Bu Lu according to specific band
Promise ', ' emerald ', ' GT815 ', ' your length ', ' Feng Yue ', ' YH-H8 ', ' Hua You ', ' Jin Kui ', ' Jin Tao ', ' Jin Xia ', ' Jin Yan ',
' chief close ', ' Longshan is red ', ' summer millet ', ' mill mountain 4 ', ' Qin Mei ', ' No. WH-1 ', ' Hunan fiber crops No. 6 ', ' rivers and mountains is tender ', ' sea is fertile
Moral ', ', tall building was No. 1 sub- ', ' mill mountain is No. 5 male ', ' gold circle ', ' new to see No. 2 ' Kiwi berry distinguish.
Specific embodiment
Technical solution of the present invention is if not otherwise specified the conventional scheme of this field；The reagent or material,
If not otherwise specified, business or disclosed channel are derived from.
Embodiment 1:
For the Kiwi berry ' acquisition of the molecular labeling primer of full Tianhong No.2 ' cultivar identification:
Applicant downloads from Kiwi berry genome sequence website (http://bioinfo.bti.cornell.edu/kiwi)
' Red Male ' Kiwi berry complete genome sequence.By SSR Finder software, developing SSR is marked within the scope of full-length genome, according to gene
Structure annotation is as a result, selection gene loci designs SSR label primer.Using the primer of design synthesis, to Kiwi berry ' all over the sky red 2
Number ' kind progress PCR amplification, it screens and obtains molecular labeling Geo9-231, the primer for its design is Geo9-231-F:
CCATTTATTTTGTCCAGGCG and Geo9-231-R:GGGTGGTAATACTATCGCCATT.
Embodiment 2:
For Kiwi berry ' application of the molecular labeling primer of full Tianhong No.2 ' cultivar identification in cultivar identification:
(1) DNA sample (the specific variety name such as table 1 of 40 multiple and different kind Kiwi berrys is extracted respectively according to CTAB method
It is shown).
(2) mixture that 990ul HIDI and 10ul ROX500 or LIZ500 are drawn using sample injector, it is anti-to be added to 96 holes
It answers in plate, every hole 10ul.
(3) 96 orifice plates are placed in plate centrifuge, centrifugation 500g stops.
(4) each sample DNA, each sample 50pg are separately added into the corresponding hole of 96 orifice plates.
(5) corresponding reagent is added to 96 orifice plates referring to following PCR reaction system, seals 96 orifice plates using sealing plate film, vibrates,
96 orifice plates are placed in plate centrifuge, centrifugation 500g stops.PCR reaction is carried out according to following procedure.
A.PCR reaction system
The preparation of 25 μ l systems
The primers F and primer R are as follows: Geo9-231-F:CCATTTATTTTGTCCAGGCG and Geo9-231-R:
GGGTGGTAATACTATCGCCATT。
B.PCR reaction condition
(6) 96 orifice plates are placed in rapid cooling on mixture of ice and water immediately after EP (end of program), then 96 orifice plates is placed in plate
In centrifuge, centrifugation 2000g stops.
(7) amplified fragments are detected using 3730xl sequencing analysis instrument (American AB I company).
(8) SSR amplification data is analyzed using Genemapper software, using STR capillary electrophoresis detection amplified fragments peak,
Abscissa is clip size, and ordinate is fluorescence intensity level.
(9) Kiwifruit Cultivars are expanded using label Geo9-231, what only ' full Tianhong No.2 ' can be specific amplifies 313bp
Band, while according to the size and number of different bands, to different cultivars include: ' Bu Lunuo ', ' emerald ', ' GT815 ',
' your length ', ' Feng Yue ', ' YH-H8 ', ' Hua You ', ' Jin Kui ', ' Jin Tao ', ' Jin Xia ', ' Jin Yan ', ' chief is close ', ' Longshan is red ', ' rice
Good No. 1 ', ' mill mountain 4 ', ' Qin Mei ', ' No. WH-1 ', ' Hunan fiber crops No. 6 ', ' rivers and mountains is tender ', ' Hayward ', ' tall building is No. 1 sub- ', ' mill mountain
Male No. 5 ', ' gold circle ', ' new to see No. 2 ' Kiwi berry distinguish.Specific amplification is as shown in table 1.
1 different cultivars Kiwi berry title of table and Geo9-231 primer PCR amplification
Sequence table
<110>Wuhan Botanical Garden, Chinese Acadmey of Sciences
<120>expire the molecular labeling primer and application of Tianhong No.2 cultivar identification for Kiwi berry
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
ccatttattt tgtccaggcg 20
<210> 2
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
gggtggtaat actatcgcca tt 22
Claims (6)
1. expiring the molecular labeling primer of Tianhong No.2 cultivar identification for Kiwi berry, the primer are as follows: Geo9-231-F:
CCATTTATTTTGTCCAGGCG and Geo9-231-R:GGGTGGTAATACTATCGCCATT.
2. application of the primer described in claim 1 in Kiwi berry breeding.
3. application of the primer described in claim 1 in Kiwifruit Cultivars identification.
4. primer described in claim 1 expires the application in Tianhong No.2 cultivar identification in Kiwi berry.
5. primer described in claim 1 is in Kiwi berry ' Bu Lunuo ', ' emerald ', ' GT815 ', ' your length ', ' Feng Yue ', ' YH-
H8 ', ' Hua You ', ' Jin Kui ', ' Jin Tao ', ' Jin Xia ', ' Jin Yan ', ' chief close ', ' Longshan is red ', ' summer millet ', ' mill mountain 4 ',
' Qin Mei ', ' No. WH-1 ', ' Hunan fiber crops No. 6 ', ' rivers and mountains is tender ', ' Hayward ', ' tall building is No. 1 sub- ', ' mill mountain is No. 5 male ', ' gold circle ', ' new
Application in the identification of sight 2 ' Kiwifruit Cultivars.
6. a kind of kit for expiring Tianhong No.2 cultivar identification for Kiwi berry, including primer: Geo9-231-F:
CCATTTATTTTGTCCAGGCG and Geo9-231-R:GGGTGGTAATACTATCGCCATT.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811157326.XA CN109055600B (en) | 2018-09-30 | 2018-09-30 | Molecular marker primer for identifying variety No. 2 of kiwi fruit Hongtianhong and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811157326.XA CN109055600B (en) | 2018-09-30 | 2018-09-30 | Molecular marker primer for identifying variety No. 2 of kiwi fruit Hongtianhong and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109055600A true CN109055600A (en) | 2018-12-21 |
| CN109055600B CN109055600B (en) | 2021-05-04 |
Family
ID=64767093
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811157326.XA Active CN109055600B (en) | 2018-09-30 | 2018-09-30 | Molecular marker primer for identifying variety No. 2 of kiwi fruit Hongtianhong and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109055600B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107326091A (en) * | 2017-08-25 | 2017-11-07 | 中国科学院武汉植物园 | Molecular labeling Geo168 primers and the application of mountain system row Male cultivar identification are ground for Kiwi berry |
| CN107338318A (en) * | 2017-08-25 | 2017-11-10 | 中国科学院武汉植物园 | Molecular labeling Geo101 primers and application for Kiwi berry mill mountain system row Male cultivar identification |
| CN107385071A (en) * | 2017-08-25 | 2017-11-24 | 中国科学院武汉植物园 | Molecular labeling primer and application for Kiwi berry mill mountain system row Male cultivar identification |
-
2018
- 2018-09-30 CN CN201811157326.XA patent/CN109055600B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107326091A (en) * | 2017-08-25 | 2017-11-07 | 中国科学院武汉植物园 | Molecular labeling Geo168 primers and the application of mountain system row Male cultivar identification are ground for Kiwi berry |
| CN107338318A (en) * | 2017-08-25 | 2017-11-10 | 中国科学院武汉植物园 | Molecular labeling Geo101 primers and application for Kiwi berry mill mountain system row Male cultivar identification |
| CN107385071A (en) * | 2017-08-25 | 2017-11-24 | 中国科学院武汉植物园 | Molecular labeling primer and application for Kiwi berry mill mountain system row Male cultivar identification |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109055600B (en) | 2021-05-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107385071A (en) | Molecular labeling primer and application for Kiwi berry mill mountain system row Male cultivar identification | |
| CN107338318B (en) | Molecular marker Geo101 primer for identifying male varieties of kiwi fruit Moshan series and application | |
| CN104946640A (en) | Specificity labeling primer for tea-oil tree improved variety Chang Lin 18 and detection method | |
| CN107326091A (en) | Molecular labeling Geo168 primers and the application of mountain system row Male cultivar identification are ground for Kiwi berry | |
| CN104673790A (en) | Molecular-specificity labeling primer for oil-tea good-variety longlin 18 and identification method | |
| CN109055599A (en) | Molecular labeling primer and application for the U.S. cultivar identification of Kiwi berry gold | |
| CN105925709A (en) | PCR (Polymerase Chain Reaction) system of SCoT (Start Codon Targeted Polymorphism) molecular marker for rubus biflorus buch | |
| CN108796111A (en) | Molecular labeling primer for Kiwi berry gold plum cultivar identification and application | |
| CN108796113B (en) | Molecular labeling primer and application for the red cultivar identification in Kiwi berry east | |
| CN109055600A (en) | Expire the molecular labeling primer and application of Tianhong No.2 cultivar identification for Kiwi berry | |
| CN104946641A (en) | Specificity labeling primer for camellia oleifera improved varieties changlin number three and twenty one and detection method | |
| CN106636325B (en) | A method of detection iris mutant | |
| CN109055601A (en) | Molecular labeling primer and application for No. 2 cultivar identifications of Kiwi berry Mi jujube | |
| CN108977575A (en) | Molecular labeling primer and application for Kiwi berry RC197 cultivar identification | |
| CN103911435A (en) | Method of identifying the purity of sugarcane hybrid seeds by utilization of SSR marking and capillary electrophoresis | |
| CN109055597A (en) | Molecular labeling primer and application for No. 1 cultivar identification of Kiwi berry Mi jujube | |
| CN109055602A (en) | Molecular labeling primer and application for Kiwi berry east rose cultivar identification | |
| CN108796115A (en) | Molecular labeling primer for Kiwi berry gold and jade cultivar identification and application | |
| CN108796114A (en) | Molecular labeling primer for the gorgeous cultivar identification of Kiwi berry gold and application | |
| CN108998566A (en) | Molecular labeling primer and application for the exceedingly popular cultivar identification of Kiwi berry | |
| CN108796116A (en) | Justify molecular labeling primer and the application of cultivar identification for Kiwi berry gold | |
| CN108796112A (en) | Molecular labeling primer for the identification of Kiwi berry gold Peach cultivars and application | |
| CN105671039A (en) | Molecular marker indel15-1 of soybean early-flowering-season major QTL (quantitative trait locus) and application thereof | |
| CN108707645A (en) | A kind of identification method of the sweet ninth-seeded purity of variety of watermelon Soviet Union | |
| CN109295244A (en) | A kind of InDel primer and its application for distinguishing head cabbage varieties |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |