CN109055599A - Molecular labeling primer and application for the U.S. cultivar identification of Kiwi berry gold - Google Patents
Molecular labeling primer and application for the U.S. cultivar identification of Kiwi berry gold Download PDFInfo
- Publication number
- CN109055599A CN109055599A CN201811157305.8A CN201811157305A CN109055599A CN 109055599 A CN109055599 A CN 109055599A CN 201811157305 A CN201811157305 A CN 201811157305A CN 109055599 A CN109055599 A CN 109055599A
- Authority
- CN
- China
- Prior art keywords
- gold
- jin
- kiwi berry
- primer
- geo13
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to molecular biology and Biotechnology in Genetic Breeding fields, it is more particularly to the molecular labeling primer and application for Kiwi berry ' Jin Mei ' cultivar identification, the primer are as follows: Geo13-84-F:TGAACGAAAGTGGTGCTTTG and Geo13-84-R:AGCCTTCATCGTCTCCTGAA.It is expanded using primer pair gold beauty DNA provided by the invention, the band for amplifying 161bp that only Jin Mei can be specific；, can also be right according to the size and number of different bands: the Kiwi berrys such as ' Bu Lunuo ', ' emerald ', ' your length ', ' magnificent light 2 ', ' Jin Kui ', ' peasants who dig gold ', ' Jin Xia ', ' Jin Yan ', ' gold and jade ', ' gold circle ', ' chief is close ', ' Longshan is red ', ' MBR ', ' summer millet ', ' mill mountain 4 ', ' Qingyuan Qiu Cui ', ' No. WH-1 ', ' Hunan fiber crops No. 6 ', ' selecting No. 1 in west ' distinguish.
Description
Technical field
The invention belongs to molecular biology and Biotechnology in Genetic Breeding field, it is more particularly to for the U.S. kind mirror of Kiwi berry gold
Fixed molecular labeling primer and application.
Background technique
China is the source area of actinidia and the original centre of origin of Kiwi berry genetic resources.In recent years, China
Kiwi berry industry expands steadily, and by 2017, national cultivated area 2,900,000 tons of yield, occupied first place in the world up to 2,400,000 mu.
In kind pattern, China is studied based on native country Kiwi berry genetic resources, and it is new to have selected the Kiwi berrys such as ' Jin Yan ', ' east is red '
Kind, cultivation extensively, revolutionizes the single pattern of world's Kiwi berry industry only ' Hayward ' kind in the world, pushes
The diversification of Kiwi berry market diversification and consumption.
With the increasingly release of Kiwi berry new varieties, the identification of new varieties is a great problem urgently to be resolved.Currently, to Mi
The identification of monkey peach patent kind only passes through the traditional means such as tree vigo(u)r, leaf morphology, florescence, floral shape, fruit appearance, inevitably by
The influence of environment and other human factors.To the uncertainty of Kiwifruit Cultivars, the healthy and sustainable development of industry, and seedling are limited
The wooden kind is impure or even wrong orchard worker's economic benefit will be caused to be badly damaged.
Molecular marking technique can quickly, it is accurate, efficiently kind is identified, to guaranteeing the correct of kind in agricultural production
Property has great importance.The suitable molecular labeling of selection and its mating detection technique, establish it is a set of easy, economical, accurate and
Efficient cultivar identification and fingerprint pattern technology system, be hit fake and forged seedling, protection plant genetics and breeding worker and
The legitimate rights and interests of peasant, specification China agricultural, commodities market there is an urgent need to.
The variation that molecular marking technique is generated in the genome by detecting bion, to carry out area to Different Individual
Point, it is the ideal genetic marker of one kind of development after morphological markers and biochemical marker.It is identified in plant germplasm resource
And in breeding, reach its maturity to the application of molecular labeling.SSR molecular marker quantity is abundant and is uniformly distributed in gene at random
Group is in codominance, and allelic variation is high, and easy to operate and stability is good, has been applied to the cultivar identifications sides such as soybean, apple and grape
Face.In Kiwi berry, it has been multiple excellent Kiwi berry product that molecular marking technique is applied to the identification of Kiwi berry male series of products
Kind is accurate to provide pollination staminiferous plant, promotes the breeding efficiency of Kiwi berry.
' Jin Mei ' kiwifruit fruit is oval, 60-80 grams of mean fruit weight, close by yellowish-brown bristle, in storage easily
It falls off.Pulp yellow or yellow green, the dense sweet tea of flavor, the tender succulence of matter, soft ripe fruit are averaged soluble solid 20%-25%, always
Sugar 15%, total acid 1.2%, Vitamin C content 115-158mg/100g fresh fruit meat.Acquisition Ministry of Agriculture New species right in plant in 2018
Certificate.The Molecular Identification that exploitation is suitable for Kiwi berry ' Jin Mei ' kind marks, and is conducive to clearly define patent from molecular level
Kind carries out identification and kind protection conducive to Kiwifruit Cultivars.
Summary of the invention
It is an object of the invention to utilize molecular marking technique, a kind of point for Kiwi berry ' Jin Mei ' cultivar identification is provided
Sub- labeled primer, the molecular labeling are named as Geo13-84, and the primer for its design is Geo13-84-F:
TGAACGAAAGTGGTGCTTTG and Geo13-84-R:AGCCTTCATCGTCTCCTGAA.
It is another object of the present invention to provide the molecular labeling primers for being used for Kiwi berry ' Jin Mei ' cultivar identification to exist
Application in Kiwi berry breeding.
In order to achieve the above object, the present invention takes following technical measures:
The acquisition of molecular labeling primer for Kiwi berry ' Jin Mei ' cultivar identification: applicant is from Kiwi berry genome sequence
Download ' Red Male ' Kiwi berry complete genome sequence in website (http://bioinfo.bti.cornell.edu/kiwi).Pass through SSR
Finder software developing SSR within the scope of full-length genome marks, and is annotated according to gene structure as a result, selecting gene loci design
SSR label primer.Using the primer of design synthesis, PCR amplification is carried out to Kiwi berry ' Jin Mei ' kind, screening obtains molecular labeling
Geo13-84, the primer for its design is Geo13-84-F:TGAACGAAAGTGGTGCTTTG and Geo13-84-R:
AGCCTTCATCGTCTCCTGAA。
Application of the molecular labeling primer in Kiwi berry breeding for Kiwi berry ' Jin Mei ' cultivar identification, including the use of this
The primer of invention be used for Kiwi berry breeding, or using primer pair Kiwifruit Cultivars of the invention, especially ' Jin Mei ' kind into
Row identification, or include: ' Bu Lunuo ', ' emerald ', ' your length ', ' China to different cultivars according to the size and number of different bands
Light 2 ', ' Jin Kui ', ' peasants who dig gold ', ' Jin Xia ', ' Jin Yan ', ' gold and jade ', ' gold circle ', ' chief is close ', ' Longshan is red ', ' MBR ', ' rice good 1
Number ', ' mill mountain 4 ', ' Qingyuan Qiu Cui ', ' No. WH-1 ', ' Hunan fiber crops No. 6 ', ' selecting No. 1 in west ', ' Xu Xiang ', ' Henan emperor's No.1 ', ' river Mi
No. 3 ', ' Chu Hong ', ' east are red ', ' Feng Yue ', ' osmanthus sea 4 ', ' H-15 ', ' Hua You ', ' Jin Mei ', ' all over the sky red ', ' logical mountain 5 ',
' force plants No. 3 ', ' tall building is No. 1 sub- ', ' new to see No. 2 ', ' rivers and mountains is tender ' Kiwi berry distinguish.
Compared with prior art, advantages of the present invention:
1. morphological markers simple, intuitive, but quantity is few, polymorphism is poor, vulnerable to environmental influence.Molecular labeling operation
Simplicity, it is detectable in each tissue and developmental stage of plant, not by season and environmental restrictions.Quantity is more, throughout entire
Genome.Polymorphism is high, and there are many allelic variations between kind.
2. primer of the invention can expand in kiwi series kind and obtain different size of DNA fragmentation.The molecule mark
Note amplification stability, can be used to carry out the identification of Kiwi berry ' Jin Mei ' kind.
3. molecular labeling primer specificity provided by the invention is high, applied widely, can be from the Mi of 40 multiple and different kinds
' Jin Mei ' kind is identified in monkey peach, is expanded using molecular labeling Geo13-84 primer pair DNA, only Jin Mei can be special
The band for amplifying 161bp of property.
4. in addition to identifying ' Jin Mei ' kind according to specific band, can also according to stripe size and number to ' Bu Lunuo ',
' emerald ', ' your length ', ' magnificent light 2 ', ' Jin Kui ', ' peasants who dig gold ', ' Jin Xia ', ' Jin Yan ', ' gold and jade ', ' gold circle ', ' chief is close ', ' dragon
Mountain is red ', ' MBR ', ' summer millet ', ' mill mountain 4 ', ' Qingyuan Qiu Cui ', ' No. WH-1 ', ' Hunan fiber crops No. 6 ', ' selecting No. 1 in west ', ' Xu
It is fragrant ', ' Henan emperor's No.1 ', ' river Mi 3 ', ' Chu Hong ', ' east is red ', ' Feng Yue ', ' osmanthus sea 4 ', ' H-15 ', ' Hua You ', ' Jin Mei ',
' all over the sky red ', ' logical mountain 5 ', ' force plants No. 3 ', ' tall building is No. 1 sub- ', ' new to see No. 2 ', ' rivers and mountains is tender ' Kiwi berry distinguish.
Specific embodiment
Technical solution of the present invention is if not otherwise specified the conventional scheme of this field；The reagent or material,
If not otherwise specified, business or disclosed channel are derived from.
Embodiment 1:
The acquisition of molecular labeling primer for Kiwi berry ' Jin Mei ' cultivar identification:
Applicant downloads from Kiwi berry genome sequence website (http://bioinfo.bti.cornell.edu/kiwi)
' Red Male ' Kiwi berry complete genome sequence.By SSR Finder software, developing SSR is marked within the scope of full-length genome, according to gene
Structure annotation is as a result, selection gene loci designs SSR label primer.Using the primer of design synthesis, to Kiwi berry ' Jin Mei ' product
Kind carries out PCR amplification, and screening obtains molecular labeling Geo13-84, and the primer for its design is Geo13-84-F:
TGAACGAAAGTGGTGCTTTG and Geo13-84-R:AGCCTTCATCGTCTCCTGAA.
Embodiment 2:
Application of the molecular labeling primer in cultivar identification for Kiwi berry ' Jin Mei ' cultivar identification:
(1) DNA sample (the specific variety name such as table 1 of 40 multiple and different kind Kiwi berrys is extracted respectively according to CTAB method
It is shown).
(2) mixture that 990ul HIDI and 10ul ROX500 or LIZ500 are drawn using sample injector, it is anti-to be added to 96 holes
It answers in plate, every hole 10ul.
(3) 96 orifice plates are placed in plate centrifuge, centrifugation 500g stops.
(4) each sample DNA, each sample 50pg are separately added into the corresponding hole of 96 orifice plates.
(5) corresponding reagent is added to 96 orifice plates referring to following PCR reaction system, seals 96 orifice plates using sealing plate film, vibrates,
96 orifice plates are placed in plate centrifuge, centrifugation 500g stops.PCR reaction is carried out according to following procedure.
A.PCR reaction system
The preparation of 25 μ l systems
The primers F and primer R are as follows: Geo13-84-F:TGAACGAAAGTGGTGCTTTG and Geo13-84-R:
AGCCTTCATCGTCTCCTGAA。
B.PCR reaction condition
(6) 96 orifice plates are placed in rapid cooling on mixture of ice and water immediately after EP (end of program), then 96 orifice plates is placed in plate
In centrifuge, centrifugation 2000g stops.
(7) amplified fragments are detected using 3730xl sequencing analysis instrument (American AB I company).
(8) SSR amplification data is analyzed using Genemapper software, using STR capillary electrophoresis detection amplified fragments peak,
Abscissa is clip size, and ordinate is fluorescence intensity level.
(9) Kiwifruit Cultivars are expanded using label Geo13-84, the item for amplifying 161bp that only ' Jin Mei ' can be specific
Band, while according to the size and number of different bands, it include: ' Bu Lunuo ', ' emerald ', ' your length ', ' magnificent light 2 to different cultivars
Number ', ' Jin Kui ', ' peasants who dig gold ', ' Jin Xia ', ' Jin Yan ', ' gold and jade ', ' gold circle ', ' chief is close ', ' Longshan is red ', ' MBR ', ' rice good 1
Number ', ' Qingyuan Qiu Cui ', ' No. WH-1 ', ' Hunan fiber crops No. 6 ', ' selecting No. 1 in west ', ' Xu Xiang ', ' Henan emperor's No.1 ', ' river Mi 3 ', ' Chu
Red ', ', east was red ', ' Feng Yue ', ' osmanthus sea 4 ', ' H-15 ', ' Hua You ', ' Jin Mei ', ' all over the sky red ', ' logical mountain 5 ', ' force plants 3
Number ', ' tall building is No. 1 sub- ', ' new to see No. 2 ', ' rivers and mountains is tender ' Kiwi berry distinguish.Specific amplification is as shown in table 1.
1 different cultivars Kiwi berry title of table and Geo13-84 primer PCR amplification
Sequence table
<110>Wuhan Botanical Garden, Chinese Acadmey of Sciences
<120>molecular labeling primer and application for the U.S. cultivar identification of Kiwi berry gold
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
tgaacgaaag tggtgctttg 20
<210> 2
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
agccttcatc gtctcctgaa 20
Claims (6)
1. for the molecular labeling primer of the U.S. cultivar identification of Kiwi berry gold, the primer are as follows: Geo13-84-F:
TGAACGAAAGTGGTGCTTTG and Geo13-84-R:AGCCTTCATCGTCTCCTGAA.
2. application of the primer described in claim 1 in Kiwi berry breeding.
3. application of the primer described in claim 1 in Kiwifruit Cultivars identification.
4. application of the primer described in claim 1 in the U.S. cultivar identification of Kiwi berry gold.
5. primer described in claim 1 is in Kiwi berry ' Bu Lunuo ', ' emerald ', ' your length ', ' magnificent light 2 ', ' Jin Kui ', ' gold
Agriculture ', ' Jin Xia ', ' Jin Yan ', ' gold and jade ', ' gold circle ', ' chief is close ', ' Longshan is red ', ' MBR ', ' summer millet ', ' mill mountain 4 ', ' celebrating
First autumn is emerald green ', ' No. WH-1 ', ' Hunan fiber crops No. 6 ', ' selecting No. 1 in west ', ' Xu Xiang ', ' Henan emperor's No.1 ', ' river Mi 3 ', ' Chu Hong ', ' east
Red ', ' Feng Yue ', ' osmanthus sea 4 ', ' H-15 ', ' Hua You ', ' Jin Mei ', ' all over the sky red ', ' logical mountain 5 ', ' force plants No. 3 ', ' tall building Asia 1
Number ', ' new to see No. 2 ', the application in ' rivers and mountains is tender ' Kiwifruit Cultivars identification.
6. a kind of kit for the U.S. cultivar identification of Kiwi berry gold, including primer: Geo13-84-F:
TGAACGAAAGTGGTGCTTTG and Geo13-84-R:AGCCTTCATCGTCTCCTGAA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811157305.8A CN109055599B (en) | 2018-09-30 | 2018-09-30 | Molecular marker primer for identifying Jinmei variety of kiwi fruit and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811157305.8A CN109055599B (en) | 2018-09-30 | 2018-09-30 | Molecular marker primer for identifying Jinmei variety of kiwi fruit and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109055599A true CN109055599A (en) | 2018-12-21 |
| CN109055599B CN109055599B (en) | 2021-06-11 |
Family
ID=64767086
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811157305.8A Active CN109055599B (en) | 2018-09-30 | 2018-09-30 | Molecular marker primer for identifying Jinmei variety of kiwi fruit and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109055599B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110122335A (en) * | 2019-06-27 | 2019-08-16 | 西南林业大学 | The abductive approach of Xu Xiang Kiwifruit Tissue Culture seedling salt-tolerant mutant |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104313019A (en) * | 2014-09-30 | 2015-01-28 | 中国科学院武汉植物园 | SSR molecular marker A002 for identifying males and females of kiwi fruit hybrid populations |
| CN107338318A (en) * | 2017-08-25 | 2017-11-10 | 中国科学院武汉植物园 | Molecular labeling Geo101 primers and application for Kiwi berry mill mountain system row Male cultivar identification |
| CN107385071A (en) * | 2017-08-25 | 2017-11-24 | 中国科学院武汉植物园 | Molecular labeling primer and application for Kiwi berry mill mountain system row Male cultivar identification |
-
2018
- 2018-09-30 CN CN201811157305.8A patent/CN109055599B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104313019A (en) * | 2014-09-30 | 2015-01-28 | 中国科学院武汉植物园 | SSR molecular marker A002 for identifying males and females of kiwi fruit hybrid populations |
| CN107338318A (en) * | 2017-08-25 | 2017-11-10 | 中国科学院武汉植物园 | Molecular labeling Geo101 primers and application for Kiwi berry mill mountain system row Male cultivar identification |
| CN107385071A (en) * | 2017-08-25 | 2017-11-24 | 中国科学院武汉植物园 | Molecular labeling primer and application for Kiwi berry mill mountain system row Male cultivar identification |
Non-Patent Citations (3)
| Title |
|---|
| RUI GUO等: "Development and Application of Transcriptome-Derived Microsatellites in Actinidia eriantha (Actinidiaceae)", 《FRONT PLANT SCI》 * |
| YUPING MAN等: "Development of microsatellite markers in Actinidia arguta (Actinidiaceae) based on the NCBI data platform", 《AM J BOT》 * |
| 廖娇等: "猕猴桃 EST-SSR 引物筛选及通用性分析", 《果树学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110122335A (en) * | 2019-06-27 | 2019-08-16 | 西南林业大学 | The abductive approach of Xu Xiang Kiwifruit Tissue Culture seedling salt-tolerant mutant |
| CN110122335B (en) * | 2019-06-27 | 2022-03-22 | 西南林业大学 | Induction method of salt-tolerant mutant of slow-fragrant kiwi fruit tissue culture seedling |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109055599B (en) | 2021-06-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107385071A (en) | Molecular labeling primer and application for Kiwi berry mill mountain system row Male cultivar identification | |
| CN107338318A (en) | Molecular labeling Geo101 primers and application for Kiwi berry mill mountain system row Male cultivar identification | |
| CN104946640A (en) | Specificity labeling primer for tea-oil tree improved variety Chang Lin 18 and detection method | |
| CN107326091A (en) | Molecular labeling Geo168 primers and the application of mountain system row Male cultivar identification are ground for Kiwi berry | |
| CN109055599A (en) | Molecular labeling primer and application for the U.S. cultivar identification of Kiwi berry gold | |
| CN104673790A (en) | Molecular-specificity labeling primer for oil-tea good-variety longlin 18 and identification method | |
| CN108796111A (en) | Molecular labeling primer for Kiwi berry gold plum cultivar identification and application | |
| CN110273020A (en) | For distinguishing the SNP marker and application of citrus summer orange and common sweet orange | |
| CN108796113B (en) | Molecular labeling primer and application for the red cultivar identification in Kiwi berry east | |
| CN105925709A (en) | PCR (Polymerase Chain Reaction) system of SCoT (Start Codon Targeted Polymorphism) molecular marker for rubus biflorus buch | |
| CN106636325B (en) | A method of detection iris mutant | |
| CN108977575A (en) | Molecular labeling primer and application for Kiwi berry RC197 cultivar identification | |
| CN109055601A (en) | Molecular labeling primer and application for No. 2 cultivar identifications of Kiwi berry Mi jujube | |
| CN104946641A (en) | Specificity labeling primer for camellia oleifera improved varieties changlin number three and twenty one and detection method | |
| CN109055602A (en) | Molecular labeling primer and application for Kiwi berry east rose cultivar identification | |
| CN108165652A (en) | For the specific molecular marker TGMI001 of Chinese torreya seedling stage sex identification | |
| CN108796116A (en) | Justify molecular labeling primer and the application of cultivar identification for Kiwi berry gold | |
| CN109055600A (en) | Expire the molecular labeling primer and application of Tianhong No.2 cultivar identification for Kiwi berry | |
| CN108796114A (en) | Molecular labeling primer for the gorgeous cultivar identification of Kiwi berry gold and application | |
| CN105420354B (en) | Conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18 identification methods based on InDel label | |
| CN108796115A (en) | Molecular labeling primer for Kiwi berry gold and jade cultivar identification and application | |
| CN109055597A (en) | Molecular labeling primer and application for No. 1 cultivar identification of Kiwi berry Mi jujube | |
| CN108998566A (en) | Molecular labeling primer and application for the exceedingly popular cultivar identification of Kiwi berry | |
| CN108796112A (en) | Molecular labeling primer for the identification of Kiwi berry gold Peach cultivars and application | |
| CN104560977B (en) | The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " the open country younger sister back of the body " |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |