CN108977579A - It is a kind of to detect the PCR kit for fluorescence quantitative for leading to the novel duck reovirus of duck spleen necrosis - Google Patents

Abstract

The invention discloses the PCR kit for fluorescence quantitative that a kind of detection leads to the novel duck reovirus of duck spleen necrosis.Contain probe and standard items and quantitative fluorescent PCR reaction reagent shown in primer shown in SEQ ID NO.1-SEQ ID NO.2 and SEQ ID NO.3 in the PCR kit for fluorescence quantitative.PCR kit for fluorescence quantitative of the invention can detect the novel duck reovirus, the high specificity of the kit, only specifically bind with novel duck reovirus, with other duck source viruses all without cross reaction；And the high sensitivity of detection, it is 4 × 10 in standard items¹‑4×10⁹There is fabulous linear relationship in copy range, detection range can be organized with efficient detection novel duck reovirus sick duck up to 9 orders of magnitude and the virus without clinical symptoms carries duck, improve detection efficiency.

Description

It is a kind of to detect the fluorescent quantitation for leading to the novel duck reovirus of duck spleen necrosis PCR kit

Technical field

The present invention relates to avian viruses detection technique fields, and in particular to a kind of detection causes the novel duck of duck spleen necrosis to be exhaled The PCR kit for fluorescence quantitative of the lonely virus of intestines.

Background technique

Avianreovirus belongs to Hu Changgubing section (Reovirdae) Orthoreovirus (Orthoreovirus), can To cause birds that a variety of diseases occur, clinical manifestation is different and variant because virus stain, virulence or infection host's.

From 2017, it is main that the ground such as China Shandong, Hebei, Henan and Jiangsu, Anhui duck, which is broken out on a large scale with spleen necrosis, The communicable disease of symptom, the disease mainly cause each age level duck spleen enlargement, bleeding and necrosis, cause kind of a duck lay eggs and There is the different necrosis region of several degree in meat duck appetite stimulator, syntexis, retarded growth, spleen, and enlargement, bleeding, edge increase It is raw.Duck feedstuff-meat ratio increases, and meat duck delivers qualification rate significant decrease for sale, causes serious financial consequences to meat duck and kind duck aquaculture.

It has been investigated that the outburst of the disease is to there is no vaccine at present caused by a kind of novel duck reovirus infection It can be prevented, existing commercially available duck reovirus vaccine can not carry out effective prevention and control to the disease；Conventional is antiviral It is invalid with antibacterial therapy method.It is to the novel duck reovirus in the effective measures for currently in this case, controlling the disease Infection is monitored, and isolation is taken to find infected duck group early to it or slaughters measure, exhales the lonely disease of intestines to reduce novel duck Loss brought by poison infection.

Currently, mainly including that cytodiagnosis, immunology diagnosis and molecule are raw for the detection method of Avianreovirus Object diagnoses three categories, wherein cytodiagnosis technology is mainly separately cultured using cell and is observed with Electronic Speculum.This method operation Relatively complicated, detection cycle is long, and testing conditions are more demanding.Immunology diagnosis technology mainly includes enzyme linked immunosorbent assay (ELISA) (ELISA) and immunofluorescence method, such method is sensitive higher, but also high to antibody preparation.Diagnostic technique in molecular biology master It to include conventional polymeric enzyme chain reaction (PCR) method and fluorescence PCR method, and traditional PCR method can only be to virus infection It is qualitative, it cannot quantify, sensitivity is relatively low；The advantages that fluorescent quantitative PCR technique is with its high sensitivity, speed is fast, high specificity Gene expression dose analysis, pathogen qualitative and in terms of be widely used.But due to the novel duck Reovirus system reports there are not the effective ways for detecting the novel duck reovirus yet so far for the first time.

Summary of the invention

For the above-mentioned prior art, the object of the present invention is to provide a kind of detections, and the novel duck of duck spleen necrosis to be caused to exhale intestines The PCR kit for fluorescence quantitative of lonely virus.

To achieve the above object, the present invention adopts the following technical scheme:

The first aspect of the present invention provides one group of primer and probe, the nucleotide sequence of the primer such as SEQ ID Shown in NO.1-SEQ ID NO.2；The nucleotide sequence of the probe is as shown in SEQ ID NO.3.It is specific as follows:

Forward primer: M1-F:5 '-ATTAGCTCTAGCCACAGCCCTG-3 '；(SEQ ID NO.1)

Reverse primer: M1-R:5 '-CAATAGTGCATAGCATCAAGTAC-3 '；(SEQ ID NO.2)

Fluorescence probe: 5 '-FAM-TGCGAGTAGTCGGTTCTCGCA-TMARA-3 '；(SEQ ID NO.3)

The second aspect of the present invention, provide above-mentioned primer and probe causes the novel duck of duck spleen necrosis to be exhaled in preparation detection Application in the reagent or kit of the lonely virus of intestines.

The novel duck reovirus is preserved in China typical culture collection center on July 18th, 2018, protects Hiding number is CCTCC NO:V201843, address: Wuhan, China, Wuhan University, classification naming: novel duck reovirus N- DRV-XT18 plants.

The third aspect of the present invention, providing a kind of detect causes the fluorescence of the novel duck reovirus of duck spleen necrosis fixed P CR kit is measured, the PCR kit for fluorescence quantitative contains above-mentioned primer and probe.The novel duck reovirus Deposit number is CCTCC NO:V201843.

Further, in the PCR kit for fluorescence quantitative further include: standard items and quantitative fluorescent PCR reaction reagent.

Preferably, the standard items are prepared by the following method:

Use primer amplification deposit number shown in SEQ ID NO.1-SEQ ID NO.2 for CCTCC NO:V20184 3 Duck reovirus genome, obtain amplified production, amplified production be connected on pMD18-T carrier, positive gram of screening It is grand and extract Plasmid DNA, that is, standard items are prepared.

The quantitative fluorescent PCR reaction reagent includes: GoldStar TaqMan One Step Buffer, GoldStar Ta qMan One Step EnzymeMix and ROX.

The fourth aspect of the present invention provides a kind of detection examination for detecting and leading to the novel duck reovirus of duck spleen necrosis Agent, the detection reagent contain above-mentioned primer and probe.

The fifth aspect of the present invention provides above-mentioned PCR kit for fluorescence quantitative or above-mentioned detection reagent in following (1)-(3) In it is any in application:

(1) the novel duck reovirus for being CCTCC NO:V201843 to duck infection deposit number carries out epidemiology tune It looks into；

It (2) is the pollution of CCTCC NO:V201843 novel duck reovirus to the deposit number in blood or serum product It is monitored；

(3) accurately detection deposit number is CCTCC NO:V201843 novel duck reovirus copy number, is specified novel The progression of infection of duck reovirus.

The sixth aspect of the present invention, providing a kind of detect using above-mentioned PCR kit for fluorescence quantitative leads to duck spleen necrosis Novel duck reovirus method, include the following steps:

(1) standard items are subjected to gradient dilution, carry out TaqMan Fluorescence PCR later, according to the concentration of standard items and Ct value draws fluorescent quantitation standard curve；

(2) sample to be tested total serum IgE is extracted, TaqMan Fluorescence PCR is carried out, sample to be tested fluorescence signal is collected, to glimmering Optical signal carries out data processing, obtains Ct value and amplification curve, carries out qualitative and quantitative detection to sample to be tested.

Preferably, in step (1) and step (2), the program of TaqMan Fluorescence PCR are as follows:

45℃10min；95℃10min；95 DEG C of 15s, 60 DEG C of 45s carry out 40 circulations later.

Result judgement method: if sample to be tested fluorescence signal is more than threshold value and Ct≤30.0, while amplification curve is smooth " S " type, then can be determined that in sample to be tested containing novel duck reovirus.

Beneficial effects of the present invention:

(1) it is directed to the newfound novel duck reovirus that can result in duck spleen necrosis, the present invention devises can be with To the PCR kit for fluorescence quantitative that the novel duck reovirus is detected, the high specificity of the kit, only and novel duck Reovirus specific binding, with other duck sources virus, such as Duck parvovirus, duck tembusu virus, duck virus etc. is all There is no cross reaction.

(2) high sensitivity detected is 4 × 10 in standard items¹-4×10⁹There is fabulous linear relationship in copy range, Detection range, can be with efficient detection novel duck reovirus sick duck tissue and the disease without clinical symptoms up to 9 orders of magnitude Poison carries duck, improves detection efficiency.

(3) novel duck reovirus infection can be monitored using kit of the invention, to find early Infected duck group takes it isolation or slaughters measure, to reduce loss brought by novel duck reovirus infection；It can be with To duck infection reovirus carry out epidemiological survey, and to the duck reovirus in blood or serum product pollute into Row monitoring.

Specific embodiment

It is noted that following detailed description is all illustrative, it is intended to provide further instruction to the application.Unless another It indicates, all technical and scientific terms used herein has usual with the application person of an ordinary skill in the technical field The identical meanings of understanding.

As background technique is introduced, from 2017, the big model of the ground such as China Shandong, Hebei, Henan and Jiangsu, Anhui duck Outburst is enclosed using spleen necrosis as the communicable disease of cardinal symptom.It has been investigated that the communicable disease is by novel reovirus Caused.It there is no the drug and method that can effectively control the novel duck reovirus infection at present.It is of the invention based on this A kind of PCR kit for fluorescence quantitative for being able to detect the novel duck reovirus is proposed, to find infected duck early Group takes it isolation or slaughters measure, to reduce loss brought by novel duck reovirus infection.

It is known that the host range of Avianreovirus is wider, generally existing this virus in various birds, from 1954 It has been separated in the birds of a variety of morbidities such as chicken, goose, pigeon, ostrich, duck, turkey and other pheasants or health since year Reovirus, and the reovirus being separated to from different hosts its there are biggish variability, pathogenic, gene sequences Column and the coding of major protein all have differences.

Present inventor isolates one plant of duck reovirus N-DRV-XT18 from morbidity duck spleen tissue, to above-mentioned The duck reovirus N-DRV-XT18 newly separated has carried out genome sequencing, and respectively by 10 genetic fragments and existing report The Avianreovirus in road has carried out sequence alignment and homology analysis, as a result, it has been found that, the 10 of new isolated strain N-DRV-XT18 L1, L2, L3, M1, M2, S3, S4 are respectively positioned in a relatively independent branch in a genetic fragment, and with uploaded at present Reovirus-originated duck sequence variability is larger in Genbank, illustrates that the strain N-DRV-XT18 newly separated is different from it really His Avianreovirus, it can be assumed that duck reovirus found in the present invention and it is existing it has been reported that duck exhale intestines lonely Virus exists compared with Big mutation rate, is 1 new independent kind of Orthoreovirus.Therefore, which is exhaled intestines lonely by the present invention For preservation in China typical culture collection center, deposit number is CCTCC NO:V201843.

Since Avianreovirus is RNA virus, there are multiple segmentations, in antigenic structure, pathogenic, cell between different strains Cultural character and host specificity etc. have a certain difference, and variation is easy to happen in genetic evolution.Therefore, different The coding of the antigenic, pathogenic of reovirus, gene order and major protein can all have differences.Using fluorescent quantitation PCR detects reovirus, above all the sequence of hard objectives gene, is examined according to target gene sequence design primer It surveys.But the present invention duck reovirus to be detected for leading to duck spleen necrosis is the strain newly separated, gene composition It is unknown, and with it is existing it has been reported that duck reovirus exist compared with Big mutation rate, the lonely disease of intestines can not be also exhaled according to existing duck The genome sequence design primer of poison.

In addition, for fluorescence quantitative PCR detection, how design primer and probe sequence are to guarantee detection validity It is crucial.Although having software and design of primers principle of many design of primers etc. in the prior art, to design to obtain high specificity, The primer and probe of high sensitivity combines, and being not can be simply obtained by primer-design software, this needs technology people Member constantly selects optimization targeting regions using its professional knowledge, carries out design of primers further according to the targeting regions of optimization, and Screening, optimization, redesign repeatedly are carried out to the primer of design.Specifically, since present invention novel duck to be detected is exhaled The lonely virus of intestines is different from the reovirus-originated duck of existing report, and how the novel duck of Te Yixing detection the application exhales the lonely disease of intestines Poison, and avoid that cross reaction occurs with other duck sources virus, it is the difficult point place of primer and probe design of the present invention.Exhale the lonely disease of intestines There are 10 genetic fragments for the full-length genome of poison, and the conservative region of different genes segment is again different, therefore, lonely for exhaling intestines For the detection of virus, how to select targeting regions to carry out primer and probe design there is no unified cognition at present.The present invention exists The targeting regions for carrying out primer and probe design are optimized during test, as a result, it has been found that, exhale intestines lonely with the novel duck The sequence conservation of the M1 gene of virus carries out primer and probe design, may be implemented to the special of the novel duck reovirus Property detection.

Primer designed by the present invention, probe are used cooperatively, and the two complements each other, in the design process further The reaction condition for having fully considered quantitative fluorescent PCR, avoid interfering with each other between primer, probe, final design the application Primer, probe.Wherein:

Forward primer: M1-F:5 '-ATTAGCTCTAGCCACAGCCCTG-3 '；(SEQ ID NO.1)

Reverse primer: M1-R；5'-CAATAGTGCATAGCATCAAGTAC-3'；(SEQ ID NO.2)

Fluorescence probe: 5 '-FAM-TGCGAGTAGTCGGTTCTCGCA-TMARA-3 '；(SEQ ID NO.3)

5 ' end mark fluorescent reporter group FAM of fluorescence probe, 3 ' end mark fluorescent quenching group TMARA, amplified fragments Length 83bp.

The present invention during the test, also passes through other conserved region sequences of reovirus gene and other primers Design principle devises the different primer of multiple groups, probe, and is respectively combined, and detects its specificity after reacted respectively and expands Increasing Efficiency, to screen the optimal primer and probe combination that can be used for clinical detection.Such as:

First group:

Forward primer: F:5 '-TGCGCCTATCCTTGAGTTGA-3 '；

Reverse primer: R；5'-TTGCCAGGAAATACGGGTCT-3'；

Fluorescence probe: 5 '-FAM-TCAAAATGGTGGACTTCAGTTTCGAT-TMARA-3 '.

Second group:

Forward primer: F:5 '-TGACAGGCCTGACTACGTTA-3 '；

Reverse primer: R；5'-ATGCTTGAAGTGAGACGTAC-3'；

Fluorescence probe: 5 '-FAM-TGCGAGTAGTCGGTTCTCGCA-TMARA-3 '.

As a result, it has been found that with new to this using primer of the invention and probe combinations (SEQ ID NO.1-SEQ ID NO.3) The specificity and sensitivity that type duck reovirus is detected are optimal.And other primer and probe combinations cannot then exhale duck The lonely virus of intestines and other duck sources virus are effectively distinguished, and false positive or false negative are easy to appear.

The present invention also optimizes quantitative fluorescent PCR condition during the test, the maximum limit in the clinical application of kit Degree reduce operation, not only guarantee sensitivity, but also reduce various pollutions to greatest extent, it is ensured that result it is scientific, accurate.

In order to enable those skilled in the art can clearly understand the technical solution of the application, below with reference to tool The technical solution of the application is described in detail in the embodiment of body.

The test material that test material is this field routine is not specifically described used in the embodiment of the present invention, It can be commercially available by commercial channel.Specific experiment condition and method are not specified in the embodiment of the present invention, usually according to routine Condition, such as J. Pehanorm Brooker chief editor, Science Press, 2002, Molecular Cloning:A Laboratory guide (third edition)；D.L. this peck Top grade chief editor, Science Press, 2001, cell experiment guide；Or the condition suggested according to manufacturer.

Embodiment 1: the design of fluorescence quantification PCR primer and probe

The complete of novel duck reovirus (deposit number is CCTCC NO:V201843) is obtained according to two generation sequencing technologies Genome sequence, the sequence point of this 10 genetic fragments of L1, L2, L3, M1, M2, M3, S1, S2, S3, S4 in whole genome sequence Not as shown in SEQ ID NO.4-SEQ ID NO.13.

For the primer sequence and fluorescence probe sequence of the sequence conservation design specificity of M1 gene, sequence design is such as Under:

Forward primer: M1-F:ATTAGCTCTAGCCACAGCCCTG；(SEQ ID NO.1)

Reverse primer: M1-R:CAATAGTGCATAGCATCAAGTAC；(SEQ ID NO.2)

Fluorescence probe: 5 '-FAM-TGCGAGTAGTCGGTTCTCGCA-TMARA-3 '；(SEQ ID NO.3)

5 ' end mark fluorescent reporter group FAM of fluorescence probe, 3 ' end mark fluorescent quenching group TMARA, amplified fragments Shown in length 83bp (SEQ ID NO.14).

ATTAGCTCTAGCCACAGCCCTGACCTGTCCGTCCTTGATCTGTTCGACTGGTCGC GATTC CAATAGTGCATAGCATCAAGTAC；(SEQ ID NO.14)

Embodiment 2: the foundation of fluorescent quantitative PCR detection method

(1) extraction of viral RNA:

Sample to be tested total serum IgE is extracted using classical Trizol method or commercial kit；

(2) Fluorescence PCR Establishing:

The GoldStar that it is CW2633S for the article No. of ShiJi Co., Ltd from health that one-step method fluorescence quantitative kit used, which is used, Taqman One Step RT-qPCR Ki kit, sequentially adds 2 × GoldStar in 200 μ l Fluorescence PCR pipes TaqMan One the Step μ of Buffer~12.5 l, Forward Primer (10 μM)~0.5 μ l, Reverse Primer (10 μM)~0.5 μ l, Probe (10 μM)~0.5 μ l, GoldStar TaqMan One Step μ of EnzymeMix~1.0 l, 50 × Low ROX or High ROX (optional)~0.5 μ l, the middle sample to be tested Total μ l of RNA~2 extracted of step (2), Use RNase Free dH₂O is supplemented to 25 μ l systems.It is placed in ABI 7300Fast fluorescence quantitative PCR instrument and is reacted, instead Answering condition is 45 DEG C of 10min；95 DEG C of 15s, 60 DEG C of 45s carry out 40 circulations after 95 DEG C of 10min.

(3) preparation of standard curve:

For copy number viral in accurate quantitative analysis sample, preparation containing have the plasmid of purpose amplified fragments as standard items with Draw standard curve.The forward and reverse primer (shown in SEQ ID NO.1 and SEQ ID NO.2) for designing M1 gene first, expands Increase novel duck reovirus gene group and obtain the amplified production of 83bp (shown in SEQ ID NO.14).

It according to classical molecular cloning protocols method, is connected on pMD18-T carrier, is named as pMD-M1, screen Positive colony simultaneously extracts Plasmid DNA, utilizes spectrophotometer measurement plasmid concentration, as standard items.10 times are carried out to standard items Gradient dilution carries out TaqMan Fluorescence PCR later, and according to the concentration of standard items and Ct value, instrument software can be drawn automatically Fluorescent quantitation standard curve out；Specifically: y=-3.3501x+45.561, coefficient R²=0.9997, good line is presented Sexual intercourse；Wherein, the copy number logarithm of x representative sample, y represent Ct value.

(4) judgement of testing result:

According to quantitative fluorescent PCR react collect fluorescence signal, recycle instrument software handle data, obtain amplification curve, Ct value.Using the corresponding Ct value of standard items minimum concentration and amplification curve as judgment basis.

Result judgement method: if sample to be tested fluorescence signal is more than threshold value and Ct≤30.0, while amplification curve is smooth " S " type, then can be determined that in sample to be tested containing novel reovirus.

According to fluorescent quantitation standard curve, reovirus novel in sample can be quantitative determined.

Embodiment 3: the optimization of the composition, experiment parameter of kit and specificity, sensitivity and repeatability are investigated

1. the composition of kit:

The kit of the present embodiment is PCR kit for fluorescence quantitative, for detecting novel duck reovirus (deposit number For CCTCC NO:V201843).Contain in kit: forward primer (10 μ shown in the SEQ ID NO.1 that embodiment 1 designs M), reverse primer (10 μM) shown in the SEQ ID NO.2 that embodiment 1 designs, shown in the SEQ ID NO.1 that embodiment 1 designs Probe, standard items and quantitative fluorescent PCR reaction reagent.

Standard items are prepared by the following method:

Use primer amplification deposit number shown in SEQ ID NO.1-SEQ ID NO.2 for CCTCC NO:V201843 Duck reovirus genome, obtain the amplified production (shown in SEQ ID NO.14) of 83bp, amplified production be connected to On pMD18-T carrier, screening positive clone simultaneously extracts Plasmid DNA, that is, standard items are prepared.

Quantitative fluorescent PCR reaction reagent includes: 2 × GoldStar TaqMan One Step Buffer, GoldStar TaqMan One Step EnzymeMix, 50 × Low ROX or High ROX (optional), RNase Free dH₂O。

2. the optimization of experiment parameter:

Exploration is optimized to the quantitative fluorescent PCR reaction condition of the primer (SEQ ID NO.1-2) in kit, is tied Fruit shows that primer is 10 μM, and reaction condition is 45 DEG C of 10min；95℃10min；95 DEG C of 15s, 60 DEG C of 45s carry out 40 later Circulation, kit sensibility, detection effect are best.

3. the specificity of kit, sensitivity and repeatability are investigated

(1) specific test

Using the kit, carry out the specific test of the kit, respectively with Duck parvovirus, duck tembusu virus, Duck virus, NDRV-JM85 plants of duck reovirus, NDRV-TH11 plants of duck reovirus and the present invention are detected The novel duck reovirus that deposit number is CCTCC NO:V201843 is template, carries out fluorescent quantitation using the kit PCR, as a result, it has been found that, Duck parvovirus, duck tembusu virus, duck virus, RV-JM85 plants of duck reovirus ND, duck exhale DRV-TH11 plants of intestines orphan's virus N cannot be expanded effectively；Only deposit number is that the novel duck of CCTCC N O:V201843 exhales intestines Lonely virus can be expanded effectively.

The above test results show that the specificity of kit of the present invention is 100%, there is stronger specificity, kit Middle primer and probe and novel reovirus are specifically bound, viral with other duck sources, such as Duck parvovirus, duck Tan Busu disease Poison, duck virus etc. are all without cross reaction.

(2) repetitive test

Using the kit, the repetitive test of the kit is carried out.Take that clinical acquisitions arrive is main with spleen necrosis The spleen tissue sample of the duckling of symptom carries out repeated detection using kit, and three repeat samples are corresponding in primary experiment The coefficient of variation (CV) less than 0.5%, illustrate it with high repeatability.

(3) sensitivity is tested

Standard items are diluted to various concentration, are detected using the kit, at the same using regular-PCR detection as pair Than.As a result, it has been found that fluorescent quantitative PCR result is shown, kit of the invention is able to detect 10¹The standard items of a copy number, and And 10¹-10⁹There is fabulous linear relationship in copy range, detection range is up to 9 orders of magnitude；And regular-PCR minimum It can detect 10⁴The standard items of a copy number.Show that the kit carries out quantitative fluorescent PCR sensitivity with higher.

Embodiment 4: the clinical application experiment 1 of kit of the present invention

(1) extraction of viral RNA:

The doubtful illness duck spleen tissue homogenate of 30mg is taken, is extracted using classical Trizol method or commercial kit Total serum IgE.

(2) Fluorescence PCR Establishing:

The GoldStar that it is CW2633S for the article No. of ShiJi Co., Ltd from health that one-step method fluorescence quantitative kit used, which is used, T aqman One Step RT-qPCR Ki kit, sequentially adds 2 × GoldStar in 200 μ l Fluorescence PCR pipes TaqMan One the Step μ of Buffer~12.5 l, Forward Primer (10 μM)~0.5 μ l, Reverse Primer (10 μM)~0.5 μ l, Probe (10 μM)~0.5 μ l, GoldStar TaqMan One Step EnzymeMi μ of x~1.0 l, 50 × Low ROX or High ROX (optional)~0.5 μ l, the middle sample to be tested Total μ l of RNA~2 extracted of step (2), makes With RNase Free dH₂O is supplemented to 25 μ l systems.It is placed in ABI 7300Fast fluorescence quantitative PCR instrument and is reacted, reacted Condition is 45 DEG C of 10min；95 DEG C of 15s, 60 DEG C of 45s carry out 40 circulations after 95 DEG C of 10min；Collect fluorescence.

Result judgement method: if sample to be tested fluorescence signal is more than threshold value and Ct≤30.0, while amplification curve is smooth " S " type, then can be determined that in sample to be tested containing novel reovirus.It the results are shown in Table 1.

Table 1: morbidity duck inspection pathological material of disease fluorescence quantitative PCR detection result

Sample serial number	Sample message	Ct value
			1	Shandong 2017.12.28	16.5450
2	Jiangsu 2017.11.18	14.8971
			3	Hebei 2018.04.22	19.8565
4	Shandong 2018.04.08	15.0195
			5	Shandong 2018.02.19	16.4998
6	Henan 2018.01.14	16.8799
			7	Shandong 2018.06.01	21.9421

Exhale intestines lonely the result shows that can detect novel duck in 7 different regions duck pathological material of diseases using kit of the invention Virus.

Moreover, detecting using kit of the invention to 40 parts of identified samples, there are 34 parts of pattern detections to contain There is novel duck reovirus, consistent with qualification result, detection accuracy rate is 100%.

Embodiment 5: the clinical application experiment 2 of kit of the present invention

The spleen necrosis morbidity duck for the novel reovirus of infection that clinical acquisitions are arrived, takes the spleen tissue of necrosis to be added It organizes to be homogenized after 5 times of physiological saline, after multigelation 3 times, takes supernatant to be inoculated with LMH cell, received after stable cytopathy to appear Poison.

The extraction of above-mentioned viral RNA:

The cell sample for taking 400 μ l virus infections to be measured is extracted total using classical Trizol method or commercial kit RNA。

Fluorescence PCR Establishing:

The GoldStar that it is CW2633S for the article No. of ShiJi Co., Ltd from health that one-step method fluorescence quantitative kit used, which is used, T aqman One Step RT-qPCR Ki kit, sequentially adds 2 × GoldStar in 200 μ l Fluorescence PCR pipes TaqMan One the Step μ of Buffer~12.5 l, Forward Primer (10 μM)~0.5 μ l, Reverse Primer (10 μM)~0.5 μ l, Probe (10 μM)~0.5 μ l, GoldStar TaqMan One Step EnzymeMi μ of x~1.0 l, 50 × Low ROX or High ROX (optional)~0.5 μ l, the middle sample to be tested Total μ l of RNA~2 extracted of step (2), makes With RNase Free dH₂O is supplemented to 25 μ l systems.It is placed in ABI 7300Fast fluorescence quantitative PCR instrument and is reacted, reacted Condition is 45 DEG C of 10min；95 DEG C of 15s, 60 DEG C of 45s carry out 40 circulations after 95 DEG C of 10min；Collect fluorescence.

Result judgement method: if sample to be tested fluorescence signal is more than threshold value and Ct≤30.0, while amplification curve is smooth " S " type, then can be determined that in sample to be tested containing novel duck reovirus.It the results are shown in Table 2.

Table 2: novel duck reovirus infection cell sample fluorescence quantitative PCR detection result

Sample serial number	Sample message	Ct value
			1	Shandong 2017.12.28	17.7650
2	Hebei 2018.04.22	22.1365
			3	Shandong 2018.04.08	17.6895
4	Shandong 2018.02.19	18.7898
			5	Henan 2018.01.14	19.8321

Through detecting, novel duck reovirus is contained in sample, meets expection, show detection method of the invention it is accurate, Reliably.

The foregoing is merely preferred embodiment of the present application, are not intended to limit this application, for the skill of this field For art personnel, various changes and changes are possible in this application.Within the spirit and principles of this application, made any to repair Change, equivalent replacement, improvement etc., should be included within the scope of protection of this application.

SEQUENCE LISTING

<110>Shandong Agricultural University

<120>a kind of to detect the PCR kit for fluorescence quantitative for leading to the novel duck reovirus of duck spleen necrosis

<130> 2018

<160> 14

<170> PatentIn version 3.5

<210> 1

<211> 22

<212> DNA

<213>artificial sequence

<400> 1

attagctcta gccacagccc tg 22

<210> 2

<211> 23

<212> DNA

<213>artificial sequence

<400> 2

caatagtgca tagcatcaag tac 23

<210> 3

<211> 21

<212> DNA

<213>artificial sequence

<400> 3

tgcgagtagt cggttctcgc a 21

<210> 4

<211> 3959

<212> DNA

<213>the L1 gene of strain N-DAV-XT18

<400> 4

gctttttctc cgaacgccga aatgagttcg cgcaaagtgg ctagacgtcg tcataaggat 60

gctaccgaca ctaaagattc taagtacact gataaagata agtcctcagc cacaactact 120

gaaacgaagt ccgtcgactc cactaacaag agtgtaagcg ctccaaaatc tgatactcca 180

gcagcatcaa caccatcctc tacagatggc gcttctcagg ttgcagtcgc taaacaaacc 240

aatgataatg acgcttcttc taaagattct tcccctaaac caactgtcac tcccgacgga 300

aaggatggaa tgcatggtgc ggttaaatct caagacgcta aagctaccat tgctgttgat 360

gataacaagg acagggacgt ggtcttcggt ggcaagggtt caggtgataa aaatgctatt 420

acaaagactg ggtccgtgga taatgatggt ggtgttaaaa cgataccggc taaggatact 480

actatcgcat ccgctaaagc catgatggaa cagaaacagt tagttgcggg tcttccgaag 540

cagccaaaac ctgccagcca tctatgcact gtttgcatgg ctcaattcgc ttcagctgat 600

gcattgacta tacaccaaac aactcattcg attggatcca acgctgcact gactagcttt 660

tcgatctcta ccgccgttga ggagttcatt caatcttggg cctcggctac ttccactgct 720

aatactaaaa cagcactaac tgtggcggac gttgattctt taatgatgac tgaagggata 780

cgtttaatca cttgggattc cggactctgt acctcctttg agcttgtgcc gatagtgcag 840

tctaacactg tccaagacgt tatctcatac tcttggttca catctagtta caatatcgct 900

actcctttcc ctcaagcgac tgtggtgcgt attgtgttac gtacgaactg ggctgctaga 960

ttggattccc catcttcctc tcgtgaatgc gatcttcggc ttgctcctcc gacagaaagt 1020

aatgcacgtt cttttgctat gctcctcaac actggtgcta ctcctgaagg tacatttaat 1080

cctaacactc tccgtatgaa cgtcttgcag atgtgcctcc agtatgtgtt agctaacctc 1140

catttaaaca ggagtactca atttacgatg gacctgaccg ctgccgctcc caatttatcc 1200

gcttctcaac ttcgaatcgt gcccgaagac aaggatggaa aatggttccc ggtcatgtac 1260

ccttctcgtg taaacatccc cctctttaat aaaacagccg atttcgttaa ccaatgtatt 1320

cgtgacagaa tcggtcgcta cgatcgcgct caaactttcg ctggtgctcc ttctgaatgg 1380

gctgatatgt gggagactgc agactcatta acactctcgg ttcgtgaaat gtggatgtct 1440

cggatctcac aaatgaacat ctctcccgcc gatatcgccg acgcaatctc gcgttgttcg 1500

cagtcgctcc tgacggtagc cgcacctact gctccctccg tagctcgtct cctgccgtgg 1560

cgtgttagtt ctgatgagcg ccaattatta caactgctga tgtatcttaa cgtaggtact 1620

agcgccgatt acatccagcc aattctatct gcgttcgctc gcactctctc gcgtgtttca 1680

cctttgcgta ttaaccccac tctcatcgct aacgcaatgt ctactattgt tgaaagcact 1740

actaacaccc agagtccagc cgctgccatc ttgtcaaagt tgaagccagt cgcatccgac 1800

ttctcagact tccgtctcgc atgtgctgct tggctgtata atggttgtgt ccagacgtac 1860

ttatctgaag actcttaccc cagtagcggc ggatctgtca ctagtattga cactctggtt 1920

gatatgtttg tctgtctctt ggctctcccg cttgtcactg atcctaatgc gccttgtcaa 1980

gctttcatgg tcgtggctaa tgctatggtc ggctatgaga atctgccgat ggatgatcct 2040

aactttaccc aacagagact ggctgccgcg tttaataacc ctaccacctg gccgcagtgc 2100

tttctacacc ctcagaacat cgatcgccgc caatgtccga tcctatcctg gtgggcacaa 2160

cagattcacc gcaactggcc tactccatca cagatcacct atggcgcgcc tgatattatc 2220

ggttcagcca acctattcac tccccctgat gttctgctgc tcccgctcca gcatcgcccc 2280

attcgcatta cgaatccaac tttgaacttc gacaacgagt taacaacctg gcgtaacacg 2340

gtagtagatt tgatcctacg catcattgac agtggcagat accaaccgaa ctggaatcag 2400

tccatccgcg cttcaatgcg aaacgctatg acgaacttta ggattattaa atcgtacact 2460

cccgcttaca tcgctgaatt gttacccgtt gagttggccg ctatcgctcc cacccttcct 2520

ttccagcctt tccaggttcc cttcgctcgt ctagaccgtg atgctattgt cacccatgtc 2580

aacgtgtcgc gtcaggcccc gaacgtgctt gctcagccag cgttaaacat gtccatgacg 2640

tatcaacgca ctggcgtgcc aatatcgttg agcgcccgtc ctcttgcagt tgctcttctg 2700

tccggccaat atcctactga gccacctctg cagacgaatg tgtggtatgt gaatacgctt 2760

acccctctgt attcaaatga tggattattt aataacgtcc agcatgctat ggtggccgct 2820

gaagcttacg ccactcttat cactatgtta gcacagtgta cggacatgca gtatcccgtg 2880

gaccgtccct taaactggtt acgtcaaatc aacctagcgg cgaatgaggc taccatcttt 2940

gggcgctcca tcaattctct cttccagacc gcctttgatc tttccccttc tactgttctc 3000

ctgcaaccgt ttttggagtc cgaccctcgc tctacacaac tcgccatctc ctacgtccgc 3060

tataatggtg atagcgaaac cttcgtgcct accgtccgcc cgtctatgat agctgaggct 3120

actctactcg tcgagcgcgt tctgtcacat gagtataact tatttggact ctgtcgcggt 3180

gacatcattt taggacagca catgacccct tccgcattta acccgttagc ccctcctcct 3240

tccgtcgtct ttagtcgcgg tgaccccgag gtctacgagt tcggccagcg tagtttcgcc 3300

aactttggta tgaatggtga agagatcctc gttatggacg cgaatggcgt acgtcgtccc 3360

ctgcttggta gatgggtgat gcccctacag ctactgatgg tgaacattgg cgtgttccct 3420

aagctcctgc tggaccggat tctgaaaggg cgtttgtaca ttaggctaga ggtcggtgcc 3480

tatccttaca ctgttcagta ctatcagggt cgagagttca ctgatggatt tacgctgttg 3540

gagcagtgga tgtcgaaagt gtcgcccatg ggcataccac ccgttccgtt cctgatgcca 3600

caatctgaag gtcataacat tacttctggc atggtgaccc actacatttg gtccactgag 3660

tataacgatg gctccctttt cgccacaaac acagacttgc ctgttactgt cttcggtcca 3720

gaccgcacta tccctattga gagataccgt gctttggtcg atccgggcgc tctgccagcc 3780

acaaaccaac tcccccacac tatcgatctc tactgttcgt tgagacgcta ctacttggaa 3840

acacctccga ttacagcgac ggtgacaact tatggtgatg gtctcccagc gttgaaccat 3900

tagagcggcg aggctagacg cgagctgatc gcgtcgactc tcgttggagg ttactcatc 3959

<210> 5

<211> 3830

<212> DNA

<213>the L2 gene of strain N-DAV-XT18

<400> 5

gctttttcct caccatgcat gtcaatgggt ttgatgatgc tactctcgca tacgcacgct 60

ccatatcggg tcttacttca atgtcaaatg atttgtttga gagagcttca ttgtctatgc 120

gctcattccc acgttctcat gcttatgaca tattagataa agtagaattt tctgtctctt 180

gtgtcattcc taatgccata tttcatcacc cggaccacgt tgagtacttt tatatcgatg 240

ctgtcaatag ggtcaggcgt aaacatgtca ttgattcgga tgatgtattt gtaccaaact 300

gtaattttca gggtctctta actcctatgg ataagttacc aaactatggt caactatctg 360

aggtcatctc ctcgaatgct cgcgacgggt tagcttcggc acgaatcgcc aatactttct 420

ataacattgc tgtctcacaa gctaggcaag tcaaagcgcc tcttgaatcg tttctccttc 480

ccctattact ttctgaaacc tgccctttat ctgatgaccc atgtggattg gatacttccc 540

cgtctcctcc gatcagtaga aatctggcgt tatgggtact gcgcgagtta agccgcacta 600

tttgtggatc gtcaggcgat cggtcaccat ggttgttgtt agattcaggt gtagcatggt 660

tcctttcacc actgatgtct tcagctatcc ctccccttat ggctgattta acgaatctgg 720

ctatctataa acaggtatgc tccgtctccg atgatatgca ctccctcgcc gttcaaatgg 780

tgttgcaagc agctgcctcg caatcctacg gacattatgt gctgcaaact aaggccgttt 840

ttccgcaaaa cactttgcat aacatgttta gaaccatcac tgacggtctg gtccctatga 900

tagactggct ggagcccagg tctaactacc gcttcatgct gcagggtgcg cgtaaggtga 960

catcagatga tgcgaatcaa tctccagata acacggaggc tgctgagaaa gttggccata 1020

agatgggttg tttagatgtt gttagatcct tacggaagat gtcttctgcc attacagtgc 1080

attcgcatga tgcgatgacg tttgttcggg acgccatgtc ttgtaccagt ggtattttca 1140

ttactcgcca acctactgaa actgtgttga aggaatatac gcaagctccg acgattgaag 1200

ttcccattcc tcaaactgat tggtctccac caattggatc ccttcgctac ttatctgatg 1260

cctgtgctct acccgctgtg tacttggctc gttcttggcg tcgagctgcc tcagcagtcg 1320

tagataatcc tcacacttgg gatccactat atcaagctat tctccgctcc caatacgtca 1380

catcacgcgg tggttcgggc gctgcgttac gagacgcgtt aaaagctgct gaagtggagc 1440

ttccacagta tcctggtgtc agtattaagg tcgctacaaa gatataccag gcagctcaaa 1500

ctgctgatgt gccattcgat aagctctccc gtgccgtcct tgctcccttg tcgatggggc 1560

tgcgtaatca ggtccagcgt cgtcctcgca ccatcatgcc tatgaacgtc gtgcaacaac 1620

aggtctcagc agctcatact ctatctgccg actatatcaa ctatcacatg aacttatcca 1680

ccacatcggg tagtgccgtt atcgagaagg tcgttccgtt gggcatgtac gcctcctgtc 1740

cgcctgctca ggcagtcaat attgatatta aagcgtgtga cgcgtctatt acgtatcagt 1800

acttcctctc cgtcattgtt ggtgctattc atgaaggtgc tgctggacgt cgtgtatcct 1860

cctcgtttat gggtgttcct cccagcgtat tgtcggtcgt tgattccagt ggagtcacat 1920

cttcaatgcc catttccggt ttccaggtta tgtgtcaatg gttagcgaaa ctctatcagc 1980

gtggttttga gtatcaggtc acggacacat tttcacccgg caatatcttt acgcaccaca 2040

cgacgacttt tccttccgga tctaccgcca cttccaccga gcacactgcc aataatagca 2100

cgatgatgga tggatttcta agatcttggg tcccctcctc tgatgcatca gatattttga 2160

agaagttctg tcgctctatt tccatccagc gaaattatgt ctgtcagggt gacgatggcc 2220

taatgattgt cgatggtctc tcaacgggta agttatcggg cgaggtgatt gctgagtttg 2280

tcaaggagtt gcgagcgtac ggtaagtctt ttggatggaa ctatgacatc gagtttactg 2340

ggaacgctga gtatcttaag ttgtattttc tgaacggttg ccgggtacct aatgtgtcgc 2400

gacaccctat atgtggtaaa gagcgagctt ccggagataa gttagagatg tggccttcta 2460

ccatcgatat ttttaatggc atctttgtca acggtgtgca tgatggtctg ccttggcgtc 2520

gttggcttcg ctactgctgg gccttggcca cgttatattc tggaaagcgt gtgcgtcatg 2580

agaatgttga agtgtcaatc caatatccta tgtggtcatt tatctactgg ggcctgcctc 2640

ctgtcagcgt ctttggttcc gatccgtgga tattctctcc ctacatgccc actggcgatc 2700

acggattcta ttccatgcta actcttgtta gacccctaat taccgccctc tctccttcat 2760

cttcaatgga tggacttttt ggtcagtgcg atcacaacgc tctctttaac tccgagatgg 2820

tgtaccaggg ttactatatg gcgcagtgtc cgcgtcagcc atcgagatcc aaccgtcgtg 2880

atgacccgga gtctgtccaa cgatttgtta gggcgctcga atcgtactta tacatatccc 2940

cggagttgaa agcacgagtc aggcttggtc gtgaccgctg gcagaaatta gttgggtata 3000

ctgaaaaatc tccgccctct ctcgatgacg tcgctcataa atggttccgt agtgcgcagg 3060

aagccgactt acctaccacc tcggaaattc aggccatgga cttagcgtta atcgcggccc 3120

gccgtaaaac ataccaaggc ttctctaagc tacttaacac gtaccttcga gtaacttggg 3180

acctgaccga gccaatcgag catgccgtcg atccccgggt accactctgt gctggcattt 3240

ctccctcgaa tagtgagccc tttttgaagc tgtactcgat cggtcctatg atgcagtcga 3300

ctcggaaata tttcagtaac accttgttca ttcatcgtac cgtatctggc cttgacgtcg 3360

acgttgtaga tcgcgctctt ctacgtctga gagcccttaa tgctcctgat gaggtggtca 3420

ttgctcaact cctcatggtc ggcctgtccg aagcagaagc ggcgactttg gcagctaaga 3480

ttaggactat ggacatcaat gccgttcagt tggctcgagt ggtgaatctg tcaatacccg 3540

actcttggat gacgatggat ttcgatcgtt taatacgtga tattgtgtct actacccctt 3600

taactattcg ttctttgacg actgacctgc cctctggtgt cccatgggtt cgtgccatat 3660

tgcagttcct cggtgctgga gtcgccatga ccgccgttgg tcccgttaga cgcccatacc 3720

ttcactcagt cgctggtggc atgtcgtcat tcattaaaca gtttcgccgg tggatgcggg 3780

ctgagacgag gtagcgtccg tgcccagcat ggctcgagga attattcatc 3830

<210> 6

<211> 3906

<212> DNA

<213>the L3 gene of strain N-DAV-XT18

<400> 6

gcttttcacc catggctcag attagaggcc ttcgattgtc tacgacactc tcagcaccgc 60

cttcacgtcg atcgtacaca cctcagacat atgatgacct catttcagcg ctgaaattaa 120

ctgtcaagcc ctggcgaccg ttgcgatctg gcgctcaaga tgttatcacg gccgtgcaac 180

tgttctttcc actaaatggg tacgttgaac cactgttcat gctcgaaaag gaggtgagct 240

atgaagattt tgaagcatgg ttatcgccaa ttctatctgc cttggctgac cagttcttgc 300

gtcggtatcc catcgcctca taccatggcc gtttagtgaa tcctctgcta gcgaacgcca 360

ttgtagctgc gtttttgtca aatgcgccat atgcgcacgc tattgaacat ctcttcttag 420

tgcgtggagt gatagaagac attgtcgacg ctggtttatc cattcaaaat cacctgtggt 480

tcgatcgtgg cgctctcgtg tcacccgctg gtcagaaatt cattcagctt gacaagtact 540

ctttctcgtc tcgtgaccca tgtctcttcg ctaagcagtc tcgctactat ggcctggttt 600

actatttcct caacatatcg gactgcttgt cctattgcta tcgtcatctc tcaaacttca 660

cacctctgct gcactttgat cgaccatcca acggcgtgca ttgtctagta ccgtcggaat 720

ccacgactcc catagccggg tctttacctg tgtcctccct gagtgccatc ttattagaat 780

cttgcattca gcagtctatt ctgaacactc ggactccgac gggcgcacca tcgacgagac 840

agatagaggc tcttttgccc gtgtcctctc ccttctttga acgtcccacc actttggaat 900

actctttgtt ttctctttct aacgctttag taggtggtta ccagctatta gatctacctt 960

ctggtcaccc tgattgttct accgttgctg ctttgttggc tcgattaacg gatttttcca 1020

aggagatcac agtcattcaa cctattccgt cgcgttttac tttgtacgct gacagtccat 1080

tgaattacag tggtgagaac gccatgtttc taagccgttt gccatgtgaa tctggtaaat 1140

ccgtcggtcc tgtctttact ggtaaacctg ttaataggag tattggttgg atgcctcagt 1200

tcgatcctgc tacgtcatat gatcctgaaa tggcagctga gtccctagcc aaagcgacca 1260

ctctcccatt gcgtgcaaaa ttttcatcat tctggtccgg acccgcactt ttctctgccg 1320

cctcatgtga cagacacaat ggtgtgtatg acctgcgctt tatgccacct tttccatcca 1380

catactttga tgaggatgac gtgttttctc gctctcggtt ttcatcttat cgtgctgtcc 1440

gggaccgttc gcttttgaag gataccgcca atctcatgta tgtctccaat ttgtcgaatt 1500

cacatgacca gcgtcttctt cctgaatcta aaactatggt gtatgtgggc gcttctggta 1560

ctcacactga taatcagcca tcaattatca agcccttgtt agacggcact cttcctggcg 1620

tcttcaagcc cctttcggtt aaacaggttg gttgggaggt taccaacggt actatctgtg 1680

atatcgagtt acccttggct actggaacat tcttcttcgt atacagtgat gtcgatcagg 1740

tacagtcggg cgattccgat ctcgtctcct cttctcgacg tttctgtctt caattagaca 1800

tgctgatgaa gctgacgtat acctctggtt ctgtgatcgt gaagtgcaat ttccctactg 1860

acttagtgtg gcgtcacatt ttctcaacta tctctccata tttcatgtcg atccatctta 1920

tgaagccgct tgtctccaat aacttagaac tgtacattct atttgctgaa aagttatccg 1980

tccctgacgc gcctttcaat ccctccgctg acgtggtgac attctggcgc tctcaacttc 2040

agcgctacag agttctccgg gattcttttt cctccgtccc tcagattgac tcagctctta 2100

cgctggacga cccactaacc gtgtcggtct taaatttcgt agatgtcaca tcactttctt 2160

cgctggatga tcagcgtgca ctggctgcct tctctgttct aacatctttg gggtcacaaa 2220

agttgtctat tcatccatat tttgacagtt accgcacaca gctgaccggc atcgtgacac 2280

ctcattctcg caacctcgtt gatcgcttag cgtacgtgcc gcgcgtgttc ccttctacca 2340

ttgacgtcca acatcgcact atcgctcctt ctgatcctga gatattcggt tttcgttcca 2400

acgcgtggac gcagctctct ttcttctacg atcacgcact cacgttgatg gattttactg 2460

atgttaagca ttggctcgac ctcggcacag gtcctgaagc gcgtccctta tctttcttgc 2520

cttccgacct tccagtgact ctttgtgacg tacgcccctt cgtcctgccc accggatgtt 2580

ggtccacatt taccgatatg ctgaattatg attatttaac aactaatgtg gtgttgtcca 2640

ctggtgcgga tgttgtctcg tgtgttctct ctctgggtgc ggcttgcgct gatgcaaaca 2700

tgtcccttca tgatggtgta cgccagttag tctctcagtg tgttgaagct aatgtccgca 2760

cacttttcct ccaacttaac tgtcctctcc cttccgcggg cgatgtatct cgtgatgttt 2820

tggagttggt ccagtctaac tcaacttatg tcttccattc ccttggacgc gtcgagccct 2880

tccttcctta ctcagctttg cttgaattga ttgaagatat ctgccctggc gttgtggttg 2940

agattaaaac catggatcct tccctagcat ggctaagtta cgcggtgcaa gccaacgctt 3000

cggtaacatc cgatgacatg gcattagcga tgcggctgtc ccacttctgc ccgttatttg 3060

ttttccgttt cgatcaaaga tctgcccaat ttccggacga cgctcgcgtc ggcgttccgt 3120

tctccgtgat tgtgtctaac tatgatgcta cacactctta tgaggtcact cttgacaacg 3180

ttaccatcgc gaccgtcact gctggttcct taataggctt ctcttctggt gtgactgttt 3240

cagttcaagg tactctactg actctctcta ttaatccgtc tagccctggt gttctctccg 3300

tagttcagac attgccagtt cgcatctctc ttggcagttg cgttatagac gctccggatc 3360

catcgctgtc tcttgtgttc ccttcagtcc tagatacttc tttgtcgggg acgaacttag 3420

agttgtactt gtccgactgg tacgatgttg cactcttcta catcgacgag gtcaactctc 3480

gactgattcc tctatccgat tcaaaatatg aaatctttcg acgtgatcaa gcccctaata 3540

gccgcaccct caactatatc ttcgaccgat cggatgtttt ctttaaaatc gtgttgtgtg 3600

acgtctcatc ctctggtgta ggccgattca tctatcgtga acttcctgag ctgagttctc 3660

cggtatggcc tgacaacatg cgcaccttct tgtcattgcc ttttgatgct cctatggtga 3720

ttatctcccc ggatggtccc gtgaattacg atggtgctgt aatcacccct cctacttcat 3780

ggctgacggt ggatggtagt acctgcgtca ttgatggacg tccatcattt tacgttcctc 3840

ctggtcgata cggtctggtg agagtctaaa cgatcgcggg cctccagtag aagggtgtta 3900

ctcatc 3906

<210> 7

<211> 2264

<212> DNA

<213>the M1 gene of strain N-DAV-XT18

<400> 7

atctagccac accggtgcta ggagttggtt ctcgtattac cgcattggat cgcactattg 60

acgcacttac tttgaaacca cgtaccgaac tgcacgatgt ctacactctt gatccatctt 120

taactctacg ccagattgag ttgatttcat ctggtacttc aatggacgat atcgctcgcg 180

gtttgcttca tcgggattgg cgtcgtcaaa ctgtcattac tctgcttcct tctcgtcgga 240

ctttactcga ctatctactc tctaatcctt cgttgtgtcc tgatggttta gatcgttcca 300

ggctcaaagg gttcaagaag cgtcccaatg acttccgcat cagtgacttc ttttctccgt 360

taatcactga gtccacttct attagcacat actcacgctg gctcaatgcc catcctgtta 420

tattctccat cactcacaag gtagtcggcg ctcgcttacg cctattcggt ccgtctaaat 480

tatatacatt atctcccgac gttcttcgag agctatcgat tttgaagtca actgatcgtg 540

ttcttgtcac acccactgcg cgtgtgtacg tgagttgttt ccctagtgct tctacgagta 600

actgcgtcct ctctgcccgc gaacgttgga acgctcccga tgtccatccc gtcgttaaag 660

ccatacaact ggtctacgat caccagtacc gcgtcaccgc gcgttatctc tccgatccct 720

tagcttcggc tttattgctt gggactcagt cggtacgctc tctgaaggtt ccccccatcg 780

aggctagagc tgctcgttca gttggcgttc gtgtacaggc aatgacccct cctcgtggta 840

tcaacacctc catcatacaa gtcatcgatc tgcgtttgca gtgccgtcac tcacttatcc 900

ctgttgagag accatttcca ttaactctcg taggcttgcc gtcctgcttg cttcagcatt 960

tggagttgac tttatccgat agctggacgc ctattcgaga ctcaactggt atgtttgaga 1020

tgtggttcat ggtactcact cttacgtgcg acaagattgt ggatggacgt ggtaatgctg 1080

tctttctaac ccctggttct actgcctctt cttcaattaa ttatgttcag ctcgtgtcta 1140

cttcttctcc tcggccgcaa tcgctggcat ctaacgcgtc tggtcgtatt gactccgtag 1200

gtttgtgtat gccaaagggt tcattcaaat cgactatgat taagttcctg actggcttag 1260

aaatatgtgg cacgcgcgta atgtactctg atgtcgtcat ggacagcgac gatgttggtg 1320

attcattgga ccctaccttt gagactactc tctttgatga gttgatggcg ttggatcctc 1380

ctttcgactt agataagtta gccagttcaa ctgaccttgt cgatcagtct tacatcgcct 1440

ctcacatgta tcccaccttt ctgaggcttg ttaacgaact gttgactcct cgagcttctg 1500

agctatactc agaacacagt gctgagttta ggtctttgac ttacgcccat gcagactctg 1560

aatttcttaa cgcttgttgg acagcacgat tgatgcgctg ctttattaac tactatgagg 1620

agcagaacat cctgctacgt cctgggagag ttggaggtgt attgtttcaa gttgcgctca 1680

gtcgttgcta taagatgttc gcgacatcca ctccttcagt tccattgtca ttattcctaa 1740

aatcactgtt cgtcccttgg attgaatcgg caccccttct cgccccactg actctcaacg 1800

aatcctcacg cgtactcgct tggtatatac ccgagtcaca atggacggaa aatggatggt 1860

gcatgtgtga taagcatcgt catgtgacct tttcttttat tcgtggtttg cctgctgacc 1920

tgtccgtcct tgatctgttc gactggtcgc gattccgcgc aactatcgga gtagacacaa 1980

ctctcgtgga gctgggtacc tccattcgtg ccgttcgcgt ctccgttttc tggacttccc 2040

aaaaacccac tgtggacgtg tttgataacc gcgctctctt caccccattc aaacactatc 2100

atcttagtct tcactgtcgg tgcgcccttg gtcgaccatt caccgcgaag aacatgaaat 2160

tgtatttgtc cacggtagga aacgagaact gacgggccgt ggggcggtga cacccaggga 2220

gggtatgctg gtaaccctgg gttagtcgtc ttgagatact catc 2264

<210> 8

<211> 2158

<212> DNA

<213>the M2 gene of strain N-DAV-XT18

<220>

<221> misc_feature

<222> (1)..(4)

<223> n is a, c, g, or t

<400> 8

nnnntttgag tgctaacctt tctcacacga tgggtaacgc gacgtctgtg gttcagaact 60

tcaacataca aggtgatggt aaccattttt ctccttctgc cgagactacc tcctccgctg 120

taccgtcgct atcattaaat ccaggtctgc ttaatcctgg cggtaaagca tggaccctta 180

tcaacccaac gctcaatgca tccgatccct cgtcgttacg attgatgaca tccgctgact 240

tgtccacctt gtcccaatcc gcgattggta actccactgg ccttctccca acgtcaggca 300

tgtataccgt ggctaataaa gagacgttga gtgtggtgac gaatcatgca ctgtctcaat 360

ttgagaagct tcaaatggcc tgcgaactgg atcgtgacta tctggatgct cgaggcgtgt 420

caccagaatc cgtggatatc cacaattaca tagtctacgt ggactgcttt gttggtgtgt 480

ccgctcgaca agcggcttct aattttcagc agcacgttcc agtcatcacc aagtcaagaa 540

tgacacagtt catgacgtcc gcgcagaata tgcttcaggt ccttggccca tgggaacatg 600

acgttcgtga gcttctcacg atattgccga cttctaccac tgcaggcaag atcacttgtg 660

acatgaaatc cgtggttaac tttgtcaacg accagctctc tgacacaaat ttatgccgtc 720

tctatcctga atgtgctgct tcgtctgtag ctaaacgtaa tggcgggata cgatggaagc 780

aacctgacac tgacgaggct ccctcccttg caactaacga tatcgccgct tccacgatgg 840

gtgcgcttgc taacaccacc cccctggctg agaagtctaa ttctggtgaa gagtctatgc 900

gtttagtcaa cgacgtaggt gtggatatca tctgttctag agcgccagtc agctcctcag 960

tgtggtcacg tactgttgag ccaaaatcgt ataacatcag gacactccgc gtggaagaag 1020

cgctttggtt gcgggaatgt cagacatcta atggttttga cgttcagtac actctgccag 1080

atcagacaac tcataagcat ttctggcttc aacaaggttc cacagtgatt aacttggagc 1140

agacgggcgg catgatgttt gaggtgaata tctctggtaa agactacaag aagggcactt 1200

ttgatccaga taaccagaag ttggtgctcc tagttatgca atccaaaata ccttttgagt 1260

catggacttc cgcagcacag attactggta tagctcaagt ggctgaagtc actgtacacg 1320

ccgccgacag ctcgacacct ggtcggaaaa tcattggtga gacatcgtta tcgtatctgt 1380

ttgaaagaga gaccgttact acagctaaca ccgaggtgaa cacctacctc ttttgcacgt 1440

ggcaacttga cgatgctcag agtaatggcg acaatgcttg gcaggatgcg tgggatggta 1500

ttaccacttt gaccccactc acttcaggca ccgtgacggt taagggtacg tctgtggact 1560

ctgtcgtgcc gactgactta gtgggctctt atactcctga agctctggct gctgcccttc 1620

caaacgacgc cggacgtatt ctcgccaata aggctattaa gctggctgat gctatcaaga 1680

aagaggatga ttctgtcatt gacgagtctt ctccattcag cacccccatt cagggagtcc 1740

tcgccgtcca acagctagat accgttggga cacgtggtgt gcgtatcatc caacctccct 1800

cctttctgaa acgtgtcgct tcacgtgctc ttcacatgtt cctcggcgac cctcagtcca 1860

tcttgaagca ggcgacaccc gttcttcgag acccggacgt ttggactggc ttcatccaag 1920

gagttcgtga tgggatccgc accaagtctc tttccgctgg agttagatct gtctacaaca 1980

acgtcaccgc aactcaatca gtgcagacct ggaagcaggg atttctgact aagatacaga 2040

cgttgttcag accatagtga ggtgctaagg cctctctgcg cggcgggtcg gtgggcacgt 2100

cgcgttgatg ctgaatgcac ggggaggtga cgctctctgg gttagcacgt tactcatc 2158

<210> 9

<211> 1996

<212> DNA

<213>the M3 gene of strain N-DAV-XT18

<220>

<221> misc_feature

<222> (1)..(4)

<223> n is a, c, g, or t

<400> 9

nnnntttgag tcctagcgtg gatcatgtcg tcaaccaagt ggggagacaa accgatgtcg 60

ctctcaatgt ctcatgatgg gtcgtccatc cgttctgctg catcacaatt tttgtcggtt 120

ccattgtccc actccactcc tattccacct caacggaaga ctgtgcttct gaagttcatg 180

ctcggcgaag atctggttac cgttcagggt actctggctc cgtttgatga ctactggttc 240

gataatcaac ccctgctttc ccaggctgtg gaactgttgg catctgagga ccgtctacgt 300

aattttgagc attatgagaa gtttcttctc aagaagggtc atcagctacc ggagattatg 360

aacagactgc gtttattctt cactgatgtg ttgaaggtga aaatggaagc tgacaatcta 420

ccgtcccttg ctcaatattt gatggctgga accatggatg ccgtttctac tggtcaccct 480

cccggcgcct ctgtgccaga cgtctctaaa gtggtagcta agcagcaaac gatctctaaa 540

tcgcccggtc gtttggatga ggaagagtat aacgtaatac gttcacgctt cttaactcac 600

gaggtatttg acctgtcatc cgatctccca ggtgtccaac cctttctgga catgtattat 660

gctaccgttc cacgtgctga tgctactggc tggtgcgctt cacgacgcaa agggttactt 720

gttcacgctc ctggcgaacg tttcgaggat ctaaccatat ttgccactga tacctctcta 780

ccaaatgagc tcatattaac ggcaggtgat gtcactgtag cgcgctttga ccttcttgac 840

gtgtccggga tagcccctca acatcacgct tcagtccaag aagagcgtac tgttggaacg 900

agtcggtatt cagccattac tgcaaacgat caccctttgg tgttcttctc tccctcagcc 960

attcgttggg cgattgatca ttcgtgcact gattcgctca tttctcctcg gaatatcaga 1020

gtgtgcgttg gcatcgaccc gttgattacc cgttggacgc gcgatggtgt gcaagaagct 1080

gctattctga tggatgacaa gctcccgtct gtcggtcgcg ctcgcatggc tctcaggaca 1140

ttgactctcg ctcgtcggtc gccgatgatt tctttcatga ttggagcgtt gaagcactca 1200

ggtggtcaac tcatggaaca ctatcgatgt gacgcagcta atcgatacgg ttcgcccacg 1260

gtgccagcct ctcaccctcc accctgcgct aagtgcccgg agcttagaga acaaatcacg 1320

aggctatctt ctcaacccgt cgccaattca caacctctgg ccggtccagc tgctctgctg 1380

tcgaagatct ctgaattgca acgcctcaac cgggaattgt ctctgaagtt ggcagatgtt 1440

caaccggcac gtgaagacca tctcctagcg tatttgaacg agcatgtgtg cgtgaacgcc 1500

aaggatcatg agaaggacct ccttgcccgt tgcaatgtgt ctggtgactc agtcaatacc 1560

gtcgtcgccc agagagctaa gaatcgtgac aggtttgagg cccgcttgcg tcaggaagcc 1620

aacgctgaat gggagccccg catggctgca ctaaatcaag agctcacaca atcacgcgct 1680

gaacagcagg agatgatgac gcaggcgctg caatacctca acgagcgtga cgaattggct 1740

caagagttgg atgagttgaa acgggagatc actactctga gatctgcgaa cgtgaggttg 1800

aatgctgaga accaccgaat gagtcgagcg accagagtgg gtgattcttt tgtcagtgat 1860

gtcctctcga cgccttccga cgttccacga acttctgcac cttccatgga tgacctggtg 1920

gacgacctgt gagctttgac ctgtgactcg gtttctctct gactccatga ccccacggcg 1980

gactcggtta tccatc 1996

<210> 10

<211> 1568

<212> DNA

<213>the S1 gene of strain N-DAV-XT18

<400> 10

gcttttttct tctctgccca tggctgacgg tgcatgcaat cacgctactt ctatttttgg 60

agccgtatat tgtcaaatat cacagaatat tgcacacgga aatattgatt cttacacctc 120

ttggacttct tatttacctc ctattctagg cggtggtttt ggtcttattg ttcttctcgt 180

gcttgtggtt ttgatcgtgt attgttgtaa gcattcaaaa attctttctg ccgttaaggc 240

gactgattct gccgtgacaa ctttgcttcg tgatgtcact cccgccaacc ccgatcctgt 300

tcaagtcgtt taaagtccac tcgtggcgtc ttttgtccca atccccgttc cacgttcagt 360

tctgcgacgc aggactccaa tcctacgacg tctattcacg tttcccttct gtgtgtgacc 420

tttcgctctg ttattatctt aatacacctt tcgagtttgg aattgctgct atagaggggc 480

gtcccggtga ctattatttg ctgttcgctg gcaagtccag tgactctaac tcacgagtat 540

ctttgtacgc tacgcggcaa gccggtgacg atggatcgca acgaggtgat acgcctgata 600

ctttccctcc tcccctacca gtcaagcgac gtcgatcatt tgacgacaca gatcaaatcc 660

ctccaaagcg ccgtcgactc actgaaagaa tcacaagtgg tagtgttgag acgcctgact 720

acgattacgt cgacggtggc ggatctacaa tcaacaactg aattgttgac ctcacaggtg 780

gcaggactta gttcccgtgt ggcttcagtg actgatgagg tagtccgtgt aaattcagtg 840

attggaacta cgatcactaa tcttgacaat gtccggtccg agctatcctc tctctcctcc 900

caagtctcgt cgcagacgtc cactctaacg aatcttacat caaccgtttc atcccagtct 960

cttgcgattt ctgatctcca gcgacgagtt acggccttag aacgatcggg tggtgcgccg 1020

acacaatttg aagctccctt gcacctacaa aacggagtcg tctcactcca agcatctccc 1080

tctttctgtt ctttgtctcc gatcctctcc ggacctgctg atgctgctgt tttcaaggtt 1140

ggtgagtggc tgggaactgt catatctggt caaagtcagt catctgcaat catgaacgtg 1200

cggattcatt catttgggca gcggaccatg ttgcttatgt cttcgcaaaa tgtattcact 1260

attccgccag gttcgggtgc gtctttgcag ctagatgtga atcgtataac gacccctgcc 1320

attgacgctg ctatggtaac tccttccgct gcttttgctt ctgcttcctt tatggctgac 1380

atagctttca aagactctaa gacaggagaa gtccatgctt tacacactac tggctctttt 1440

cgatcacctt ctttctctat cgtttgggtc ccggttgctt cggaaactcg taattatcaa 1500

ataatggcgt tacgcttcac cgtcgccacg ggctaggctg tggcgcgcaa tgagaagagc 1560

tattcatc 1568

<210> 11

<211> 1324

<212> DNA

<213>the S2 gene of strain N-DAV-XT18

<220>

<221> misc_feature

<222> (1)..(1)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (1323)..(1324)

<223> n is a, c, g, or t

<400> 11

nctttttctt ccacgatggc gcgtgccgtg tacgactttt tatctacgcc tttcggtaac 60

cgtggtctag caactaaccg tactcaactg tcgtcactac tgtcaagttc aaattcgcca 120

tggcaacgct ttttgtccgc cttaactcca ctgaccgctc caggcattgt ttcaacccct 180

gaggcaccct acccgggttc atcgttatac caggagtcca tgcttcacag cgctactatc 240

cctgggattc taggtaatag agacgcgtgg cgcaatttca acgtattcgg cttttcatgg 300

acagatgaag gtttgtcagg acttgtcgct gctcaggacc ctcctccagc tccaccgtac 360

caaccagctt cgggacagtg gtctgatctg cttcagtatc ctcgatgggc taatcgtcaa 420

cgtgagttgc agtctaaata tcccattctg ttgagatcta ctttgctttc agctatgcgc 480

gctggaccgg tgttgtacgt tgagacttgg cccaacatga tttctggtcg acttgctgac 540

tggttcatgt cgcagtatgg aaacaacttc gttgacatgt gtgcacgatt aactcagtcc 600

tgcatgaaca tgccagttga gccggatggt aattatgacc agcagatgcg agcattaatt 660

agtctgtggc tcctctcgta tattggcgtt gtgaatcaat ctaacactat taacggcttc 720

tactttgctt ccaagacgcg tgggcaggct atggataact ggacgctgtt ctatgctacc 780

aacaccaatc gggtgcagat tactcagcgc cactttgcct acgtttgcgc tcgctccccc 840

gactggaatg tcgataagtc ctggatcagc gctgccaatt tgactgccat tatcatggct 900

tgccgccagc cgccagcctt tgccaaccag ggggtaatca accaggccca gaatcgaccc 960

ggattctcga tgaatggtgg aacgcctgtg cacgagctga acctgctgac taccgctcaa 1020

gcttgtatcc agcagtgggt cgtagctggt ttgatctcag cagctaaggg tcagtccatg 1080

acgcaggagg cgaatgactt ctcgaacctc atccaagccg atcttgggcg gatcaaagcg 1140

caagatgacg cgttgtacaa ccaacaacct ggttacgctc gtcgcattaa gccgtttgcc 1200

aacggagatt ggacgcctgg aatgactgcg caagcattag ctctactagc cacttttacc 1260

gtctaggcgt agggtcgtac gctgcctgag tccagccctc cggcagcacg tggacgtact 1320

cann 1324

<210> 12

<211> 1202

<212> DNA

<213>the S3 gene of strain N-DAV-XT18

<400> 12

gctttttgag tccttagcgt gcaagccgca atggaggtgc gtgtgccaaa ctttcactcc 60

tttatcgaag gtattactac tagttacttg tgttctcctg cgtgctggaa ttcgaagacg 120

ttatgggata ttgaagaatt tcacacacct gacgttatca gggtcggcaa cgcttattgt 180

tgcactcagt gctgtggtgt tctgtactat ggtgcccctc cctctgatgg aaactgtttt 240

ccacatcaca agtgtcatca acagcaatat cgtactgaga ctccgctcat gagatatatt 300

aaggtgggtc gcactacaga gcaactgctt gatcaatatg ccattgctct gcatgtcatt 360

gcagattact atgatgaggc gagtaagcaa cctcatgata ttgctgaagc tgagtcaatc 420

gcaccatttg atatcgtaac caggactgaa tctattcgca gtgaccgtgc cgttgacccg 480

gaattctgga cttatccgtt agagaggcga ggatacgacg cgcgacatga gattgctaga 540

gcgggttgga agatgatcga tgcttcatcg cgaagtcaca ctcttcctga atgtctggtg 600

tcaaatatgc tacatactag gcatgtcttc agccaaatgt tgaccacgac aaccatctat 660

gatgtcgctg tcacgggtaa ggccgttaaa ttcagtccga tggtagcaac catgccaact 720

cgaggagatg gtgctgtggc tctgtcaaga ggtaacttgg atcatgatgt cgaggactgt 780

tggatggatg gttttgcatt ctcccccctc atcggcggtg ttggcatcac tggtcaattt 840

gagcgtggtt cctgccataa ttttgggcac cccatgattg ggagcggtaa gaaagcttct 900

cactaccgca atttgttcat ggaatcctgg cgtggatggt caaagtcgtg ctttacatgt 960

gctgcaggga tggagcccgc ggagtgcgaa tctaggctgc gaggccacgc cagaactatg 1020

ttcggacgtt ctcttccgga tatctgtgac ttcgaggaga ctacccacgt tggccagtcg 1080

tccgcgccat taaagaaggc cacgaaattg tccttcctgg agtgtaggtg gtaagcacct 1140

ctgggtcaaa atgcacatag gctcccacct atgtgacggt tagcgggact cacctattca 1200

tc 1202

<210> 13

<211> 1191

<212> DNA

<213>the S4 gene of strain N-DAV-XT18

<220>

<221> misc_feature

<222> (1)..(4)

<223> n is a, c, g, or t

<400> 13

nnnntttgag tccttgttca gccatggaca acaccgtgcg tgttggagtt tcccgcaaca 60

catccgtcgc cgctggtcag actgttttca agaacttcta cttactccga tgcaacattt 120

cagctgacgg tcgaaatgcc acgaaagcgg tccagtctca cttcccatac ttgtctcgcg 180

ctgtccgttg cttgtccccg cttgctgctc actgtgctga tagaactctt cgtcgtgata 240

acgtcaagaa cattttgacg cgtgatctgc cctttccatc cgatctcatt aactacgctc 300

accacgtgaa ctcgtcctcc ctcaccactt cccaaggcgt tgaagccgct cgtctcgtgt 360

cccaggttta cggggagcaa gttcctttcg accacgttta tccatctggt tcagcaacct 420

actgtcccgg tgccgtcgcc aacgctatct ctcggcttat ggcaggtttt gtgcctcagg 480

aaggtgacga tttcatgccg actggtccaa tcgattatct cgcagctgat cttgtggcgt 540

acaagtttgt tttaccgtat atgttagata tggtggatgg acgtccccaa attgtgctac 600

cctctcacac cgttgaggaa atgttgactg acactggcct gctgaatgct attgatgcct 660

catttggcat tgagtctaaa agtgatcaac gcatgacgcg tgatgctgct gagatgagct 720

ctcgttcgct caatgagtta gagaaccatg aacatcgcgg gcgcatgccg tggaagatta 780

tgcttgctat gatggccgcg caactgaagc ttgaactgga cgcattagca gacgaacgca 840

ctgagtctca ggctaacgct catgttacat ccttcggctc acgtctattc aatcagatgt 900

cagcctttgt gcctatcgat cgtgagttga tggagcttgc tctcctaatc aaagaacaag 960

gctttgccat gaatcctggt caggttgcgg ccaaatggtc gtctattagg aggtccagtg 1020

cagtacgttc cctggcgagt gcgcgtcttg agattcgaaa tgggaactgg atgatccgcg 1080

aaggcgacca gacgctgctg tctgtctctc cagctaggat ggcgtagacg ggacccatgg 1140

tgtgggtgag gggggccacg acctctgcca cgacttggac tcttattcat c 1191

<210> 14

<211> 83

<212> DNA

<213>artificial sequence

<400> 14

attagctcta gccacagccc tgacctgtcc gtccttgatc tgttcgactg gtcgcgattc 60

caatagtgca tagcatcaag tac 83

Claims (10)

1. one group of primer and probe, which is characterized in that the nucleotide sequence of the primer such as SEQ ID NO.1-SEQ ID NO.2 It is shown；The nucleotide sequence of the probe is as shown in SEQ ID NO.3.

2. the examination that primer and probe described in claim 1 leads to the novel duck reovirus of duck spleen necrosis in preparation detection Application in agent or kit；The deposit number of the novel duck reovirus is CCTCC NO:V201843.

3. a kind of detect the PCR kit for fluorescence quantitative for leading to the novel duck reovirus of duck spleen necrosis, which is characterized in that The PCR kit for fluorescence quantitative contains primer and probe described in claim 1.

4. PCR kit for fluorescence quantitative according to claim 3, which is characterized in that in the PCR kit for fluorescence quantitative Further include: standard items and quantitative fluorescent PCR reaction reagent.

5. PCR kit for fluorescence quantitative according to claim 4, which is characterized in that the standard items are made by the following method It is standby to form:

Primer amplification deposit number shown in SEQ ID NO.1-SEQ ID NO.2 is used to exhale for the duck of CCTCC NO:V201843 The genome of the lonely virus of intestines, obtains amplified production, amplified production is connected on pMD18-T carrier, screening positive clone simultaneously mentions Plasmid DNA is taken, that is, standard items are prepared.

6. PCR kit for fluorescence quantitative according to claim 4, which is characterized in that the quantitative fluorescent PCR reaction reagent It include: GoldStar TaqMan One Step Buffer, GoldStar TaqMan One Step EnzymeMix and ROX.

7. a kind of detect the detection reagent for leading to the novel duck reovirus of duck spleen necrosis, which is characterized in that the detection Reagent contains primer and probe described in claim 1；The deposit number of the novel duck reovirus is CCTCC NO: V201843。

8. the described in any item PCR kit for fluorescence quantitative of claim 3-6 or detection reagent as claimed in claim 7 are as follows (1) in-(3) it is any in application:

(1) the novel duck reovirus for being CCTCC NO:V201843 to duck infection deposit number carries out epidemiological survey；

It (2) is that the pollution of CCTCC NO:V201843 novel duck reovirus carries out to the deposit number in blood or serum product Monitoring；

(3) accurately detection deposit number is CCTCC NO:V201843 novel duck reovirus copy number, specifies novel duck and exhales The progression of infection of the lonely virus of intestines.

9. a kind of lead to the new of duck spleen necrosis using the described in any item PCR kit for fluorescence quantitative detections of claim 3-6 The method of type duck reovirus, includes the following steps:

(1) standard items are subjected to gradient dilution, carry out TaqMan Fluorescence PCR later, according to the concentration of positive criteria product and Ct value draws fluorescent quantitation standard curve；

(2) sample to be tested total serum IgE is extracted, TaqMan Fluorescence PCR is carried out, collects sample to be tested fluorescence signal, fluorescence is believed Number carry out data processing, obtain Ct value and amplification curve, to sample to be tested carry out qualitative and quantitative detection.

10. according to the method described in claim 9, it is characterized by: TaqMan fluorescent PCR is anti-in step (1) and step (2) The program answered are as follows:

45℃10min；95℃10min；95 DEG C of 15s, 60 DEG C of 45s carry out 40 circulations later.