CN108611441A - It is a kind of detection novel duck reovirus PCR kit for fluorescence quantitative and application - Google Patents

Abstract

The invention discloses a kind of PCR kit for fluorescence quantitative of detection novel duck reovirus and applications.Contain probe and standard items and quantitative fluorescent PCR reaction reagent shown in primer shown in SEQ ID NO.1 SEQ ID NO.2 and SEQ ID NO.3 in the PCR kit for fluorescence quantitative.The PCR kit for fluorescence quantitative of the present invention can be detected the novel duck reovirus, the high specificity of the kit, only be specifically bound with novel duck reovirus, with other duck source viruses all without cross reaction；And the high sensitivity of detection, it is 4 × 10 in standard items¹‑4×10⁹There is fabulous linear relationship in copy range, detection range can be organized with efficient detection novel duck reovirus sick duck up to 9 orders of magnitude and the virus without clinical symptoms carries duck, improve detection efficiency.

Description

It is a kind of detection novel duck reovirus PCR kit for fluorescence quantitative and application

Technical field

The present invention relates to avian viruses detection technique fields, and in particular to a kind of fluorescence of detection novel duck reovirus is fixed Measure PCR kit and application.

Background technology

Avianreovirus belongs to Hu Changgubing sections (Reovirdae) Orthoreovirus (Orthoreovirus), can To cause birds that a variety of diseases occur, clinical manifestation is different and variant because virus stain, virulence or infection host's.

From 2016, the outburst on a large scale of the ground such as China Shandong, Hebei, Henan and Jiangsu duck is with gambrel enlargement for main disease The communicable disease of shape, the disease mainly cause each age level duck gambrel swelling, gambrel often to contain a small amount of yellow or blood Sample exudate, several cases have cheesy exudate in articular cavity, suffer from duck and different degrees of limping occur.The disease mainly results in The decline that kind duck is laid eggs with meat duck weight, feedstuff-meat ratio increase, and meat duck delivers qualification rate significant decrease for sale, to meat duck and kind duck cultivation Industry causes serious financial consequences.

It has been investigated that the outburst of the disease is caused by a kind of novel duck reovirus infection, vaccine there is no at present It can be prevented, existing commercially available duck reovirus vaccine can not carry out effective prevention and control to the disease；Conventional is antiviral It is invalid with antibacterial therapy method.It is to the novel duck reovirus in the effective measures for currently in this case, controlling the disease Infection is monitored, and isolation is taken to find infected duck group early to it or slaughters measure, and the lonely disease of intestines is exhaled to reduce novel duck Loss caused by poison infection.

Currently, including mainly that cytodiagnosis, immunology diagnosis and molecule are given birth to for the detection method of Avianreovirus Object diagnoses three categories, wherein cytodiagnosis technology is mainly separately cultured using cell and is observed with Electronic Speculum.This method operates Relatively complicated, detection cycle is long, and testing conditions are more demanding.Immunology diagnosis technology includes mainly enzyme linked immunosorbent assay (ELISA) (ELISA) and immunofluorescence method, such method is sensitive higher, but also high to antibody preparation.Diagnostic technique in molecular biology master To include conventional polymeric enzyme chain reaction (PCR) method and fluorescence PCR method, and traditional PCR method can only infect virus It is qualitative, it cannot quantify, sensitivity is relatively low；The advantages that fluorescent quantitative PCR technique is with its high sensitivity, speed is fast, high specificity It is widely used in gene expression dose analysis, the qualitative and quantitative detection of pathogen etc..It is current existing using glimmering Fluorescent Quantitative PCR method detects the report of reovirus in cows, but since the novel duck reovirus system reports for the first time, needle It cannot be used for the detection of the novel duck reovirus to the reovirus Diagnostic Strategy of mammal and other birds, so far There are not the effective ways for detecting the novel duck reovirus yet.

Invention content

For the above-mentioned prior art, the object of the present invention is to provide a kind of fluorescent quantitations of detection novel duck reovirus PCR kit and application.

To achieve the above object, the present invention adopts the following technical scheme that：

The first aspect of the present invention provides one group of primer and probe, the nucleotide sequence such as SEQ ID of the primer Shown in NO.1-SEQ ID NO.2；The nucleotide sequence of the probe is as shown in SEQ ID NO.3.It is specific as follows：

Forward primer：M1-F：ATTATCCATTTTGAGATCCACG；(SEQ ID NO.1)

Reverse primer：M1-R：TTGGTTGCTTTCCTAGCGCTT；(SEQ ID NO.2)

Fluorescence probe：5’-FAM-TGCGAGTCGGTTCTAGTCGCA-TMARA-3’；(SEQ ID NO.3)

The second aspect of the present invention, provide above-mentioned primer and probe prepare detection novel duck reovirus reagent or Application in kit.

The novel duck reovirus is preserved in China typical culture collection center on April 26th, 2018, protects It is CCTCC NO to hide number：V201818, address：Wuhan, China, Wuhan University.

The third aspect of the present invention provides a kind of PCR kit for fluorescence quantitative of detection novel duck reovirus, described PCR kit for fluorescence quantitative contains above-mentioned primer and probe.The deposit number of the duck reovirus is CCTCC NO： V201818。

Further, further include in the PCR kit for fluorescence quantitative：Standard items and quantitative fluorescent PCR reaction reagent.

Preferably, the standard items are prepared by the following method：

Use primer amplification deposit number shown in SEQ ID NO.1-SEQ ID NO.2 for CCTCC NO：V201818's The genome of duck reovirus, obtains amplified production, amplified production is connected on pMD18-T carriers, screening positive clone And extract Plasmid DNA, that is, standard items are prepared.

The quantitative fluorescent PCR reaction reagent includes：One Step RT-PCR Buffer、TaKaRa Ex Taq HS、 PrimeScript RT Enzyme Mix II and ROX reference dyes.

The fourth aspect of the present invention provides a kind of detection reagent of detection novel duck reovirus, the detection reagent Contain above-mentioned primer and probe.

The fifth aspect of the present invention provides above-mentioned PCR kit for fluorescence quantitative or above-mentioned detection reagent in following (1)-(3) In it is any in application：

(1) novel reovirus is infected to duck and carries out epidemiological survey；

(2) the novel duck reovirus pollution in blood or serum product is monitored；

(3) novel duck reovirus copy number is accurately detected, the progression of infection of novel duck reovirus is specified.

The sixth aspect of the present invention provides and a kind of detecting duck reovirus using above-mentioned PCR kit for fluorescence quantitative Method includes the following steps：

(1) standard items are subjected to gradient dilution, carry out TaqMan Fluorescence PCRs later, according to the concentration of standard items and Ct values draw fluorescent quantitation standard curve；

(2) sample to be tested total serum IgE is extracted, TaqMan Fluorescence PCRs are carried out, sample to be tested fluorescence signal is collected, to glimmering Optical signal carries out data processing, obtains Ct values and amplification curve, and qualitative and quantitative detection is carried out to sample to be tested.

Preferably, in step (1) and step (2), the program of TaqMan Fluorescence PCRs is：

42℃ 5min；95℃ 10s；95 DEG C of 5s later, 60 DEG C of 34s, 40 cycles.

Beneficial effects of the present invention：

(1) it is directed to the newfound novel duck reovirus that can result in duckling gambrel enlargement, the present invention devises Can to the PCR kit for fluorescence quantitative that the novel duck reovirus is detected, the high specificity of the kit, only with it is new Type duck reovirus is specifically bound, with other duck sources virus, such as Duck parvovirus, duck tembusu virus, duck virus Deng all without cross reaction.

(2) high sensitivity detected is 4 × 10 in standard items¹-4×10⁹There is fabulous linear relationship in copy range, Detection range, can be with efficient detection novel duck reovirus sick duck tissue and the disease without clinical symptoms up to 9 orders of magnitude Poison carries duck, improves detection efficiency.

(3) kit using the present invention can be monitored novel duck reovirus infection, to find early Infected duck group takes it isolation or slaughters measure, is lost caused by novel duck reovirus infection with reducing；It can be with To duck infection reovirus carry out epidemiological survey, and to the duck reovirus in blood or serum product pollute into Row monitoring.

Specific implementation mode

It is noted that following detailed description is all illustrative, it is intended to provide further instruction to the application.Unless another It indicates, all technical and scientific terms used herein has usual with the application person of an ordinary skill in the technical field The identical meanings of understanding.

As background technology is introduced, from 2016, the ground such as China Shandong, Hebei, Henan and Jiangsu duck is quick-fried on a large scale Hair is using gambrel enlargement as the communicable disease of cardinal symptom.The symptom of disease duck reovirus infection different from the past, There is the symptom of gambrel enlargement in duck group for the first time, thus deduce, which may be to exhale the lonely disease of intestines by novel Caused by poison.It there is no the drug and method that can effectively control the novel duck reovirus infection at present.Based on this, this hair It is bright to propose a kind of PCR kit for fluorescence quantitative that detect the novel duck reovirus, to find to infect early Duck group takes it isolation or slaughters measure, is lost caused by novel duck reovirus infection with reducing.

It is known that the host range of Avianreovirus is wider, this virus of generally existing in various birds, from 1954 It has been separated in the birds of a variety of morbidities such as chicken, goose, pigeon, ostrich, duck, turkey and other pheasants or health since year Reovirus, and the reovirus being separated to from different hosts its there are larger variability, pathogenic, gene sequences Row and the coding of major protein all have differences.

Present inventor isolates one plant of duck reovirus N-DAV-SD16 from the tendon tissue of morbidity duck swelling, Genome sequencing carried out to the duck reovirus N-DAV-SD16 of above-mentioned new separation, and respectively by 10 genetic fragments with The Avianreovirus of existing report has carried out sequence alignment and homology analysis, as a result, it has been found that, new isolated strain N-DAV- L1, L2, L3, M1, M2, S3, S4 are respectively positioned in a relatively independent branch in 10 genetic fragments of SD16, and at present Through uploading, reovirus-originated duck homology is relatively low in Genbank, illustrates that the strain N-DAV-SD16 newly detached is different from it His Avianreovirus, it can be assumed that duck reovirus found in the present invention with it is existing it has been reported that duck exhale intestines lonely Virus exists compared with Big mutation rate, is 1 independent kind of Orthoreovirus, and the novel duck reovirus is preserved in China Type Tissue Collection, deposit number are CCTCC NO：V201818.Therefore, present invention novel duck to be detected exhales intestines There are variability for the duck reovirus of lonely virus and existing report, in the prior art still for the duck reovirus reported Without effective detection method, for its difficulty bigger of the detection of the novel duck reovirus.

For fluorescence quantitative PCR detection, how design primer and probe sequence are the key that ensure detection validity. Although having software and design of primers principle of many design of primers etc. in the prior art, to design to obtain high specificity, sensitive High primer and probe combination is spent, being not can be simply obtained by primer-design software, this needs technical staff sharp Optimization targeting regions are constantly selected with its professional knowledge, carry out design of primers further according to the targeting regions of optimization, and pair set The primer of meter carries out screening repeatedly, optimization, redesign.Specifically, since present invention novel duck to be detected exhales intestines lonely Virus be different from existing report reovirus-originated duck, how specificity detection the application novel duck reovirus, And avoid that cross reaction occurs with other duck sources virus, it is the difficult point place of primer and probe design of the present invention.It is lonely for exhaling intestines The detection of virus, some with the segments S6 conserved regions design primer, some with S7 gene conserved regions design specificity amplification primers and Therefore how Taqman probes for the detection of reovirus, select targeting regions to carry out primer and probe design mesh Before there is no unified cognition.The present invention is during the test optimized the targeting regions for carrying out primer and probe design, As a result, it has been found that carrying out primer and probe design with the sequence conservation of the M1 genes of the novel duck reovirus, may be implemented To the specific detection of the novel duck reovirus.

Primer, probe designed by the present invention are used cooperatively, and the two complements each other, in the design process further The reaction condition for having fully considered quantitative fluorescent PCR, avoid interfering with each other between primer, probe, final design the application Primer, probe.Wherein：

Forward primer：M1-F：5’-ATTATCCATTTTGAGATCCACG-3’；(SEQ ID NO.1)

Reverse primer：M1-R；5’-TTGGTTGCTTTCCTAGCGCTT-3’；(SEQ ID NO.2)

Fluorescence probe：5’-FAM-TGCGAGTCGGTTCTAGTCGCA-TMARA-3’；(SEQ ID NO.3)

5 ' end mark fluorescent reporter group FAM of fluorescence probe, 3 ' end mark fluorescent quenching group TMARA, amplified fragments Length 80bp.

The present invention during the test, also passes through other conserved region sequences of reovirus gene and other primers Design principle devises multigroup different primer, probe, and is respectively combined, and detects its specificity after reacted respectively and expands Increasing Efficiency is combined with the primer and probe that can be used for clinical detection for screening optimal.Such as：

First group：

Forward primer：F:5’-TGCGCCTATCCTTGAGTTGA-3’；

Reverse primer：R；5’-TTGCCAGGAAATACGGGTCT-3’；

Fluorescence probe：5’-FAM-TCAAAATGGTGGACTTCAGTTTCGAT-TMARA-3’.

Second group：

Forward primer：F:5’-TGACAGGCCTGACTACGTTA-3’；

Reverse primer：R；5’-ATGCTTGAAGTGAGACGTAC-3’；

Fluorescence probe：5’-FAM-TGCGAGTCGGTTCAGTTTCGAT-TMARA-3’.

As a result, it has been found that new to this with primer using the present invention and probe combinations (SEQ ID NO.1-SEQ ID NO.3) The specificity and sensitivity that type duck reovirus is detected are optimal.And other primer and probe combinations cannot then exhale duck The lonely virus of intestines and other duck sources virus are effectively distinguished, and false positive or false negative are susceptible to.

The present invention also optimizes quantitative fluorescent PCR condition during the test, the maximum limit in the clinical application of kit Degree reduces operation, not only ensures sensitivity, but also reduce various pollutions to greatest extent, it is ensured that the science of result, accurate.

In order to enable those skilled in the art can clearly understand the technical solution of the application, below with reference to tool The technical solution of the application is described in detail in the embodiment of body.

The test material that test material is this field routine is not specifically described used in the embodiment of the present invention, It can be commercially available by commercial channel.Specific experiment condition and method are not specified in the embodiment of the present invention, usually according to routine Condition, such as J. Pehanorm Brooker chief editors, Science Press, 2002, Molecular Cloning:A Laboratory guide (third edition)；D.L. this peck Top grade is edited, Science Press, and 2001, cell experiment guide；Or the condition suggested according to manufacturer.

Embodiment 1：The design of fluorescence quantification PCR primer and probe

Obtaining novel duck reovirus according to two generation sequencing technologies, (deposit number is CCTCC NO：V201818) complete Genome sequence, the sequence point of this 10 genetic fragments of L1, L2, L3, M1, M2, M3, S1, S2, S3, S4 in whole genome sequence Not as shown in SEQ ID NO.4-SEQ ID NO.13.

For the primer sequence and fluorescence probe sequence of the sequence conservation design specificity of M1 genes, sequence design is such as Under：

Forward primer：M1-F：ATTATCCATTTTGAGATCCACG；(SEQ ID NO.1)

Reverse primer：M1-R；TTGGTTGCTTTCCTAGCGCTT；(SEQ ID NO.2)

Fluorescence probe：5’-FAM-TGCGAGTCGGTTCTAGTCGCA-TMARA-3’；(SEQ ID NO.3)

5 ' end mark fluorescent reporter group FAM of fluorescence probe, 3 ' end mark fluorescent quenching group TMARA, amplified fragments Shown in length 80bp (SEQ ID NO.14).

Embodiment 2：The foundation of fluorescent quantitative PCR detection method

(1) extraction of viral RNA：

Sample to be tested total serum IgE is extracted using classical Trizol methods or commercial kit；

(2) Fluorescence PCR Establishing：

One-step method fluorescence quantitative kit used uses the article No. from Takara companies for the One Step of RR064A PrimerScript^TMRT-PCR Kit kits sequentially add 2 × One Step RT- in 200 μ l Fluorescence PCR pipes III~10 μ l, 1 × TaKaRa Ex Taq HS (5U/ μ l)~0.4 μ l, PrimeScript RT Enzyme of PCR Buffer Mix II~0.4 μ l, PCR Forward Primer (10 μM)~0.4 μ l, PCR Reverse Primer (10 μM)~0.4 μ l, The II μ l of (50 ×)~0.4 of the μ of Probe~0.8 l, ROX Reference Dye or Dye, the middle sample to be tested extracted of step (1) The μ l of Total RNA~2 use RNase Free dH₂O is supplemented to 20 μ l systems.It is placed in ABI 7300Fast quantitative fluorescent PCRs It is reacted in instrument, reaction condition is 42 DEG C of 5min；95℃10s；95 DEG C of 5s, 60 DEG C of 34s later carry out 40 cycles.

(3) preparation of standard curve：

For copy number viral in accurate quantitative analysis sample, prepare the plasmid containing purposeful amplified fragments as standard items with Draw standard curve.The forward and reverse primer (shown in SEQ ID NO.1 and SEQ ID NO.2) for designing M1 genes first, expands Increase novel duck reovirus gene group and obtain the amplified production of 80bp (shown in SEQ ID NO.14).

It according to classical molecular cloning protocols method, is connected on pMD18-T carriers, is named as pMD-M1, screen Positive colony simultaneously extracts Plasmid DNA, utilizes spectrophotometer measurement plasmid concentration, as standard items.10 times are carried out to standard items Gradient dilution carries out TaqMan Fluorescence PCRs later, and according to the concentration of standard items and Ct values, instrument software can be drawn automatically Go out fluorescent quantitation standard curve；Specially：Y=-3.3607x+45.635, coefficient R²=0.9958, good line is presented Sexual intercourse；Wherein, the copy number logarithm of x representative samples, y represent Ct values.

(4) judgement of testing result：

According to quantitative fluorescent PCR react collect fluorescence signal, recycle instrument software handle data, obtain amplification curve, Ct values.Using the corresponding Ct values of standard items minimum concentration and amplification curve as judgment basis.

Result judgement method：If sample to be tested fluorescence signal is more than threshold value and Ct≤30.0, while amplification curve is smooth " S " type, then can be determined that in sample to be tested contain novel reovirus.

According to fluorescent quantitation standard curve, novel reovirus in sample can be quantitative determined.

Embodiment 3：The optimization of the composition, experiment parameter of kit and specificity, sensitivity and repeatability are investigated

1. the composition of kit：

The kit of the present embodiment is PCR kit for fluorescence quantitative, for detecting novel duck reovirus (deposit number For CCTCC NO：V201818).Contain in kit：Forward primer (10 μ shown in the SEQ ID NO.1 that embodiment 1 designs M), reverse primer (10 μM) shown in the SEQ ID NO.2 that embodiment 1 designs, shown in the SEQ ID NO.1 that embodiment 1 designs Probe, standard items and quantitative fluorescent PCR reaction reagent.

Standard items are prepared by the following method：

Use primer amplification deposit number shown in SEQ ID NO.1-SEQ ID NO.2 for CCTCC NO：V201818's The genome of duck reovirus obtains the amplified production (shown in SEQ ID NO.14) of 80bp, amplified production is connected to On pMD18-T carriers, screening positive clone simultaneously extracts Plasmid DNA, that is, standard items are prepared.

Quantitative fluorescent PCR reaction reagent includes：2 × One Step RT-PCR Buffer III, 1 × TaKaRa Ex Taq HS (5U/ μ l), PrimeScript RT Enzyme Mix II, ROX Reference Dye or Dye II (50 ×), RNase Free dH₂O。

2. the optimization of experiment parameter：

Exploration is optimized to the quantitative fluorescent PCR reaction condition of the primer (SEQ ID NO.1-2) in kit, is tied Fruit shows that primer is 10 μM, and reaction condition is 42 DEG C of 5min；95℃ 10s；95 DEG C of 5s, 60 DEG C of 34s later carry out 40 Cycle, kit sensibility, detection result are best.

3. the specificity of kit, sensitivity and repeatability are investigated

(1) specific test

Using the kit, carry out the specific test of the kit, respectively with Duck parvovirus, duck tembusu virus, What duck virus, NDRV-JM85 plants of duck reovirus, NDRV-TH11 plants of duck reovirus and the present invention were detected Deposit number is CCTCC NO：The novel duck reovirus of V201818 is template, and fluorescent quantitation is carried out using the kit PCR, as a result, it has been found that, Duck parvovirus, duck tembusu virus, duck virus, RV-JM85 plants of duck reovirus ND, duck exhale DRV-TH11 plants of intestines orphan's virus N cannot be expanded effectively；Only deposit number is CCTCC N O：The novel duck of V201818 exhales intestines Lonely virus can be expanded effectively.

The above test results show that the specificity of kit of the present invention is 100%, there is stronger specificity, kit Middle primer and probe is specifically bound with novel reovirus, viral with other duck sources, such as Duck parvovirus, duck Tan Busu diseases Poison, duck virus etc. are all without cross reaction.

(2) repetitive test

Using the kit, the repetitive test of the kit is carried out.Take that clinical acquisitions arrive based on gambrel enlargement The tendon tissue samples for wanting the duckling of symptom carry out repeated detection, three repeat samples in primary experiment using kit The corresponding coefficient of variation (CV) is less than 0.5%, illustrates it with high repeatability.

(3) sensitivity is tested

Standard items are diluted to various concentration, are detected using the kit, at the same using regular-PCR detection as pair Than.As a result, it has been found that fluorescent quantitative PCR result is shown, kit of the invention can detect 10¹The standard items of a copy number, and And 10¹-10⁹There is fabulous linear relationship in copy range, detection range is up to 9 orders of magnitude；And minimum of regular-PCR It can detect 10⁴The standard items of a copy number.Show that the kit carries out quantitative fluorescent PCR and has higher sensitivity.

Embodiment 4：The clinical application experiment 1 of kit of the present invention

(1) extraction of viral RNA：

The doubtful illness duck tendon tissue homogenate of 30mg is taken, is extracted using classical Trizol methods or commercial kit Total serum IgE.

(2) Fluorescence PCR Establishing：

2 × One Step RT-PCR Buffer III~10 μ l, 1 × Ta are sequentially added in 200 μ l Fluorescence PCR pipes II~0.4 μ l, PCR For ward of KaRa Ex Taq HS (5U/ μ l)~0.4 μ l, PrimeScript RT Enzyme Mix Primer (10 μM)~0.4 μ l, PCR Reverse Primer (10 μM)~0.4 μ μ of l, Probe~0.8 l, ROX The II μ l of (50 ×)~0.4 of Reference Dye or Dye, the middle sample to be tested Total R μ l of NA~2 extracted of step (1), make It is supplemented to 20 μ l systems with RNase Free dH2O.It is placed in ABI7300Fast fluorescence quantitative PCR instruments and is reacted, react item Part is 42 DEG C of 5min；95℃10s；95 DEG C of 5s, 60 DEG C of 34s later carry out 40 cycles, collect fluorescence.

Result judgement method：If sample to be tested fluorescence signal is more than threshold value and Ct≤30.0, while amplification curve is smooth " S " type, then can be determined that in sample to be tested contain novel reovirus.It the results are shown in Table 1.

Table 1：Morbidity duck inspection pathological material of disease fluorescence quantitative PCR detection result

Exhale intestines lonely the result shows that kit using the present invention can detect novel duck in 7 different regions duck pathological material of diseases Virus.

Moreover, 40 parts of identified samples of kit pair using the present invention are detected, there are 36 parts of pattern detections to contain There is novel duck reovirus, consistent with qualification result, detection accuracy rate is 100%.

Embodiment 5：The clinical application experiment 2 of kit of the present invention

The arthritic duck for the novel reovirus of infection that clinical acquisitions are arrived, takes the tendon tissue of swelling to be added 5 It organizes homogenate after times physiological saline, after multigelation 3 times, takes supernatant to be inoculated with LMH cells, received after stable cytopathy to appear Poison.

The extraction of above-mentioned viral RNA：

The cell sample for taking 400 μ l virus infection to be measured is extracted total using classical Trizol methods or commercial kit RNA。

Fluorescence PCR Establishing：

2 × One Step RT-PCR Buffer III~10 μ l, 1 × Ta are sequentially added in 200 μ l Fluorescence PCR pipes II~0.4 μ l, PCR For ward of KaRa Ex Taq HS (5U/ μ l)~0.4 μ l, PrimeScript RT Enzyme Mix Primer (10 μM)~0.4 μ l, PCR Reverse Primer (10 μM)~0.4 μ μ of l, Probe~0.8 l, ROX The II μ l of (50 ×)~0.4 of Reference Dye or Dye, the middle sample to be tested Total R μ l of NA~2 extracted of step (1), make It is supplemented to 20 μ l systems with RNase Free dH2O.It is placed in ABI7300Fast fluorescence quantitative PCR instruments and is reacted, react item Part is 42 DEG C of 5min；95℃10s；95 DEG C of 5s, 60 DEG C of 34s later carry out 40 cycles, collect fluorescence.

Result judgement method：If sample to be tested fluorescence signal is more than threshold value and Ct≤30.0, while amplification curve is smooth " S " type, then can be determined that in sample to be tested contain novel duck reovirus.It the results are shown in Table 2.

Table 2：Novel duck reovirus infection cell sample fluorescence quantitative PCR detection result

Sample serial number	Sample message	Ct values
			1	Shandong 2016.10.28	17.4250
2	Hebei 2016.12.22	21.7765
			3	Shandong 2017.01.08	16.9095
4	Shandong 2017.02.19	14.3898
			5	Henan 2017.01.14	19.8321

After testing, novel goose astrovirus is contained in sample, meets expection, show the detection method of the present invention it is accurate, can It leans on.

The foregoing is merely the preferred embodiments of the application, are not intended to limit this application, for the skill of this field For art personnel, the application can have various modifications and variations.Within the spirit and principles of this application, any made by repair Change, equivalent replacement, improvement etc., should be included within the protection domain of the application.

SEQUENCE LISTING

<110>Shandong Agricultural University

<120>It is a kind of detection novel duck reovirus PCR kit for fluorescence quantitative and application

<130> 2018

<160> 14

<170> PatentIn version 3.5

<210> 1

<211> 22

<212> DNA

<213>Artificial sequence

<400> 1

attatccatt ttgagatcca cg 22

<210> 2

<211> 21

<212> DNA

<213>Artificial sequence

<400> 2

ttggttgctt tcctagcgct t 21

<210> 3

<211> 21

<212> DNA

<213>Artificial sequence

<400> 3

tgcgagtcgg ttctagtcgc a 21

<210> 4

<211> 3928

<212> DNA

<213>L1 genetic fragments

<400> 4

ctttttctcc gatctccgaa atgagttcgc gcaaagtggc tagacgtcgt cataaggatg 60

ctactgaatt taaatacact aagaacgtta acaagtctaa gccatcctct actgacgtta 120

aagaacctgc ggatagtgcc acagataaga aagtcactgt tccatcacca gacaatccag 180

ccgcttctac tccctcttcc actgatggag cttctcaaac atccgttgct aagcagacga 240

atgataatga cgcctcagtt aaggaatcag ctcccaagcc taccgtatct agcgatggga 300

aagacggaat gcatggtgct gtgaagttgc aagacgctaa ggccactgca gctgtggata 360

gtaataagga tagagatgtg gtatttggtg gcgcaggctc tggtgacaaa aatgctatta 420

cgaagactgg ttccgttgac aatgatgggg gcgttaaagt cgttccagcc aaggatgcta 480

cgatatcttc ggccaaagcc atgatggaac agaagcagtt agttgctggt cttccgaagc 540

aaccgaagtc tgctaatcat ttgtgcaccg tttgtatggc acaattcgcg tctgctgacg 600

ccctaactat ccatcagact acgcactcca ttggctccaa tgctgctctg acgagcttct 660

cgatttctac tgctgttgaa gaattcattc aatcatgggc tgctgctacg tccactgcca 720

ataccaagac ggccttaact gtgtctgacg tggactcgct gatgatgact gaaggaatac 780

gtctcataac ttgggattct gggttatgta catcttttga gcttgtcccg attgtccatt 840

caaacactgt tcaagatgta atttcgtact catggttcac atcaagttat aatatcacaa 900

ctcccttccc acaggcgcct gtcgtgcgaa ttgttttacg tactaattgg gctgccaaat 960

tggactctcc ctcgtcgtcg cgtgaatgtg atcttcgcct cgccccacct acagagagta 1020

atgctcgatc attctcaatg ctgctcaata ctggtgcgac tccagaaggt actttcaacc 1080

ccaacaccct tcgtatgaat gtgctgcaga tgtgtcttca gtatgttctg gctaacctac 1140

acttgaatcg tagcactcag ttcaccatgg atttgactgc cgcagctccc aatctgtcgg 1200

cgtctcaact ccgtatcgtt ccagatgata aagatggtaa atggttccct gtcatgtatc 1260

catctcgcgt gaacatccca ctgttcaata agacagctga ttttgttaat cagtgcattc 1320

gtgacagaat tggccgatat gaccgcgccc agactttcgc tggcgcaccc tctgaatggg 1380

ctgacatgtg ggaaacagcg gacgcgttaa ctctctccgt ccgtgaaatg tggatgtcac 1440

gtatttccca aatgaatatc tctcctgctg atatcgctga cgctatctct cgatgttctc 1500

agtccctgct cactgttgcc gcgccaacag ctccttctgt agctcgtctg ttaccttggc 1560

gggttagttc cgatgagagg cagctcctcc aattgttgat gtacttgaac gttgggacta 1620

gtgccgacta cgtccaacct attctgtctg cgttcgctcg aactctatct cgcgtgtcac 1680

cattgcgtat taatcccact ttaatcgcta atgccatgtc gacaattgtc gagagcacta 1740

ctaataccca gagtcctgcg gcagctattt tgtcgaagct taaacctgtt gcctcggact 1800

tctccgattt taggttggcg tgtgccgctt ggttgtataa tggttgcgtc cagacatact 1860

tgtctgagga ttcatatcca agcagtggtg gatctgttac tagcattgat acattggttg 1920

atatgtttgt gtgcttgttg gctttgcctc ttgttactga tcctaatgct ccttgccaag 1980

cctttatggt tgtcgctaat gccatggttg gttacgagaa tctaccgatg gacgacccta 2040

attttactca gcaaagattg gctgcagcgt tcaacaatcc cacgacctgg cctcaatgtt 2100

tcctccaccc tcaaaacatc gatcgacgcc aatgtccgat tctctcatgg tgggctcagc 2160

agattcatcg taattggccc acaccgtctc aaattactta tggggcgcct gacatcattg 2220

ggtccgctaa cttgtttact cctcctgacg tgctgttgct tccattacag cataggccca 2280

tccgtattac taatcccacc ctgaacttcg ataatgagtt gacgacttgg cgtaacaccg 2340

tggttgatct ggttctgcgc atcatcgaca gtggtcggta ccagcccaat tggaatcagt 2400

ccatccgtgc ctctatgcgg aatgcgatga caaatttcag aattattaag tcctatactc 2460

ctgcttacat agcagaactg ctacctgtgg aactggcagc tatcgctcca actctaccct 2520

tccagccttt tcaggtgccg tttgcccgct tagatcgcga cgctatcgtc actcacgtca 2580

atgtatctag acaagctccc aacaatcttg ctcaacctgc attgaacatg tccatgacgt 2640

accagcgcac aggggttcca atctctctta gtgcccgtcc cttggcagtc gctcttctgt 2700

caggccagta ccctactgat ccccctcttc agactaatgt ttggtacgta aacactctca 2760

cgcctctata ttccaatgat ggtctcttta ataacgtcca gcacgctatg gttgcttctg 2820

aagcttacgc taccttgatc accatgctgg ctcagtgcac tgacatgcag taccctgtgg 2880

atcggccatt gaattggctt cgtcagatta atttggctgc taatgaggcg acgattttcg 2940

gtcgatcaat taattcactt ttccagactg ctttcgacct ttcaccttcc actgtattgc 3000

ttcaaccgtt tttggaatct gatccacgtg cgacacagct agccatttct tacgttcgtt 3060

ataatggtga cagtgaaacc ttcgtgccaa cagtgcgtcc atctatgatt tcagaagcga 3120

cattgctcgt tgagcgtact ctctcgcacg aatacaacct cttcggttta tgccgtggtg 3180

acatcatcct gggacagcac atgactccaa ctgcgttcaa tcctttggct ccgcctcctt 3240

ccgtcgtttt taacaggggt gatactgatg tctatgagtt tggctctcgt agcttcgcca 3300

acttcggcat gaatggggag gagatcttgg tcatggatgc gaacggcgtg cgtcgtccat 3360

tactcggccg gtgggttatg ccactgcagc ttttgatggt taatattggc gtatttccta 3420

agctgttgct ggatcgtatc ctgaaggggc gcttgtatat ccgacttgaa gttggcgcgt 3480

atccatatac ggtgcagtat taccagggac gtgagtttac ggatggcttc actctgcttg 3540

agcaatggat gtctaaggtg tcgcccatgg gtatccctcc cgtccctttc ctcatgccgc 3600

agtccgaagg acacaacatc acttcaggca tggttactca ttacatctgg tccactgaat 3660

ataatgatgg gtccctcttc gccacgaaca ccgacctacc agttactgtg ttcggccctg 3720

accgcaccat cccaatcgag cgttatcggg cactcgtgga tccaggtgct cttcccgcta 3780

ctaaccaact gccgcacacc attgatcttt actgctcact gagacggtac tacttggaga 3840

cacctcccat cactgcgacc gtcaccactt atggcgatgg actccccgcg ctgaaccatt 3900

agagcggcga ggctagacgc gagctgat 3928

<210> 5

<211> 3830

<212> DNA

<213>L2 genetic fragments

<400> 5

gctttttcct caccatgcat gtcaacgggt ttgatgatgc tactctctcc tacgcacagt 60

ccatatcggg ggttatccca atgacaaata agttatttga gcaagcatct acctcaatac 120

gtgccctacc acgctcacat gtttatgcta tattagataa tgttaatttt tcagtttcat 180

gtgtcatccc gaatcgtatt ttccatcatc ctgatcactc tgagtacttt tacattgatg 240

cggttaacag agttagacgg aaacaagtta tcgatcctga tgatgtattt gtgccaaact 300

gcaatttgca gggtcttatt actccaatgg agagattacc aaattatggt caattgtctg 360

agactatttc gtcgaacgct cgggatggct tgccatctgc acgcgtagca gctacttttt 420

ataacacttc ggtgtcacag gctcgccaag ttaaagctcc acttgaatcc tttttgttgc 480

ctttgctatt atctgagact tgctcattat cagacgatcc ttgcggactt gacaccgcag 540

cttctcctcc gatccatacc aatctggcgt tatgggtgtt acgcgaaatt agtcgaacta 600

tttgtggatc ttcgaatgac cgttcacctt ggttactgct cgattcaggg gttgcgtggt 660

tcatgtctcc gttaatgtca tcggccattc cacctcttat ggctgactta acgaatctag 720

cgatctacaa acaaatttgt tctgtgtctg atgagcttca ttcccttgca gttcaagtgg 780

ttttgcaggc cgcggcgtca caatcgtatg gacactacat attgcagacg aagtcagtat 840

tcccccaaaa tacgttacat aacatgtttc gtacgctcac tgatggtatt gttccggtca 900

tagattggtt agaaccgcgt tcaaactatc gcttcatgct tcaaggtgcg cgtaaagtga 960

cttcagatga tgcgaatcag gctccggata acacggaagc cgcggagcaa ctcggtcgca 1020

agatggggtg cctcgatgtc gtacgctcct tacgtaagat gtcctcgtcc atcactgtcc 1080

attcacacga tgccatgacc ttcgtacgtg atgctatgtc gtgcactagt ggcatcttta 1140

tcacgcgtca acctactgag accgttttaa aagagtacac tcaagcgccg accattgaag 1200

tccctattcc tcaatcggac tggtcaccgc ctattggatc tctgcgatat ctctctgatg 1260

cctgttccct ccccgctgtg tatctggcta gggcttggcg cagagctgcc tctgctgtag 1320

tagataatcc gcacacttgg gaccctttat atcaggccat ccttcgctct caatatgtga 1380

cgtcacgcgg tgggtccggt gccgcgttaa gagatgcttt gaaggctgcg gaagttgagc 1440

ttcctcagta tcctggggtc agtgttaaag tggcgaccaa gatttatcaa gcggctcaga 1500

ctgctgacgt gcctttcgat aaattatctc gtgctgttct agctccattg tcgatgggct 1560

tacgtaacca agttcagcga cgtccaagaa ccatcatgcc catgaatgtg gttcaacagc 1620

agatttcagc ggctcatact ctctccgctg actacattaa ttatcacatg aacttgtcga 1680

cgacctcggg tagcgctgtg attgagaagg tggttccatt aggtatgtat gcatcctgtc 1740

ctcccgctca agcggttaat attgatatta aggcttgtga cgcgtccatc acgtaccagt 1800

attttctttc tgttatcgtc ggtgccattc atgagggtgc agcaggccgt cgtgtctcgt 1860

cttcattcat gggcgttcca ccaagcgtgc tgtccgttgt cgatgctagc ggagtgactt 1920

catccatgcc catctcaggt tttcaagtca tgtgtcaatg gttggctaaa ctttaccagc 1980

gaggttttga gtatcaagtg acggatacat tctcacctgg caatattttc acgcatcaca 2040

ctactacttt tccctctggt tcaacagcga cgtctacaga acatactgcc aataatagca 2100

cgatgatgga tggcttcctg cgcgcttgga ttccttcctc cggtgcgtcc gacgtactga 2160

agaagttctg caaatccatc tcaatacaac ggaattacgt ttgtcagggt gacgatggtc 2220

taatggtcgt tgatgggcta tcgacaggta aattatcagg cgagataatc gatgaatttg 2280

ttaaggaatt gagagcctat ggtaaatcat ttgggtggaa ctatgatata gagtttaccg 2340

gaaatgcgga gtatctaaag ttgtatttcc taaacggttg ccgtatacct aatgtttctc 2400

gacatccgat ctgtggcaaa gagcgcgctt caggggacaa gttagaaatg tggccgtcca 2460

ccattgacat cttcaatggc atatttgtga atggtgtgca tgatggtttg ccgtggcgca 2520

gatggttacg ttattgttgg gctcttgctc ttatgtattc tggaaagacc gtgcgtcatg 2580

atgattctga ggtgttgatc caatatccta tgtggtcttt tgtgtattgg ggtttgcctc 2640

ccgtgagcgc gtttgggtct gatccatgga tcttttctcc atatatgccc actggtgatc 2700

atggtttcta ttcaatgttg actttagtgc gccctctgat cactaacttg tccccatcgt 2760

cagacgcttc gggattattt ggtcaatgcg atcacaacgt tttgttcaat tctgagctag 2820

tttatcaggg ctattacatg gctcaatgcc cacggcaacc ttctcgctcg aaccgtagag 2880

atgatcccga ctctgtacag cgcttcgtca aggccttgga gtcttacctt tacatttccc 2940

ctgagctaaa atcgcgagtg cgccttggtc gtgaccgctg gcagaagttg gttgggtata 3000

cggaaaaatc tcccccgtcg cttgatgacg tggcgttcaa atggttccgt agtgcacagg 3060

aagctgatct cccaaccgct acagagattc aaagcatgga tctggccttg ctggcagcca 3120

gacgtaggac atatcagggc ttctccaagt tgttgaatac ctatttaagg gtaacctggg 3180

atttatctga tcctgttgaa cacgctgtag atccccgcgt acccttgtgt gccggtgtct 3240

ctccatcaaa tagcgagccg ttcctcaaat tgtactccgt aggtcctatg atgcaatcca 3300

cgcgtaaata ctttagcaat acgctattta tccatcggac tgtgtctggt cttgacgtcg 3360

atgtcgtcga tcgtgcgctc cttaggttgc gtgcccttaa tgcgcctgat gacgtggttg 3420

tagctcaact tttgatggta gggttgtctg aagccgaagc cgctacatta gcagcgaaaa 3480

tacggacgat ggatatcaat gccgtgcaat tggccagagt tgtcaactta tccatccctg 3540

actcatggat gaccatggat tttgatcgct tgatacgaga tatcgtgtct gtcactcctc 3600

tgaccgttcg atccctaacc accgatctac cctctggcgt accgtgggct cgcgcgatct 3660

tacagttctt aggtgcgggt gtcgccatga cggccgtcgg acccttgcgt cgtccctact 3720

tacactcagt tgccggaggc atgtcttcat tcattaagca gttccgccgg tggatgcgtg 3780

ccgaaacgag gtagcgtccg tgcccggcat ggctcgagga attactcatc 3830

<210> 6

<211> 3876

<212> DNA

<213>L3 genetic fragments

<400> 6

gcttttccac ccatggctca gattcgaggc cttcggttgt ctacgacgct ctcagctcca 60

cctccacgca agattataac atctcacact tatgatgagc tgatctccgc tctgaagtta 120

gcaaccaagc cttggcgccc tttgaagtcg cgaaataatg attctgtcac ggcagtgcag 180

ctcctttttc cccttaatgg ttatattgaa cccatgttca tgttggaaaa ggatatgacc 240

cttagtgatt ttgaggcctg gttgacgcct cttctatctg cactcgctga ccagttgctt 300

agacactacc ctatcgccgc ctatcacggg cgtttgatta atccgctgct atctaatgca 360

attgttgccg ctttcttgtc taacgtgcct tatgcgcatg cattggatca tctcttcctt 420

gttagaggaa acgtcgagga tattatggat gcggggatcg caattcagaa tcacttgtgg 480

ttcgatcgcg gtgcactagt gacccctgct ggacagaaat ttgttcagct gactggctat 540

aacttctcct ctaatgatcc gtgtctattt tctaagcaat tgcgttgtta tggcctcgtt 600

tactactttc tcgacatggc cgaatgtctg gcgtattgtt ggcgtcatct atccaattca 660

actccactga tacactttga ccgtccgtcc aatggagttc attgtttggt gccctctgaa 720

tccacgacgc ctatcgctgg ttcgttacca gtgtcagcac tcagctctat tttgttggaa 780

tcctgtcttc agcaatctac aattaatgcc cttactccca ctggttcgcc cgtcattaga 840

caaatagaag cattgttgcc tatatcatca ccgtttttcg aacgacggaa cactctggaa 900

tattctctct tcgcactgtc aaatgctctg gtaaatggtt atcagcttgt agacttgcgt 960

tccggccacc ctgattgcgc tactgttgct gccatcctag ctagattgat tgatttctct 1020

aaggatatca ccgttattca accgcgccct gctctctttg ctatcaacag cgacagtccg 1080

cttacgtata gtggagaaaa tgctaatttt atttcgcgct tgacttgtgc gtccggtaga 1140

cctattggtc cggtcgttgt cggtaaatcc gttgatcatg ccgttggttg gatgccccag 1200

tttgaccccg ccacgtccta caaccctgat ctctcgatgg actcacttgc tcgtgccacg 1260

acactgcctc tccgtgctaa gtattcgact ttctggtcag gcccagcatt gttttctttc 1320

gcttcatgta ataggcacaa tggtgtatat gacatacagt tcatggctca atttcctcct 1380

acttacttta gtgatgatga cgccttttct agatcacgat tctcttctta tcgtgcagtt 1440

agggaccggt cattgttgaa ggataccgct aatttgatgt acatctcgaa tttgtccagc 1500

tctcacgacc atcgtcttgt cccagattct aaaactatga tttatgtggg ttcctctggt 1560

actcatgtag ataatcaacc ttctatcatt aaacctctct tagctggaac tcttccgggt 1620

gtttttcgcc ccctttctat aaaacaggtt ggttgggagg tcactaatgg aacgatttgt 1680

gatgttgagc ttcctttagc cactggtacg ttcttcttcg tgtacagtga tgtggatcaa 1740

gtgcaatcag gtgattctga tttggacgcc tcctcgcgtc gcttttgctc ccaattggac 1800

atgctaatga agttgacgtt tactggtgga tcgcttgtcg ttaaatgcaa ttttccgact 1860

agtctagtgt ggcgtcacat cttctccact gtttctcctt atttctcggc tattcattta 1920

atgaagcctc tcgtgtcaaa taatttagaa ctgtatctat tgtttgcgga gcgtttgccc 1980

gttcctgacg tcgcgttccg tccttcagcg gacgttgtcg ttttctggcg atcacagcta 2040

caacgctatc gagtgttgcg tgattccttt tctaatgtgc cctccatcgg gtccactctc 2100

actttagatg aacctttgac tgtctctatt ctcaattttg ttgacgtcac ctccctttct 2160

tctcttgagg atcaacgagc cttatctgct ttttcagttt taacttctct agggtcacag 2220

aaactctcgc ttcatcctta ctttgatagc taccgcacgc agctcactgg aataattact 2280

ccacattcac gtaatcttct agatagactg gcgtacgtcc cgcgcgtttt tccttcgacg 2340

attgatgtgc aacatcgtgt catggcctct tcagatccag aaatttttgg ttttcgttct 2400

aattcatgga ctcaactgtc cttcttctac gacgcgacgt taacttctat tgattttact 2460

gatgtaaagc actggttaga tttagggacc gggcctgagg cgcgaccgtt gtcttttctg 2520

ccttccgatc ttcccgtcac gttatgtgac actcgtccat tcatcttccc ttccggctgc 2580

tgggctactt tcactgattt cttaagttat gactaccttg tcacgaatgt cgtgctctca 2640

actggtgccg atgtcgtatc ctgtgttctt tctctgggtg cggcctgtgc tgatgccaac 2700

ataactttac atgaaggcgt gcggcagctg atttcccaat gcgtggatgc caatgtcaag 2760

acattgttcc tgcagcttaa ttgtcctctc ccatctgcgg gtgatgtatc tcgggagatt 2820

cttgagatgg ttcagactaa ttcaacttac gtgtttcata ccttgggtcg tattgaaccg 2880

ttcattccat actccgctct ttcagagata gttgaggact tgtgtcccgg catcgtcatt 2940

gaaattaaga ctatggatcc ctctctctca tggcttgatt acgctgttca atccaatgcg 3000

tcagtgacgt cggatgatat cgtattggca atgcgtctgt ctcacttctg tccacttttc 3060

gtgtttcatt ttgaccgtca gtctgctcaa tttccggatg atgcgcgtgt tgggactcct 3120

tttactgtca cgctgttaga ttatgaagat actcgttcat acgaggtgac gttagataat 3180

gtcactatcg ccaccgttac cgcaggtgct ttggtgggtt tctcatctgg tgtcagcgtc 3240

agttcaacca acaatcagct tattttaact atcgattccg caagtccagg aattctctcg 3300

gtcattcaga ttcttcccgc tcgtatctct ttaggcagtt gtgtgataga agcaccggat 3360

ccatctctct ccttgatctt ccccgccacg ttagatacct ctttgtcggg aaccgatttg 3420

gagctgtatt tgtctgactg gtacgatgtt gcattatttt acgtcgatga aatccactcc 3480

cgcttgctgc cagtgtccga taccaagtat gaaatatatc gcaaggatca ggcgccgaac 3540

agccgggtga tcaactatat tttcgatcgg tctgatgtgt ttttcaagct agtgttatgt 3600

gacgtatctc cctcaggagt aggccgtttc atctaccgtg agttgccaga attaagttca 3660

cctgtttggc cagacaacgc gcgcactttc ttgtccatac cgttcgagtc acccatggtg 3720

attgtctcgc cggacggacc tgttaattac gatggcgcaa actttactcc tccaaactca 3780

tggttgacgg ttgatggcag tacctgcgtt gtagatggcc gtccttcgtt ctacgtgccc 3840

cctggccgat atggtctggt gagagtctaa acgacc 3876

<210> 7

<211> 2199

<212> DNA

<213>M1 genetic fragments

<400> 7

atggcctatc tagccacacc tgtgctagga gtcggttctc gcattaccgc tttagatcgt 60

actattgatg ctatcacgtt gaaacctcga atcgacttac aagatgtata cacaattgat 120

cccactttga ctctgcgtca gatagagtta atctcttcgg gaacttcaat ggacgatatc 180

gctcgtggac tgttgcaccg agactggcgt cgtcaatcca tcatcgtttt gcttccctcg 240

cgtcgctctc tccttgagta tctattgtct aacccttctg tctgtccaga cggtttagat 300

cgttctcgac ttaaaggatt tcagaagcgt ccaaatgatt ttcgtgttca agatttcttc 360

tctccactga tcacggactc gacgtcaatt gctacatact ctcgatggct taatgcccac 420

cctgttgtgt actcaactac tcataaggtc gctggtgctc gggtgcgtct ctttggacct 480

gccaaattat acattctgtc acctgacgtt cttcgcgaat tatccatttt gagatccacg 540

gatcgtgtcc tcgttgtacc tacagcacgt gtatatgttg gttgctttcc tagcgcttcc 600

actagtaatt gtgtgctcac tgcacgcgac cgctggaatg ctcctgacgt tcatcccgtt 660

gtcaaggcaa tccaattagc atatgaccat caatatcgtg tcaccgctcg ctatctttcg 720

gatccccttg tctccgccct tcttgttggg aatcggtcgg tgaagacctt gaaggtacag 780

ccagtagagg ccagagcagc acgatcagtc ggcattcgcg ttcaagcgat gacgccccct 840

cgtggtatca acacctctat catccaagtc gttgatctca ggctgcaatg tcgacattct 900

ctcattccca ccgaaaggcc cttcccgctg acatttatcg gcctcccatc ctgtttgctc 960

cagcatttgg atttgacgct atctgacgat tgggtgccta ttcgtgatcc cacgggcatg 1020

tttgaaatgt ggttcatgat tcttacgctc acttgtgata agattcttga tggacggggc 1080

aacgctgttt ttctcatccc cagttctact aatgcattgt cgattaatta tgtacagctt 1140

acatcgaccg cgtctcaacg ccctcagtca ttagcggcaa atgcatctgg acggatagat 1200

tctatcggac tatgtatgcc taaggggtct tttaagtcaa ctatgattaa atttctcact 1260

ggcttggaga tttgcggcac acgagtgatg tactcggacg tcgtgatgga cagtgatgac 1320

gtgggtgacg ctttggatcc tacttttgaa acggctttgt atgatgcact ggtagcactt 1380

gatccgcctt ttgacgttga taagttggct agccccactg atctagttaa tcaggagtac 1440

gttgcgtctc atatgtaccc gacattctta cggcttgtca atgagctgct gactcctaag 1500

gcttcagagt tgtactctga gcgtagcgtt gaattccgat ctcttactta cgcgcacgct 1560

gattctgaat ttcttaactc atgctggacc gctcgcttaa tgcgttgctt tatcaactat 1620

catgaagagc agaatatctt acttcgtcct ggacgcgttg gtggggtgtt atttcaagtc 1680

gcgttgagcc gttgctataa gatgttcgct acttccactc ctgcttcccc tctgtcattg 1740

ttcctcaagt cgttgttcgt tccttggatt gagtctgccc cactgttagc gaatctaacg 1800

ccaaatgagt cttctcgtgt gttagcatgg tatattcctt cctcgtactg gagcgacaat 1860

ggttggtgcg tttgtgacac tcatcgtcac gtcaccttct ccttcatccg cggtcttccc 1920

gccgacctgt cggtgttaga tctgtttgat tggtctcgat tccgcgcgac tataaacgtg 1980

gacacgtctc tcgtggagct aggcgcagac attcgtgcgg tcaaagtatc agtccattgg 2040

acatctcaga agcccactgt ggacgttttt gacaatcgtg cgcttttcac ccccttccag 2100

cactaccatt tgagtctcca ctgtaattgc gcacctggtc gacctttctt cgcgaagaac 2160

atgaagctat atttgtcgac ggtaggaggc gagcactga 2199

<210> 8

<211> 2208

<212> DNA

<213>M2 genetic fragments

<400> 8

accaccgaga tctacactct ttccctacac gacgctcttc cgatctcttt ctcacaagat 60

gggtaacgcg acgtctgttg tgcagaactt caatatccaa ggtgatggta atcattttgc 120

tccatctgct gagactactt catccgccgt accgtcatta tctttgaatc ccggactgtt 180

aaatccaggt ggtaaggcgt gggtcctgat tgatccatct ctaaatgctt ccgatccttc 240

atcactacgt ctgatgactt cggctgatct atcaacactt cctcgatctg ctactagtaa 300

ctctaccggg tttctcccca cttctggcat gtatgccatt gctactaagg agacgttgag 360

tgtaattact gagcacgcga tttcccagtt tgataagtta cagatggctt gtgagttgga 420

ccgcgattat ctggatgcta gaggtgtttc tcctgagtct gtgaatattc atagttatat 480

agcctacgtt gattgcttcg tgggtgtatc tgcaaggcag gctgcgtcaa attttaagcg 540

gcatgtgcca gttatcacca aatctcgtat gacacaattt atgacatccg cgcagaatat 600

gttgcaagtg cttgggccct gggaacgtga tgttcgtgag ttactcacta ttcttcctac 660

ttccactacc gctggtaaaa ttacgtgcga catgaagtct gttgtcgctt tcattgatga 720

tcagctctct gataccagtt tgtgtcgtct gtaccccgac tgtgctgctg cggcggtggc 780

tagacgtaat ggtggcattc gatggaagac acctgatact gacgaggctc cttcacttgc 840

aactaacgat attgctgctt caactatggg tacgcttgcg aatactacac cactggctga 900

gaagtcgaac tcgggcgagg agtcgatgcg cttggttagt gatgttggcg tggacatcgt 960

ttgttctcgt ggccccatca gttcttcagt ttggtcccgc acggttgaac ccaaatcgta 1020

caatattaga acccttcgtg tagaagaagc gctttggcta cgcgagtgcc aagcgactac 1080

tggttttgat gtacagtaca cgctgcccga ccagactaca cataagcatt tctggcttca 1140

gaaggggtca gtcgtcataa atcttgagca aacgggtagt atgatgttcg atgtgaacat 1200

agcgggtaaa gattacaaga agggcacctt taatcctgat aatcataaat tggtcctctt 1260

ggttatgcag tcaaagatcc ctttcgagtc ttggaccgtc gcttctcaaa ttactggtat 1320

cgctcaagtg gctgaggtca ctgtgcatgc tgctgatagt tcgactccta accaaaagat 1380

aatcggtgaa acttcgctgt cttatttatt tgagagggag acggtgacca catccaatac 1440

tgaagtcaat acatatctgt tgtgcacttg gcagcttgac gacgcgcaga gcaatgacgc 1500

aaacgcctgg ccagatgctt gggacgggat cacaacattg accccactta cgtccggtac 1560

tgtaaccatc aaggggactt cggtggattc tgtcgtaccg tctgatttag ttggtgctta 1620

tacacctgag gctttggctg ccgcgcttcc taacgacgct gggttaattt tggctaataa 1680

ggcaactaaa ttggctgacg ccatcaataa ggaggatgat tctgtgattg atgagtcttc 1740

tccctttagc acccccattc aaggagttct ggctgttcaa caacttgata ccgtggggac 1800

acgcggtaca cgtgcactcc agcctccatc cattctgaaa cgcatcgcct cacgagctct 1860

tcacatgttt cttggtgatc caaagtctat tctaaaacag gcgacgcccg tattgaggga 1920

ccctgacgtt tggaccggct ttgttcaagg tgttagagac ggcatccgga ctaagtcgct 1980

atccgctgga gtacggtccg tgtataataa cgttaccgcc acacagtctg tacaaacgtg 2040

gaaacagggg ttcctgacga aaatacagac gttgttcaag ccatcgtgag gtgctaaggc 2100

ctctctctgc ggcgggtcgg tgggcacgtc gtagtgacgc tgaatgcacg gggaggtgac 2160

gctccctgga ttggcaagat cggaagagcg tcgtgtaggg aaagagtg 2208

<210> 9

<211> 1996

<212> DNA

<213>M3 genetic fragments

<400> 9

gctttttgag tcctagcgtg gatcatggcg tcaaccaagt ggggagacaa gccgatgtcg 60

ctctcaatgt ctcacgatgg atcatctatc cgcagtgccg cctcacagtt tctgtcggtt 120

cccctgtctc actcaacgcc aatcccacct caacggaaga ccgtattgct gaaattcatg 180

atcggtgatg acctggttac cgtgcagggc gcgctcgctc cttttgatga atactggtac 240

gataaccaac ctctattgtc tcaagctgtt gagctgctcg cctctgagga tcgtctgcgt 300

caattcgagc attatgagaa gtttctactt aagaagggcc accaaattgc tgagatcatg 360

aataggctac gtcttttctt caccgacgtt ctcaaagtga agatggaagc tgatgctctt 420

ccttctctag ctcaatacct gatggctggt actttggatg ctgtctccac cgttcacgaa 480

cctgatgctt gtgttccagt cacttcaaaa atcatagcta agcagcagac tgtgtccaag 540

tcccctggac gtcttgctga agaggagtat aatgttatta gatcacgttt cctcactcat 600

gagatctttg acttaacgtc tgacttgccc ggtgttcaac cattcatgga tatgtactat 660

gccaccgttc ctcgtgccga ttccaccggt tggtgtgtct accgcagaaa aggtctattg 720

attcatgccc ctgatgagca atactcggat ctgactattt tcaccacccg tcttacggca 780

gcgcgtgagt tacagcttgt ggctggggag gtcgttgtgg cttgcttcga tcttatggat 840

atctctgata ttgctccatc tcatcatgca tcggttcaag aggaacgtac tctcggcact 900

agcaagtatt ccaacgttac agctaatgag catccgttgg tattcttttc acccaatgca 960

ttacgctggg caatagatca tgcctgtact gattccttga tttccactag gaatattcgg 1020

gtctgcgtcg gtattgaccc cttagtgacc agatggactc gcgatggcgt gcaggaggct 1080

gcaattctta tggatgacaa gctaccctca gcaggacgtg ctcggatggc tctacgaacc 1140

ttgcttctag cgcgtcgctc accaatgacg tccttcttac taggtgctct caagcagtcc 1200

ggtggtcagc taatggaaca ttatcgatgt gatgcggcta ataggtatgg atctcccacc 1260

attccagttt ctcaccctcc accgtgtcca aaatgtcctg agctgaaaga acagatcacc 1320

aaactttcgt cagctcctgc gcctaaagtt gactcgtccg ctggtcctgc cgtgctgttg 1380

tcgaagatcg ctgagctcca acgtgctaac cgagaactgt ccttgaagtt agtggacgtt 1440

cagccagccc gagaagacca ccttctagct tacctcaacg agcacgtatg tgttaacgct 1500

aaagatcacg agaaaggtct actagcccgt tgtaatgtct cgagtgattc aatcgccgct 1560

atccttggtc aacgtttgaa aaatcgagaa cggtttgaaa cgagactacg gcacgaggct 1620

ggtgcggagt gggagccacg agtggaagcg ttgaatcaag agttggctaa ggcgcgtatt 1680

gagcaacaag atatgatgac tcagtcctta cagtacctga atgaacgtga tgaactgctg 1740

cgcgaggtgg atgagctcaa acgcgaactg gctaccctac ggtttgctaa tgtgagacta 1800

aatgccgata accaccgcat gagtcgtgcg acccgtgttg gagatgtatt cgtcagtgat 1860

gttgatccct taccacccgg tcttcctggt gaatcgaaac catccattga agaactggta 1920

gatgatctgt gagctttgcc ttgtgactcg acttctctct gattccatgt acccacggcg 1980

gactcggcta ttcatc 1996

<210> 10

<211> 1644

<212> DNA

<213>S1 genetic fragments

<400> 10

gctttttcag tctcttgtat cgatgttccg tatgtcttcc ggttcatgca acggcgcgac 60

gtcaatattt ggtaacgtgc attgtcaagc ggcccaaaat accgcaggcg gagatcttca 120

agctacctcg tcattaattg cttattggcc ttatctcgct gctggtggtg gtctcattat 180

aattttaatt attgttatag gtataatctg ttgttgtaag gccaaagtta aggctgacgc 240

taccagaagt gtgttctatc gggagttgct tgctctgaac tcgggcaagt gtaatgcagc 300

acctccgtca tacgacgttt gatgtgcggc ggtttgagtt ttctccgacg gtgtttgaag 360

agtgtttgac tccatctttt accgctgtga ctgacactga ccctgtgagg tactttaata 420

ttgagcttcc gtcaactcac cgtctcctcc cttggcttcc cgttcttctg ttccaatcct 480

gtaaagtgca tgtttcttta gtacgtagat tctctttatg ctcgacttta tctgatattt 540

gtgagtacga ttgcaaattg cttccgtcta ttaacgctat tgtgtcgaat ccagtgtcga 600

gcgcggtttc atctatcgtc gttcactggg atggacggat taactcaaca gcagcgaaga 660

gaagtcgtgg ggttgatact gtcgttgact tcgagcgtga gtataagttc tggcgatttg 720

acgcaaattc gtgagcgtct ttccgctttg gaatctgcga ctgcgtcgct gaacgaatcc 780

gttaatacag ctttgtctag gttagtggat ttgtctgcat cgcttgataa cgtggcggcc 840

tcgttagcgg agacgaaagt ggaaatgaac tcactagttt ctgacgttca gggtttgcga 900

gcttcccttg actcttctgc ttcagagctg gcttctctat cttcattggt gcgtgatcac 960

ggctcttcga ttgctggcct acagagagaa gtaagtgcct tatcgagtga ggtaggcaac 1020

cttaaaacct cggtatcatc gcagggcctt cctatcacta gccttgagaa acgagtgcaa 1080

gctttagaag gtggttctag tacgactctg tcatttgctg atcctcttaa gttagaggct 1140

gggaccgtgt cactcgaggt agatccgtat ttctgctctg tgaatcgtaa tctgacgtcg 1200

tattctgctg atgctcagtt gatgcaattt cagtggtctg tgaaagggga agatggcgcg 1260

gccaactcta ttgatatgga cgtgaacgct cactctcatg gttcacgcac tgattatctg 1320

atgtcaacca agcaatcatt gactgttaca acgtctcccg ctactcttgt ctttgaactg 1380

gataggatta ttgctcttcc ctccgacctt tctcgcctaa ttccatgtta tggttttcag 1440

caagccactt ttcccgttga tatctccttc cagcgagatg gcgtttcgca tacgtatcaa 1500

gtctatggga agtacacatc ttctcgcgtc ttcaagacta cgttctcgcc tggctcctca 1560

ggtcccgcag tgattaagtt tttgaccgtg cgtacgggca tcgataccta aggtgtggcg 1620

ccgtacgggg gctggttatt catc 1644

<210> 11

<211> 1322

<212> DNA

<213>S2 genetic fragments

<400> 11

gggcgcgtgc cgtgtacgac ttcttttcta cgcctttcgg gaatcgtggt ctagcgacga 60

atcgtactca actatcatca ctactatcaa gctcgaattc cccatggcaa cgttttctat 120

catcaatgac tccattgaca gcgccgggca tcgtttcgac acctgaagca ccctatccag 180

gttcgttaat gtatcaagag tctatgctcc acagtgctac cgtccctgga gtacttggca 240

atcgcgacgc ttggcgtacg ttcaatgtct tcggactttc atggactgac gaaggactgt 300

caggactagt ggctacccaa gatcctcctc ccgccgcccc gtatcagcca gcctctgctc 360

agtggtcgga tcttctcaac taccccagat gggcaaacag acgtcgtgag ctgcaatcta 420

agtacccgct tctgcttcgc tccactctgc tctctgccat gcgagctggt cctgttctat 480

atgttgagac gtggccgaat atgatttctg gacgattagc tgattggttt atgtcccaat 540

atggcaataa tttcgttgac atgtgtgcta ggttgaccca gtcttgttcg aacatgcctg 600

ttgaacctga tgggaattat gatcaacaga tgcgtgcttt aattagtttg tggcttctgt 660

catacattgg ggtaatcaac caaaccaaca ccatcagcgg tttctacttc tcctcaaaga 720

ctcggggtca agcgttggac agttggactt tgttctatac cacgaatact aatcgtgtcc 780

aaattacgca gagacatttt gcttatgtgt gcgcccgatc tcctgattgg aacgtggaca 840

aatcatggat cgctgctgcg aacttaaccg ccattgttat ggcttgccgt caaccgccga 900

tgtttgctaa tcaaggcgtc attaatcagg cgcagaaccg acccggattc tccatgaatg 960

gggggacgcc cgtccacgag ctcaacttac ttactactgc gcaagagtgc atcaggcagt 1020

gggtggtagc aggcttggtg tcggcagcaa aggggcaagc actaacgcag gaagctaatg 1080

acttctcaaa cctcatccag gcggatctag gccagatcaa ggcgcaggac gacgctttgt 1140

acaatcagca gccgggatac gcgaggagaa taaaaccttt cgttaatggt gactggacac 1200

caggtatgac cgctcaagct ctggccgttc tagccacttt taccgcctag gcgtagggtc 1260

gtacgctgcc cgagtccagc cctccggcag cccgtggaga tcggacgagc gtcgtgtagg 1320

ga 1322

<210> 12

<211> 1202

<212> DNA

<213>S3 genetic fragments

<400> 12

gctttttgag tccttagcgt gcaagccgca atggaggtac gtgtgccaaa ctttcactcg 60

ttcgttgaag gaataacatc tagctacttg aagactcctg cttgctggaa tgcacaaaca 120

gcttgggata ctgtgacctt tcacgtccct gatgtaatta gagttggtaa cgcctactgt 180

tgttctcaat gttgtggtgt actctactac gggactctgc cctcggacgg taattatttc 240

cctcatcaca agtgtcatca gcaacagttt aggactgata ctccactgct tcgatacgtg 300

cgcattggta gaaccactga gcatctgatg gatcaatatg ctgtcgctct ggagtccatt 360

gctgaacact atgacgagat tagtcaacgt atggtcgatg agccagagaa tgacgaggtt 420

acacctcttg atatcgttac gcgtaccgaa tctatcagga gtgacaaggc agtcgaccca 480

gacttttgga catacccact tgagcggcgt tctgatgatt ctcgtagaga catcgcctca 540

gcatgctgga aaatgattga cgcgtcggcg cgtagtctca ctcttccaaa ttgcctcgtc 600

tccccctctt tgcactctcg ctccgtcttt ggtcagatgc aaacgaccac cactatatac 660

gatgttgcgg catcgggaaa ggccgttaag ttttcaccaa tggttgctac actagcgcaa 720

cgtgatgctg gccctgtaat gcttgcgaat gctgacccgg cggaaggcgt gtactctttc 780

tggacgtcgc acttcgcttt ctcaccgctc atcggcggag ttggaattac gggacagtac 840

gctcgtgagt cgtaccatca agtgggtcat ccagtgattg ggagtggtaa gaaggcatcg 900

cattacagga atctgttcat ggaagcgtgg cgcgggtggt cgaagtcagc tttcgcatgt 960

gctactggaa tggagccagc tgaatgtgaa tctcgtctga gaggacacgc tcgtactatg 1020

ctcggacgct ctctgccgcc cgtttgtgac gatgatgttg ctcagcagtc tggcgcggta 1080

ctgacttcgc tgcagaaaac gaacaagttc accgttgtgg agtgtggttg gtaagtacct 1140

ccgggtcaaa atgcacatag gctcccacct atgtgacggt tagcgggact cgcctattca 1200

tc 1202

<210> 13

<211> 1192

<212> DNA

<213>S4 genetic fragments

<400> 13

gctttttgag tccttgcgca gccatggaca acaccgtgcg tgttggagtt tcccgcaaca 60

catccggcgc agctggtcag actgttttta gaaactttta cttactacga tgcaatatct 120

cagctgacgg tcgtaatgca acaaaagctg tgcaatccca ttttccattc ctttctcgtg 180

ctgtccgttg cctatctcct ctagccgctc attgtgctga taggactctt cgtcgtgaca 240

atgtgaaaca aattcttact cgtgagctgc catttccatc ggatttaatc aattacgcac 300

atcatgtgaa ctcatcctcc cttactactt ctcagggtgt cgaggcggca cgtctagtgg 360

cccaagtcta tggagaacag ctatcgtttg atcacattta tcccactggt tccgcaactt 420

actgccctgg agcgattgct aatgcgattt cccgtatcat ggctggtttt gtgccccacg 480

aaggtgacaa ctttaccccg gacggttcta ttgactatct cgccgccgac ctggtcgcgt 540

ataagttcgt gctcccttac atgctagata ttgtggacgg acgtccgcag attgttcttc 600

catcacacac tgttgaggag atgctgtcca acacgagttt gcttaattcg attgacgctt 660

catttggtat tgaatcgaag agcgatcaac gcatgacccg tgacgcggct gaaatgagtt 720

ctcgctcact taatgagctt gaggatcatg agcagagggg tcgaatgcct tggaaaatca 780

tgacggcaat gttcgcggcg caattgaagg tggagttgga cgccctagct gatgagcgcg 840

ttgaatctca ggctaacgct catgtgacat cttttgggtc tcgtctgttc aaccaaatgt 900

ctgcttttgt cccaattgat cgtgagttga tggagctggc tctactcatc aaagagcagg 960

gtttcgcaat gaatccaggg caagtcgcat ctaaatggtc gctgatacga cgatctggcc 1020

ccactcgccc gctatcaggc gcacgccttg agatcaggaa tggcaactgg acaattcgtg 1080

aaggtgacca gacgcttctg tctgtctccc cagctaggat ggcgtaaacg ggacccatgg 1140

tgcgggtgag gggccgccac accctctgcc gcgacctgga ctcttattca tc 1192

<210> 14

<211> 80

<212> DNA

<213>Artificial sequence

<400> 14

attatccatt ttgagatcca cggatcgtgt cctcgttgta cctacagcac gtgtatatgt 60

tggttgcttt cctagcgctt 80

Claims (10)

1. one group of primer and probe, which is characterized in that the nucleotide sequence of the primer such as SEQ ID NO.1-SEQ ID NO.2 It is shown；The nucleotide sequence of the probe is as shown in SEQ ID NO.3.

2. primer and probe described in claim 1 answering in the reagent or kit for preparing detection novel duck reovirus With；The deposit number of the novel duck reovirus is CCTCC NO：V201818.

3. a kind of PCR kit for fluorescence quantitative of detection novel duck reovirus, which is characterized in that the quantitative fluorescent PCR Kit contains primer and probe described in claim 1.

4. PCR kit for fluorescence quantitative according to claim 3, which is characterized in that in the PCR kit for fluorescence quantitative Further include：Standard items and quantitative fluorescent PCR reaction reagent.

5. PCR kit for fluorescence quantitative according to claim 4, which is characterized in that the standard items are made by the following method It is standby to form：

Use primer amplification deposit number shown in SEQ ID NO.1-SEQ ID NO.2 for CCTCC NO：The duck of V201818 exhales The genome of the lonely virus of intestines, obtains amplified production, amplified production is connected on pMD18-T carriers, screening positive clone simultaneously carries Plasmid DNA is taken, that is, standard items are prepared.

6. PCR kit for fluorescence quantitative according to claim 4, which is characterized in that the quantitative fluorescent PCR reaction reagent Including：One Step RT-PCR Buffer, TaKaRa Ex Taq HS, II and of PrimeScript RT Enzyme Mix ROX reference dyes.

7. a kind of detection reagent of detection novel duck reovirus, which is characterized in that the detection reagent contains claim 1 The primer and probe；The deposit number of the novel duck reovirus is CCTCC NO：V201818.

8. the detection reagent described in claim 3-6 any one of them PCR kit for fluorescence quantitative or claim 7 is as follows (1) in-(3) it is any in application：

(1) novel reovirus is infected to duck and carries out epidemiological survey；

(2) the novel duck reovirus pollution in blood or serum product is monitored；

(3) novel duck reovirus copy number is accurately detected, the progression of infection of duck reovirus is specified.

9. a kind of detecting novel duck reovirus using claim 3-6 any one of them PCR kit for fluorescence quantitative Method includes the following steps：

(1) standard items are subjected to gradient dilution, carry out TaqMan Fluorescence PCRs later, according to the concentration of positive criteria product and Ct values draw fluorescent quantitation standard curve；

(2) sample to be tested total serum IgE is extracted, TaqMan Fluorescence PCRs are carried out, collects sample to be tested fluorescence signal, fluorescence is believed Number data processing is carried out, obtains Ct values and amplification curve, qualitative and quantitative detection is carried out to sample to be tested；

Preferably, in step (1) and step (2), the program of TaqMan Fluorescence PCRs is：

42℃5min；95℃10s；95 DEG C of 5s later, 60 DEG C of 34s, 40 cycles.

10. deposit number is CCTCC NO：The duck reovirus of V201818 leads to the duck of duck gambrel swelling in preparation detection Application in the PCR kit for fluorescence quantitative of reovirus.