CN106676200A - RT-LAMP nucleic acid test strip kit and application - Google Patents
RT-LAMP nucleic acid test strip kit and application Download PDFInfo
- Publication number
- CN106676200A CN106676200A CN201710041100.2A CN201710041100A CN106676200A CN 106676200 A CN106676200 A CN 106676200A CN 201710041100 A CN201710041100 A CN 201710041100A CN 106676200 A CN106676200 A CN 106676200A
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- concentration
- primer
- lamp
- acid test
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an RT-LAMP nucleic acid test strip kit and application. The nucleic acid test strip kit comprises a primer group, a nucleic acid test strip, magnesium sulfate, betaine, dNTPs, AMV reverse transcriptase, Bst polymerase, a buffer solution and an RNA template. By adopting the method of combining an RT-LAMP technology and a nucleic acid test strip detection technology, novel duck reovirus can be quickly and efficiently detected by using a simple experimental apparatus, the false positive problem in RT-LAMP product detection is solved, the RT-LAMP nucleic acid test strip kit is not only convenient and fast and high in specificity, is about 100 times higher than conventional RT-PCR in sensitivity, is beneficial to popularization and application of a nucleic acid test strip method, and can meet clinical and fast field test requirements.
Description
Technical field
The present invention relates to biological technical field, more particularly to a kind of RT-LAMP nucleic acid test-strip kit and application.
Background technology
Glynou etc. by spray respectively in the nature controlling line of immuno-chromatographic test paper strip and detection line Streptavidin and
PolyA, accelerates reaction of the product on solid phase carrier film, when the glue for being marked with polyT using biotin-avidin amplification system
When body gold hybridizes with the amplified production with polyA in test strips, a large amount of colloid gold particles are enriched at detection line and develop the color, i.e.,
Sentence read result (Glynou et al, 2003) can with the naked eye be carried out.Cater etc. establishes nucleic acid test strip technology, and by examination
Checking understands that this technology has sensitiveness higher.Spy can be detected in complicated mixtures of nucleic acids by nucleic acid test strip
Fixed molecular label, detection consumption as little as 250Amol.This nucleic acid test strip technology reduces the consumption of reagent in traditional detection
With detection time (Carter et al, 2007), be conducive to the popularization and application in basic unit is detected.
Novel duck reovirus (NDRV) disease, is caused by segmented dsRNA viruses, irregularly bad with liver
Extremely, bleeding spot and cardiac muscle, bursa of farbricius bleeding are the new epidemic disease of cardinal symptom.At present, the detection method viral to this has various,
But all there is certain defect：Serology test sensitivity as conventional is not high enough；PCR (PCR) method is needed
Want expensive PCR instrument device, operating condition is harsh and operating process is complicated, detection time is long, it is impossible to meet live and basic unit quick
Detection needs；Reverse transcription loop-mediated isothermal amplification technique (RT-LAMP) method for quick of existing novel duck reovirus
Easily there is false positive issue.
Therefore, prior art has yet to be improved and developed.
The content of the invention
In view of above-mentioned the deficiencies in the prior art, it is an object of the invention to provide a kind of detection of RT-LAMP nucleic acid test-strip
Method and application, it is intended to solve existing novel duck reovirus detection method detection sensitivity not high, it is necessary to large-scale instrument
And easily there is the problem of false positive in complex operation and testing result.
Technical scheme is as follows：
A kind of RT-LAMP nucleic acid test-strip kit, wherein, including following primer sets and nucleic acid detection test strip:
The nucleotide sequence of the primer sets is as follows：
Outer primer：F3：5’-CGTGGATGGTCAAAGTCGT-3’；
B3：5’-ACCTACACTCCAGGAAGGAC-3’；
Inner primer：FIP：
5-Biotin-TAGTTCTGGCATGGCCTCGC-CTTTACATGTGCTGCAGGGA-3’；
BIP：
5-Fitc-TGTTCGGACGTTCTCTTCCGGA-TTTAATGGCGCGGACGAC-3’；
Ring primer：LoopF：5’-AGCCTAGATTCGCACTCCG-3’；
LoopB：5’-CGAGGAGACTACCCACGTT-3’.
Described RT-LAMP nucleic acid test-strip kit, wherein, with biotin and fluorescein to above-mentioned primer sets in draw
Thing is marked.
Described RT-LAMP nucleic acid test-strip kit, wherein, also include：Magnesium sulfate, glycine betaine, dNTPs, AMV reversion
Record enzyme, Bst polymerases, buffer solution.
Described RT-LAMP nucleic acid test-strip kit, wherein, the initial reaction system of RT-LAMP reactions includes：Concentration
For the magnesium sulfate of 100mmol/L, concentration be the glycine betaine of 5mmol/L, concentration be the dNTPs of 2.5mmol/L, concentration be 10U/ μ L
AMV reverse transcriptase, concentration be the Bst polymerases of 8U/ μ L, the addition of RNase-free water be 3.7 μ L, buffer solution
Addition is that 2.5 μ L, the concentration of outer primer are that 10 μm of ol/L, the concentration of ring primer are that 10 μm of ol/L, the concentration of inner primer are 10 μ
mol/L。
The application of described RT-LAMP nucleic acid test-strip kit, wherein, comprise the steps of：
(1) RT-LAMP reaction systems are configured：By final concentration calculate, concentration be the magnesium sulfate of 0~6mmol/L, concentration be 0
The AMV reversions that the glycine betaine of~1.5mmol/L, concentration are the dNTPs of 0.2~0.7mmol/L, concentration is 0.06~0.16U/ μ L
Record enzyme, concentration are that the Bst polymerases of 0.08~0.48U/ μ L, RNase-free water complement to the cumulative volume of reaction system
The final concentration ratio of 25 μ L, 0~16% that the addition of buffer solution is reaction system cumulative volume, inner primer and outer primer is 2:1~
12:1st, the final concentration ratio of ring primer and outer primer is 0~6:1st, the addition of testing sample RNA is 2 μ L；
(2) react：By the reaction system isothermal reaction in step (1), then reacted product is tried with detection of nucleic acids
Paper slip detection, reads testing result after 10~30min；
(3) testing result interpretation：
It is negative：When the band that nucleic acid detection test strip is located at quality control region takes on a red color, when detection zone is without band, then show to be measured
Target is not by novel duck reovirus infection；
It is positive：When there are being located at respectively two red stripes of quality control region and detection zone in nucleic acid detection test strip, then table
Bright target to be measured is by novel duck reovirus infection；
It is invalid：When nucleic acid detection test strip quality control region and detection zone band do not occur, then show that detection process is invalid.
The application of described RT-LAMP nucleic acid test-strip kit, wherein, in step (1), final concentration of 2.0 μ of inner primer
Mol/L, the final concentration of 0.2 μm of ol/L of outer primer, final concentration of 0.8 μm of ol/L of ring primer.
The application of described RT-LAMP nucleic acid test-strip kit, wherein, in step (1), magnesium sulfate it is final concentration of
3mmol/L, final concentration of 0.3mmol/L, AMV reverse transcriptase of final concentration of 0.5mmol/L, dNTPs of glycine betaine end it is dense
It is 0.14U/ μ L, Bst polymerases final concentration of 0.32U/ μ L to spend.
The application of described RT-LAMP nucleic acid test-strip kit, wherein, the temperature of the isothermal reaction in above-mentioned steps (2)
Spend is 59~66 DEG C.
The application of described RT-LAMP nucleic acid test-strip kit, wherein, isothermal reaction in above-mentioned steps (2) when
Between be 10~60min.
The application of described RT-LAMP nucleic acid test-strip kit, wherein, the isothermal reaction condition in above-mentioned steps (2)
It is 65 DEG C of reaction 50min.
Beneficial effect：The invention provides a kind of RT-LAMP nucleic acid test-strip kit and application, set by online primer
Meter Software for Design and the RT-LAMP reaction primer sets for having filtered out the good novel duck reovirus of a set of specificity, this is drawn
Thing group is applied in RT-LAMP reactions, and the reacted products of RT-LAMP is detected with nucleic acid test strip, the detection side
Method is simple and easy to apply, testing result fast response time and detection sensitivity is high, and specificity is good, can be prevented effectively from false positive inspection
Survey the generation of result.
Brief description of the drawings
Fig. 1 is that primer specificity testing result figure is identified in digestion of the present invention, wherein：
Swimming lane M is 2000bp DNA Marker, swimming lane 1 is digestion products, swimming lane 2 is for positive, swimming lane 3 is ddH2O is negative
The product for obtaining.
Fig. 2 is RT-LAMP reaction temperatures optimum results figure of the present invention, wherein：
Swimming lane M be 2000bp DNA Marker, swimming lane 1~9 be respectively 66 DEG C, 65 DEG C, 64 DEG C, 63 DEG C, 62 DEG C, 61 DEG C,
60℃、59℃、ddH2The product that O feminine genders are obtained.
Fig. 3 is RT-LAMP reaction time optimum results figure of the present invention, wherein：
Swimming lane M be 2000bp DNA Marker, swimming lane 1~7 be respectively 10min, 20min, 30min, 40min, 50min,
60min、ddH2The product that O feminine genders are obtained.
Fig. 4 is magnesium sulfate concentration optimum results figure in RT-LAMP reaction systems of the present invention, wherein：
Swimming lane M is 2000bp DNA Marker, swimming lane 1~8 respectively 0mmol/L, 1mmol/L, 2mmol/L, 3mmol/
L、4mmol/L、5mmol/L、6mmol/L、ddH2The product that O feminine genders are obtained.
Fig. 5 is glycine betaine concentration optimization result figure in RT-LAMP reaction systems of the present invention, wherein：
Swimming lane M be 2000bp DNA Marker, swimming lane 1~5 be respectively 0mmol/L, 0.5mmol/L, 1.0mmol/L,
1.5mmol/L、ddH2The product that O feminine genders are obtained.
Fig. 6 is dNTPs concentration optimization result figures in RT-LAMP reaction systems of the present invention, wherein：
Swimming lane M be 2000bp DNA Marker, swimming lane 1~7 be respectively 0.2mmol/L, 0.3mmol/L, 0.4mmol/L,
0.5mmol/L、0.6mmol/L、0.7mmol/L、ddH2The product that O feminine genders are obtained.
Fig. 7 is AMV enzyme concentration optimum results figures in RT-LAMP reaction systems of the present invention, wherein：
Swimming lane M be 2000bp DNA Marker, swimming lane 1~7 be respectively 0.06U/ μ L, 0.08U/ μ L, 0.1U/ μ L,
0.12U/μL、0.14U/μL、0.16U/μL、ddH2The product that O feminine genders are obtained.
Fig. 8 is Bst polymerase concentration optimum results figures in RT-LAMP reaction systems of the present invention, wherein：
Swimming lane M be 2000bp DNA Marker, swimming lane 1~7 be respectively 0.08U/ μ L, 0.16U/ μ L, 0.24U/ μ L,
0.32U/μL、0.4U/μL、0.48U/μL、ddH2The product that O feminine genders are obtained.
Fig. 9 is the volumetric concentration optimum results figure of buffer solution in RT-LAMP reaction systems of the present invention, wherein：
Swimming lane M be 2000bp DNA Marker, swimming lane 1~7 be respectively 0%, 4%, 8%, 10%, 12%, 16%,
ddH2The product that O feminine genders are obtained.
Figure 10 is inner primer and outer primer ratio optimization result figure in RT-LAMP reaction systems of the present invention, wherein：Swimming lane M
For 2000bp DNA Marker, swimming lane 1~7 are respectively 0.4 μm of ol/L of inner primer, 0.2 μm of ol/L of outer primer；The μ of inner primer 0.8
Mol/L, 0.2 μm of ol/L of outer primer；1.2 μm of ol/L of inner primer, 0.2 μm of ol/L of outer primer；Inner primer 1.6 μm of ol/L, outer primers
0.2μmol/L；2.0 μm of ol/L of inner primer, 0.2 μm of ol/L of outer primer；2.4 μm of ol/L of inner primer, 0.2 μm of ol/L of outer primer；
The product that ddH2O feminine genders are obtained.
Figure 11 is RT-LAMP reaction systems middle ring primer of the present invention and outer primer ratio optimization result figure, wherein：Swimming lane M
For 2000bp DNA Marker, swimming lane 1~8 are respectively 0 μm of ol/L of ring primer, 0.2 μm of ol/L of outer primer；The μ of ring primer 0.2
Mol/L, 0.2 μm of ol/L of outer primer；0.4 μm of ol/L of ring primer, 0.2 μm of ol/L of outer primer；Ring primer 0.6 μm of ol/L, outer primer
0.2μmol/L；0.8 μm of ol/L of ring primer, 0.2 μm of ol/L of outer primer；1.0 μm of ol/L of ring primer, 0.2 μm of ol/L of outer primer；Ring
1.2 μm of ol/L of primer, 0.2 μm of ol/L of outer primer；The product that ddH2O feminine genders are obtained.
Figure 12 A are the RNA sensitivity Detection result figures of extracting in the present invention, wherein：
Swimming lane M be 2000bp DNA Marker, swimming lane 1~8 in rna content be 2ng, 200pg, 20pg, 2pg, 200fg,
20fg、2fg、ddH2The product that O feminine genders are obtained.
Figure 12 B are positives plasmid sensitivity Detection result figure of the invention, wherein：
Swimming lane M be 2000bp DNA Marker, the positives plasmid content of swimming lane 1~8 be 2ng, 200pg, 20pg, 2pg,
200fg、20fg、2fg、ddH2The product that O feminine genders are obtained.
Figure 12 C are amplifying nucleic acid test strips sensitivity Detection result figure of the present invention, wherein：
The positives plasmid content of kit 1~8 is 2ng, 200pg, 20pg, 2pg, 200fg, 20fg, 2fg, ddH2O is negative
The product for obtaining.
Specific embodiment
The present invention provides a kind of RT-LAMP nucleic acid test-strip kit and application, to make the purpose of the present invention, technical scheme
And effect is clearer, clear and definite, the present invention is described in more detail below.It should be appreciated that specific implementation described herein
Example is only used to explain the present invention, is not intended to limit the present invention.
In the examples below, primer sets are synthesized by Shanghai Sheng Gong biotechnologies service company；Novel duck exhales intestines lonely
Viral QY plants (DRV-QY), a kind duck exhale intestines orphan's strain (MDRV), fowl to exhale intestines orphan's strain (ARV) and duck plague vaccine (DPV), duck hepatitis
Vaccine (DHAV), duck NDV (NDV), avian influenza virus (H9+H5) vaccine, bird flu (H7) vaccine, duck Tan Busu diseases
Strain such as malicious (DTMUV) is preserved and provided by Foshan Science ＆. Technology College's prevention veterinary laboratories；Bst DNA large fragments are gathered
Synthase, 10 × thermopol Buffer (buffer solution carried in Bst DNA Large fragment polymerase kits), AMV reverse transcriptions
Enzyme, dNTPs, magnesium sulfate are purchased from NEB companies, and glycine betaine (Betaine) is purchased from Sigma companies, Trizol Reagent reagents
Box, RRI, Random Primer, Ex-Taq archaeal dna polymerase, agarose are purchased from Takara companies, isoamyl alcohol, absolute ethyl alcohol etc.
It is domestic AR, disposable closed nucleic acid detection apparatus are purchased from Yousida Biological Technology Co., Ltd., Hangzhou.
Embodiment 1：Design of primers
Design of primers principle is reacted according to RT-LAMP, with QY plants of sigmaB gene order of novel duck reovirus to set
Meter template (total length 1104bp), some set primers are designed using the online primer-design software Primer Explorer4 of LAMP,
Primer is screened using Larsergene7.0PrimerSelect and Oligo7.0, and using Primer-BLAST retrievals
The specificity of designed primer, finally filters out a set of preferable primer and a set of alternative primer, and primer is by Shanghai life work biology work
Journey Technology Service Co., Ltd synthesizes, and in primer building-up process, uses biotin and fluorescein to be marked to it, is easy to
It is follow-up result is detected using novel duck reovirus RT-LAMP nucleic acid test paper.By default experiment from above-mentioned synthesis
Two sets of primers in, screening verification goes out a set of optimal primer, and the optimal primer for obtaining is as follows：
The novel duck reovirus RT-LAMP nucleic acid test-strip method primer of table 1
Position of the novel duck reovirus RT-LAMP nucleic acid test-strip method primer in gene is as follows：
Note：Plus four " CCGG " bases of double underline are the restriction enzyme site of the enzymes of Hpa II, FIP is by F1c (the complementary sequences of F1
Row) and F2 sequences constitute, BIP is made up of B1c and B2 (complementary series of B2c) sequence.
Embodiment 2：Strain is extracted
(1) fluid sample of 250 QY plants of μ L novel duck reoviruses is added in the Ep pipes of 1.5ml, adds 750 μ L
With the Trizol Reagent reagents of ice cube precooling, 5min is stored at room temperature after acutely concussion mixes (under 50)；
(2) 200 μ L chloroforms are added, reverse Ep pipes are mixed twice, and acutely concussion mixes (under 15) again, makes liquid
Fully mix and be stored at room temperature 5min in after milky white shape (no phase separation phenomenon)；
Under the conditions of (3) 4 DEG C, 15min is centrifuged with the rotating speed of 12000r/min, upper strata aqueous phase (500 μ L) is transferred to one
In new 1.5ml Ep pipes, and isometric isopropanol is added, 4 DEG C of refrigerator 15min are placed in after mixing；
Under the conditions of (4) 4 DEG C, after 15min is centrifuged by above-mentioned 12000r/min, whole supernatants are removed carefully and as much as possible
Night；
(5) 5min is stored at room temperature after washing RNA precipitate and tube wall with the ethanol of 1ml 75%, under the conditions of 4 DEG C, with
The rotating speed centrifugation 10min of 12000r/min；
(6) liquid in Ep pipes carefully is discarded, after RNA precipitate is dried (can not be completely dried) into treatment, adds 15 μ L
RNase-Free Water dissolve RNA, carry out mark and in -20 DEG C of preservations.
Embodiment 3：The structure of positive plasmid
1st, reverse transcription of viral RNA
According to Reverse Transcriptase M-MLV (RNase H-) operation instructions carry out.Step is as follows：
(1) RT reaction solutions are prepared in following components：
(2) after above each component is mixed, being placed in carries out reverse transcription in PCR, program is：30 DEG C, 10min, then 42 DEG C
Effect 1h, 70 DEG C of insulation 15min.Product preserves or enters immediately performing PCR amplification in -20 DEG C.
2nd, PCR amplifications
Carried out with reference to the operation instructions of precious bioengineering Co., Ltd Ex Taq polymerases.According to Yuan Yuanhua etc. (2013)
The reaction PCR primer set up：
S3-F:GCTTTTTGAGTCCTCAGCGTG；
S3-R：GATGAATAGGCGAGTCCCGC.
Reaction system：The μ L of Primix Ex TaqTM enzymes 12.5, concentration is (i.e. described to draw outward 10 μm of sense primers of ol/L
Thing S3-F), each μ L of 1 μ L, CDNA template 2 of anti-sense primer (i.e. described outer primer S3-R), plus three steam aqua sterilisa to cumulative volume be 25 μ
L.After each component mixes brief centrifugation, following procedure is performed in thermograde PCR instrument：94℃4min；94 DEG C of 30s, 55 DEG C
45s, 72 DEG C of 60s；Carry out 30 circulations, last 72 DEG C of extensions 10min.
3rd, agarose gel electrophoresis
After PCR terminates, taking 5 μ LPCR products carries out electrophoresis, while using DL2000Marker as reference, the agar of preparation
The concentration of sugared gel is 1.0%, is nucleic acid staining agent with Gold view, and 1xTAE is set to as electrophoretic buffer, electrophoresis apparatus
100V voltages, electrophoresis 25min after electrophoresis terminates, observes under gel imaging system, takes pictures and preserve.
4th, the purifying of PCR primer
According to the operation instructions of Takara companies gel DNA QIAquick Gel Extraction Kits, purpose fragment is purified and reclaims, step is such as
Under：
(1) Ago-Gel containing DNA fragmentation is cut under uviol lamp, is transferred to a 1.5mL centrifugation provided for oneself
Guan Zhong；
(2) gel weight for cutting is weighed, adds 3 times of BufferG of volume (to be scaled 1uL gelinites per 1mg gels
Product)；
(3) 50 DEG C of water-baths of centrifuge tube of gel be will be equipped with until gel is completely dissolved (about 5-10min)；
(4) 1 times of isopropanol of gel volume is added, is well mixed；
(5) sol solutionses are transferred to (nucleic acid purification post is placed in 2mL centrifuge tubes) in nucleic acid purification post, 12000 × g centrifugations
30s；
(6) filtrate abandoned in 2ml centrifuge tubes, during nucleic acid purification post put back into 2mL centrifuge tubes, adds 500 μ L Buffer
G, covers lid, 12000 × g centrifugations 30s；
(7) filtrate abandoned in 2mL centrifuge tubes, during nucleic acid purification post put back into 2mL centrifuge tubes, adds 700 μ L Buffer
WG, covers lid, 12000 × g centrifugations 30s.Repeat step 7) once；
(8) filtrate abandoned in 2mL centrifuge tubes, during nucleic acid purification post put back into 2mL centrifuge tubes, 14000 × g centrifugations
1min；
(9) 2ml centrifuge tubes are abandoned, nucleic acid purification post is placed in a 1.5mL centrifuge tube for cleaning (kit offer),
The film center of purification column adds 25~30 μ L Buffer TE, covers lid, is stored at room temperature 1min, and 12000 × g centrifugations 30s is washed
De- DNA；
(10) purification column is abandoned, the DNA of wash-out can be immediately available for various molecular biology experiments；Or DNA is stored in -20
It is DEG C standby.
5th, coupled reaction
Kit is connected using Takara companies PMD18-T carriers, reaction system cumulative volume is that 5ul is as follows：PCR purifying is produced
The μ L of thing 2.25 μ L, 2 × Ligase Buffer (Ligation Solution I) 2.5 μ L, pMD18-T Vector 0.25.
Operated on ice chest, by one PCR pipe of sterilizing of any of the above reaction reagent addition, after adding mixing, 16 DEG C act on 5~6h.
If wouldn't convert, connection product can be stored in -20 DEG C about one month.
6th, the preparation of competent cell
The DH5a bacterial strains that laboratory is preserved are inverted in overnight incubation in incubator in the flat lining outs of LB；From growth
There is one single bacterium colony of picking on the flat board of bacillus coli DH 5 alpha, be inoculated in 2mLLB fluid nutrient mediums, 37 DEG C of 200r/min vibrations
Overnight incubation, as one-level culture.
One-level culture is pressed 1:50 ratios are aseptic to be transferred in 5mLLB fluid nutrient mediums, 37 DEG C of 200r/min vibration trainings
About 2h~3h is supported, two grades of cultures are carried out, makes the OD of bacterium600Reach 0.5 or so.
To be dispensed into aseptic 1.5mL centrifuge tubes after cultured bacterium solution ice bath 30min, 4 DEG C of 4000r/min centrifugations
10min, abandons supernatant.
Add the 0.1mol/L CaCl of 1mL ice precoolings2Resuspended precipitation, continues ice bath 15min~30min, 4 DEG C of 4000r/
Min is centrifuged 10min, abandons supernatant.
The ice-cold 0.1mol/L CaCl of 200 μ l are added in precipitation2It is gently resuspended.The competent cell of suspension can be straight
Connect for converting, to preserve, then need to add sterile glycerol to final concentration of 15%, packing 100 μ L/ pipes, -70 DEG C of preservations are standby
With.
7th, the conversion of recombinant plasmid
The DH5 α competent cells of preparation are taken, the μ L of connection product 5 are added, gently mixed, ice bath 30min.And set simultaneously
Positive controls (pMD18-T from ring plasmid) and negative control group (being added without the competent cell of any DNA).
42 DEG C of water-bath heat shock 90s, then 10min on ice is put back to rapidly.
The fresh LB fluid nutrient mediums of 400 μ L are added, after 37 DEG C of 200r/min-220r/min shaken cultivations 45min, to recover
The resistance of plasmid.
4 DEG C of 4000r/min are centrifuged 5min, the μ L of supernatant discarded 400, and ammonia benzyl LB fine jades are applied after remaining 100 μ L bacterium solutions are mixed
Fat flat board, 37 DEG C of cultures 30min (plate is just put) treat that bacterium solution absorbs complete, then plate is inverted into culture about 12h-16h, to list
Bacterium colony occurs.
8th, the screening and identification of transformed bacteria
It is inoculated in the LB meat soups containing AMP (100ug/mL) with the disinfection inoculation ring picking doubtful transformant single bacterium colony of white,
37 DEG C of shaken cultivation 4-6h, carry out bacterium colony PCR identifications.Wherein, PCR reaction systems are Primix Ex TaqTM12.5 μ L, upstream
Primer and each 1 μ L of anti-sense primer, the μ L of bacterium solution 2, sterilize the μ L of distilled water 8.5, after solution is mixed, enters performing PCR.
9th, Sequence analysis
The bacterium solution of the positive is accredited as through PCR, the sequencing of Shanghai bioengineering Co., Ltd is sent to.With the sequence that obtains of sequencing and
DRV-QY plants of corresponding sequence compares, if result is coincide, the positive bacteria plasmid of extracting uses spectrophotometric determination
Its OD value, plasmid concentration C=50 × A × n (50 is calculated by formula：1 double-strand of OD260 values expression 50ug/ml under 260nm
DNA；A：Absorbance OD260 values；n：Extension rate).
Embodiment 4：Primer specificity is identified in digestion
Base in the primer that the present invention is filtered out in the presence of " CCGG " is the restriction enzyme site of the enzymes of Hpa II, can be to RT-LAMP
The specificity of the product that reaction amplification is obtained is identified.After carrying out digestion to RT-LAMP product with the enzymes of Hpa II, to producing
Thing carries out 2% agarose gel electrophoresis detection, as a result as shown in Figure 1, it can be seen that be only close in 100bp~250bp scopes
There is digestion band at 100bp (127bp and 114bp) place, and this is consistent with two stripe sizes of budget, shows that the present invention filters out
Primer specificity is preferable.
The novel duck reovirus RT-LAMP nucleic acid test-strip detection method initial reaction system of table 2 and reaction condition
Note：1st, the buffer solution used in the present invention is times concentration buffer liquid of 10 × thermopol buffer, i.e., 10.
2nd, the present invention is in the optimization process of reaction condition and reaction system, the determination of optimum reaction condition and reaction system
Method is：2% agarose gel electrophoresis detection is carried out to product, electrophoretic band is brighter, then novel duck is exhaled in showing product
Intestines orphan's viral level is higher.
Embodiment 6：The optimization of reaction condition
1st, the optimization of reaction temperature
On the basis of the initial reaction condition and reaction system of above-mentioned table 2, design 59 DEG C, 60 DEG C, 61 DEG C, 62 DEG C, 63
DEG C, 64 DEG C, 65 DEG C, 66 DEG C, 8 thermogrades carry out RT-LAMP reactions.Each reaction is repeated 3 times the above, and product is used
2% agarose gel electrophoresis is detected, as a result as shown in fig. 2, it can be seen that carrying out RT-LAMP product at 65 DEG C
2% agarose gel electrophoresis band brightness is maximum, then show that 65 DEG C is the optimal reaction temperature of RT-LAMP reactions.
2nd, the optimization in reaction time
On the basis of the initial reaction condition and reaction system of above-mentioned table 2 and the reaction temperature of optimization, design 10min,
20min, 30min, 40min, 50min, 60min, 6 time gradients carry out RT-LAMP reactions.Each reaction is at least repeated 3 times,
Product is detected with 2% agarose gel electrophoresis, as a result fig. 3, it is shown that carrying out RT-LAMP reactions
After 50min, 2% agarose gel electrophoresis band brightness of product is maximum, then show that optimum reacting time is 50min.
Embodiment 7：The optimization of reaction system
1st, magnesium sulfate concentration optimization
On the basis of reaction condition after the initial reaction system of above-mentioned table 2 and optimization, 0mmol/L, 1mmol/ are designed
L, 2mmol/L, 3mmol/L, 4mmol/L, 5mmol/L, 6mmol/L, 7 magnesium sulfate concentration gradients are reacted.Each reaction
At least be repeated 3 times, product is detected with 2% agarose gel electrophoresis, as a result as shown in figure 4, it can be seen that
When magnesium sulfate final concentration is not more than 3.0mmol/L (that is, swimming lane 1~3), with the increase of magnesium sulfate concentration, electrophoretic band is bright
Degree is presented ascendant trend；When concentration is more than 3.0mM (that is, swimming lane 4~7), electrophoretic band brightness declines but tends to be steady, therefore
Optimum response magnesium sulfate concentration is 3.0mmol/L.
2nd, glycine betaine concentration optimization
On the basis of reaction condition, the reactant of optimization after the initial reaction system of above-mentioned table 2 and optimization, meter
0mmol/L, 0.5mmol/L, 1.0mmol/L, 1.5mmol/L, 4 glycine betaine final concentration gradients carry out RT-LAMP reactions.Each
Reaction is at least repeated 3 times, and product is detected with 2% agarose gel electrophoresis, as a result as shown in figure 5, can be with from figure
Find out, during without glycine betaine, the reaction still can be expanded smoothly, but beet alkali concn be 0.5mmol/L when, electrophoretic band is most
Bright, beet alkali concn can decline on the contrary the brightness of electrophoretic band when being more than 0.5mmol/L, therefore, optimal beet alkali concn
It is 0.5mmol/L.
3rd, the optimization of dNTPs concentration
On the basis of reaction condition, the reactant of optimization after the initial reaction system of above-mentioned table 2 and optimization, design
0.2mmol/L, 0.3mmol/L, 0.4mmol/L, 0.5mmol/L, 0.6mmol/L, 0.7mmol/L, 6 dNTPs concentration gradients
Carry out RT-LAMP reactions.Each reaction is at least repeated 3 times, and product is detected with 2% agarose gel electrophoresis, as a result
As shown in fig. 6, it can be seen that during the final concentration of 0.3mol/L of dNTPs, electrophoretic band brightness is maximum, i.e., final concentration of
The dNTPs of 0.3mmol/L can be smoothed out reaction, therefore optimal dNTPs concentration is 0.3mmol/L.
4th, AMV enzyme concentrations optimization
On the basis of reaction condition, the reactant of optimization after the initial reaction system of above-mentioned table 2 and optimization, design
0.06U/ μ L, 0.08U/ μ L, 0.1U/ μ L, 0.12U/ μ L, 0.14U/ μ L, 0.16U/ μ L6 AMV enzyme concentrations gradients carry out RT-
LAMP reacts.Each reaction is at least repeated 3 times, and product is detected with 2% agarose gel electrophoresis, as a result such as Fig. 7 institutes
Show, it can be seen that as the final concentration of 0.14U/ μ L of AMV enzymes, RT-LAMP reaction amplification efficiency highests, i.e. electrophoretic band brightness
It is bigger.Therefore selection 0.14U/ μ L are the optimal AMV reverse transcriptase final concentration of RT-LAMP reactions.
5th, Bst polymerase concentrations optimization
On the basis of reaction condition, the reactant of optimization after the initial reaction system of above-mentioned table 2 and optimization, design
0.08U/ μ L, 0.16U/ μ L, 0.24U/ μ L, 0.32U/ μ L, 0.4U/ μ L, 0.48U/ μ L, 6 Bst polymerase concentrations gradients are carried out
RT-LAMP reacts.Each reaction is at least repeated 3 times, and product is detected with 2% agarose gel electrophoresis, as a result such as Fig. 8
It is shown, it can be seen that as the concentration of Bst polymerases increases, RT-LAMP reaction amplification efficiencies are to rise, i.e. electricity
The brightness of swimming band increases, but only when concentration is 0.32U/ μ L (swimming lanes 4), electrophoretic band brightness is maximum, as Bst is polymerized
The continuation of enzyme concentration increases, the luminance-reduction of RT-LAMP product electrophoretic bands, therefore the optimal Bst polymerizations of RT-LAMP reactions
Enzyme concentration is 0.32U/ μ L.
6th, 10 × thermopol Buffer optimizations
On the basis of reaction condition, the reactant of optimization after the initial reaction system of above-mentioned table 2 and optimization, design 0,
4%th, 8%, 10%, 12%, 16%, 6 volumetric concentration of 10 × thermopol Buffer (10 × thermopol Buffer
Addition volume and reaction system cumulative volume ratio) gradient carries out RT-LAMP reactions.Each reaction is at least repeated 3 times, reaction
Product detected with 2% agarose gel electrophoresis, as a result as shown in figure 9, it can be seen that in the 4th swimming lane, i.e., 10
When the volumetric concentration of × thermopol Buffer is 10%, electrophoretic band brightness is maximum, and the final amplification efficiency in surface is optimal, energy
Reaction is smoothed out, therefore 10 × thermopol Buffer optimal volumes concentration of RT-LAMP reactions is for 10% (i.e. to 25 μ L
The addition of reaction system is 2.5 μ L).
7th, inner primer and outer primer ratio optimization
On the basis of reaction condition, the reactant of optimization after the initial reaction system of above-mentioned table 2 and optimization, according to table
The nucleic acid test strip of the different inner primers of 36 groups of designs and outer primer concentration ratio, detects RT-LAMP product.Each reaction is extremely
It is repeated 3 times less, product is detected with 2% agarose gel electrophoresis, structure is as shown in Figure 10 it can be seen that swimming
The final amplification efficiency highest in road 5, electrophoretic band brightness is maximum, therefore the optimal inner primer of RT-LAMP reactions and outer primer ratio are
10:1, (final concentration of, 2.0 μm of ol/L of inner primer (FIP+BIP), 0.2 μm of ol/L of outer primer (F3+B3))..
The novel duck reovirus RT-LAMP of table 3 reacts the optimization of inner primer and outer primer concentration ratio
8th, ring primer and outer primer ratio optimization
On the basis of reaction condition, the reactant of optimization after the initial reaction system of above-mentioned table 2 and optimization, according to table
The nucleic acid test strip of the different inner primers of 47 groups of designs and outer primer concentration ratio, detects RT-LAMP product.Each reaction is extremely
It is repeated 3 times less, product is detected with 2% agarose gel electrophoresis, as a result as shown in figure 11, it can be seen that ought not
When adding ring primer (swimming lane 1), amplified band generation is had no, when ring primer and inner primer ratio are 4:When 1 (swimming lane 5), electrophoresis
Band brightness is maximum, i.e., final amplification efficiency is optimal, and reaction can be made effectively to carry out, thus RT-LAMP react optimal ring primer with
Outer primer ratio is 4:1 (final concentration of, 0.8 μm of ol/L of ring primer (LoopF+LoopB), 0.2 μm of ol/ of outer primer (F3+B3)
L)。
The novel duck reovirus RT-LAMP of table 4 reacts the optimization of inner primer and outer primer concentration ratio
Summary experiment condition, reacts after obtaining the optimization of novel duck reovirus RT-LAMP nucleic acid test-strip method
System and reaction condition are as shown in table 5 below：
Reaction system and reaction condition after the optimization of the novel duck reovirus RT-LAMP nucleic acid test-strip method of table 5
The application of the RT-LAMP nucleic acid test-strip kit of novel duck reovirus, comprises the steps of：
(1) RT-LAMP reaction systems are configured：By final concentration calculate, concentration be the magnesium sulfate of 0~6mmol/L, concentration be 0
The AMV reversions that the glycine betaine of~1.5mmol/L, concentration are the dNTPs of 0.2~0.7mmol/L, concentration is 0.06~0.16U/ μ L
Record enzyme, concentration are that the Bst polymerases of 0.08~0.48U/ μ L, RNase-free water complement to the cumulative volume of reaction system
The final concentration ratio of 25 μ L, 0~16% that the addition of buffer solution is reaction system cumulative volume, inner primer and outer primer is 2:1~
12:1st, the final concentration ratio of ring primer and outer primer is 0~6:1st, the addition of testing sample RNA is 2 μ L；
(2) react：By the reaction system isothermal reaction in step (1), then reacted product is tried with detection of nucleic acids
Paper slip detection, reads testing result after 10~30min；
(3) testing result interpretation：
It is negative：When the band that nucleic acid detection test strip is located at quality control region takes on a red color, when detection zone is without band, then show to be measured
Target is not by novel duck reovirus infection；
It is positive：When there are being located at respectively two red stripes of quality control region and detection zone in nucleic acid detection test strip, then table
Bright target to be measured is by novel duck reovirus infection；
It is invalid：When nucleic acid detection test strip quality control region and detection zone band do not occur, then show that detection process is invalid.
When carrying out result detection, test strips are located in full closed target nucleic amplifier fast testing device.By above-mentioned RT-
The product of LAMP reactions, puts at the well of test strips after mixing with developping solution, and mixed liquor passes through capillarity flow forward.
Because the primer of amplification procedure is by biotin labeling, in the presence of having amplified production, product has strepto- parent with gold standard pad first
Collaurum (Au) with plain (SA) is combined, and detection line is reached as liquid phase continues flowing, is fixed on the anti-different sulphur cyanogen in detection line
Sour anti-fluorescein antibody (Anti-F) will be captured by the amplified production of fluorescein (fluorescein is marked on primer), thus make
The collaurum combined with amplified production is all rested at detection line, produces red band.Conversely, not combined with amplified production
Collaurum by continue chromatograph, finally by nature controlling line the coated biotins of use BSA (Biotin, B) capture, make nature controlling line same
Sample develops the color.So when amplified production does not exist, colloid gold particle cannot be rested at detection line, and by the biotin on nature controlling line
Capture, so the colour developing situation of nature controlling line can be used to carry out Quality Control to reagent strip.
The sensitivity analysis of embodiment 8, novel duck reovirus RT-LAMP nucleic acid test-strip method for quick
Sensitivity analysis is carried out to above-mentioned novel duck reovirus RT-LAMP methods, to the RNA for extracting and positive matter
Grain by after spectrophotometric determination content, being diluted to 1ng, 100pg, 10pg, 1pg, 100fg, 10fg, 1fg respectively, and 7 quick
The RNA solution and positive plasmid solution for feeling gradient carry out RT-LAMP reactions, as a result such as Figure 12 A~C, it can be seen that should
Method is 100fg × 2=200fg (swimming lane 5) to the detection limit of DRV-QY pnca gene group RNA and positive plasmid, with new
Duck reovirus RT-LAMP nucleic acid test-strip carries out sensitivity tests, as a result unanimously.And existing RT-PCR carry out it is same
During sensitivity tests, as a result detection limit is 20pg (swimming lane 3).The NDRV RT- set up from result above, the research
The sensitiveness of LAMP nucleic acid test strip detection methods is 100 times of conventional RT-PCR method.
In sum, the invention discloses a kind of RT-LAMP nucleic acid test-strip detection method and application, the present invention is used
The method that RT-LAMP technologies are combined with nucleic acid test strip detection technique, can using simple laboratory apparatus, rapidly and efficiently
Novel duck reovirus is detected, the false positive issue in RT-LAMP product detections of having determined is not only convenient and swift, and
Sensitiveness is higher than conventional RT-PCR about 100 times, is conducive to the popularization and application of nucleic acid test strip method.
It should be appreciated that application of the invention is not limited to above-mentioned citing, and for those of ordinary skills, can
To be improved according to the above description or converted, all these modifications and variations should all belong to the guarantor of appended claims of the present invention
Shield scope.
SEQ ID NO 1：
CGTGGATGGTCAAAGTCGT
SEQ ID NO 2：
ACCTACACTCCAGGAAGGAC
SEQ ID NO 3：
TAGTTCTGGCATGGCCTCGC-CTTTACATGTGCTGCAGGGA
SEQ ID NO 4：
TGTTCGGACGTTCTCTTCCGGA-TTTAATGGCGCGGACGAC
SEQ ID NO 5：
AGCCTAGATTCGCACTCCG
SEQ ID NO 6：
CGAGGAGACTACCCACGTT
SEQ ID NO 7：
CGTGTATGGTCAAAGTCGTGCTTTACATGTGCTGCAGGGATGGAGCCCGCGGAGTGCGAATCTAGGCTGCGAG
GCCATGCCAGAACTATGTTCGGACGTTCTCTTCCGGATATCTGTGACTTCGAGGAGACTACCCACGTTGGCCAGTCG
TCCGCGCCATTAAAGAAGGCCACGAAATTGTCCTTCCTGGAGTGTAGGT
Claims (10)
1. a kind of RT-LAMP nucleic acid test-strip kit, it is characterised in that including following primer sets and nucleic acid detection test strip:
The nucleotide sequence of the primer sets is as follows：
Outer primer, F3：5’-CGTGGATGGTCAAAGTCGT-3’；
B3：5’-ACCTACACTCCAGGAAGGAC-3’；
Inner primer, FIP：
5-Biotin-TAGTTCTGGCATGGCCTCGC-CTTTACATGTGCTGC AGGGA-3’；
BIP：
5-Fitc-TGTTCGGACGTTCTCTTCCGGA-TTTAATGGCGCGGA CGAC-3’；
Ring primer, LoopF：5’-AGCCTAGATTCGCACTCCG-3’；
LoopB：5’-CGAGGAGACTACCCACGTT-3’.
2. RT-LAMP nucleic acid test-strip kit according to claim 1, it is characterised in that use biotin and fluorescein
Primer in above-mentioned primer sets is marked.
3. RT-LAMP nucleic acid test-strip kit according to claim 1, it is characterised in that also include：It is magnesium sulfate, sweet
Dish alkali, dNTPs, AMV reverse transcriptase, Bst polymerases, buffer solution.
4. RT-LAMP nucleic acid test-strip kit according to claim 1, it is characterised in that RT-LAMP reactions it is initial
Reaction system includes：Concentration is the magnesium sulfate of 100mmol/L, concentration is the glycine betaine of 5mmol/L, concentration is 2.5mmol/L's
AMV reverse transcriptase, Bst polymerases, the addition of RNase-free water that concentration is 8U/ μ L of dNTPs, concentration for 10U/ μ L
Measure for the addition of 3.7 μ L, buffer solution be 2.5 μ L, outer primer concentration be 10 μm of ol/L, ring primer concentration be 10 μm of ol/
L, the concentration of inner primer are 10 μm of ol/L.
5. a kind of application of RT-LAMP nucleic acid test-strip kit as described in Claims 1 to 4 is any, it is characterised in that bag
Containing following steps：
(1) RT-LAMP reaction systems are configured：By final concentration calculate, concentration be the magnesium sulfate of 0~6mmol/L, concentration be 0~
The AMV reverse transcriptions that the glycine betaine of 1.5mmol/L, concentration are the dNTPs of 0.2~0.7mmol/L, concentration is 0.06~0.16U/ μ L
Enzyme, concentration are that the cumulative volume of reaction system is complemented to 25 by the Bst polymerases of 0.08~0.48U/ μ L, RNase-free water
The final concentration ratio of μ L, 0~16% that the addition of buffer solution is reaction system cumulative volume, inner primer and outer primer is 2:1~12:
1st, the final concentration ratio of ring primer and outer primer is 0~6:1st, the addition of testing sample RNA is 2 μ L；
(2) react：By the reaction system isothermal reaction in step (1), then by reacted product nucleic acid detection test strip
Detection, reads testing result after 10~30min；
(3) testing result interpretation：
It is negative：When the band that nucleic acid detection test strip is located at quality control region takes on a red color, when detection zone is without band, then show target to be measured
Not by novel duck reovirus infection；
It is positive：When two red stripes of quality control region and detection zone occurs being located at respectively in nucleic acid detection test strip, then show to treat
Target is surveyed by novel duck reovirus infection；
It is invalid：When nucleic acid detection test strip quality control region and detection zone band do not occur, then show that detection process is invalid.
6. the application of RT-LAMP nucleic acid test-strip kit according to claim 5, it is characterised in that in step (1),
The final concentration of 2.0 μm of ol/L of inner primer, the final concentration of 0.2 μm of ol/L of outer primer, final concentration of 0.8 μm of ol/L of ring primer.
7. the application of RT-LAMP nucleic acid test-strip kit according to claim 5, it is characterised in that in step (1),
The final concentration of 3mmol/L of magnesium sulfate, the final concentration of 0.3mmol/L of final concentration of 0.5mmol/L, dNTPs of glycine betaine,
The final concentration of final concentration of 0.32U/ μ L of AMV reverse transcriptase.
8. the application of RT-LAMP nucleic acid test-strip kit according to claim 5, it is characterised in that above-mentioned steps (2)
In isothermal reaction temperature be 59~66 DEG C.
9. the application of RT-LAMP nucleic acid test-strip kit according to claim 5, it is characterised in that above-mentioned steps (2)
In isothermal reaction time be 10~60min.
10. the application of RT-LAMP nucleic acid test-strip kit according to claim 5, it is characterised in that above-mentioned steps
(2) the isothermal reaction condition in is 65 DEG C of reaction 50min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710041100.2A CN106676200A (en) | 2017-01-17 | 2017-01-17 | RT-LAMP nucleic acid test strip kit and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710041100.2A CN106676200A (en) | 2017-01-17 | 2017-01-17 | RT-LAMP nucleic acid test strip kit and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106676200A true CN106676200A (en) | 2017-05-17 |
Family
ID=58859374
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710041100.2A Pending CN106676200A (en) | 2017-01-17 | 2017-01-17 | RT-LAMP nucleic acid test strip kit and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106676200A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108265067A (en) * | 2018-01-02 | 2018-07-10 | 佛山科学技术学院 | The cloning process of novel duck reovirus L group genes |
| CN108611441A (en) * | 2018-05-22 | 2018-10-02 | 山东农业大学 | It is a kind of detection novel duck reovirus PCR kit for fluorescence quantitative and application |
| CN112881672A (en) * | 2021-01-11 | 2021-06-01 | 南京钟鼎生物技术有限公司 | Universal type colloidal gold test strip for detecting polynucleic acid products and preparation method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102703608A (en) * | 2012-06-07 | 2012-10-03 | 中国水产科学研究院长江水产研究所 | Reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay kit and detection method for grass carp reoviruses |
| CN103602761A (en) * | 2013-11-29 | 2014-02-26 | 华南农业大学 | RT-LAMP nucleic acid test-strip kit for determining hog cholera virus and application |
-
2017
- 2017-01-17 CN CN201710041100.2A patent/CN106676200A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102703608A (en) * | 2012-06-07 | 2012-10-03 | 中国水产科学研究院长江水产研究所 | Reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay kit and detection method for grass carp reoviruses |
| CN103602761A (en) * | 2013-11-29 | 2014-02-26 | 华南农业大学 | RT-LAMP nucleic acid test-strip kit for determining hog cholera virus and application |
Non-Patent Citations (2)
| Title |
|---|
| LIN Q F ET AL.: "Isolation and characterization of a reovirus causing spleen necrosis in Peking ducklings", 《VET MICROBIOL》 * |
| 于可响等: "新型鸭呼肠孤病毒RT-LAMP检测方法的建立", 《生物技术通报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108265067A (en) * | 2018-01-02 | 2018-07-10 | 佛山科学技术学院 | The cloning process of novel duck reovirus L group genes |
| CN108611441A (en) * | 2018-05-22 | 2018-10-02 | 山东农业大学 | It is a kind of detection novel duck reovirus PCR kit for fluorescence quantitative and application |
| CN112881672A (en) * | 2021-01-11 | 2021-06-01 | 南京钟鼎生物技术有限公司 | Universal type colloidal gold test strip for detecting polynucleic acid products and preparation method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110551846B (en) | Cpf1 kit for quickly detecting African swine fever virus nucleic acid and detection method thereof | |
| Fujimoto et al. | Single‐tube multiplex PCR for rapid and sensitive diagnosis of subgenus B and other subgenera adenoviruses in clinical samples | |
| CN104328222B (en) | The test kit of reverse transcription PCR detection and somatotype dengue virus and detection method thereof | |
| CN112094948A (en) | Application of target gene combination in African swine fever virus detection and kit | |
| CN106676200A (en) | RT-LAMP nucleic acid test strip kit and application | |
| CN104630387B (en) | The LAMP detection kit of Porcine epidemic diarrhea virus | |
| CN102250924A (en) | Getah virus complete genome sequence, amplification method and primers | |
| CN106916907A (en) | The fluorescence PCR method and kit of a kind of specific detection herpes simplex virus I, II type nucleic acid | |
| CN103388033A (en) | Enterovirus type 71 (EV71) real-time fluorescent nucleic acid isothermal amplification detection kit | |
| CN110438260A (en) | A kind of African swine fever virus nucleic acid test strips detection kit | |
| CN109735659A (en) | A kind of primer and kit and detection method using RPA detection Procambius clarkii picornavirus | |
| CN107858453A (en) | Porcine encephalomyocarditis virus LAMP detection primer is to, detection method and application | |
| CN104946753A (en) | Specificity primer pair for cow mycoplasma detection, detection kit, as well as using method and application of detection kit | |
| CN105002169A (en) | DHAV-3 fluorescent quantitation RT-LAMP detection reagent kit and application and method thereof | |
| CN110938708A (en) | Kit for detecting H7N9 avian influenza virus based on isothermal amplification technology and application thereof | |
| CN107236827B (en) | Kit and method for detecting transmissible gastroenteritis virus of swine | |
| CN107058630B (en) | Multiple RT-PCR detection method for 3 genotypes of bovine parainfluenza 3 virus | |
| CN103388032A (en) | Coxsackie virus type A16 (CA16) real-time fluorescent nucleic acid isothermal amplification detection kit | |
| CN105463131A (en) | Human bocavirus LAMP (loop-mediated isothermal amplification) detection kit | |
| AU2021100496A4 (en) | A fast qualitative and quantitative kit for microorganisms and a fast qualitative and quantitative method | |
| CN102618627B (en) | Internal reference detection system and kit for isothermal nucleic acid amplification reaction | |
| CN108467904A (en) | Detect RT-LAMP primer sets, kit and the application of Sai Nika paddy viruses | |
| CN108103152A (en) | A kind of Listonella anguillarum rapid detection method | |
| CN100460518C (en) | Reagent box for detecting prawn leucoplakia syndrome virus using isothermal branch augmentation and method therefor | |
| CN115029345A (en) | Nucleic acid detection kit based on CRISPR and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170517 |
|
| RJ01 | Rejection of invention patent application after publication |