CN111719004A

CN111719004A - Kit for distinguishing and identifying paragonimus westermani cysticercus and paragonimus cysticercus and using method

Info

Publication number: CN111719004A
Application number: CN202010782631.9A
Authority: CN
Inventors: 陈韶红; 郑彬; 卢艳; 蔡玉春; 艾琳; 宋鹏; 陈家旭; 周晓农
Original assignee: National Institute of Parasitic Diseases of Chinese Center for Disease Control and Prevention
Current assignee: National Institute of Parasitic Diseases of Chinese Center for Disease Control and Prevention
Priority date: 2020-08-06
Filing date: 2020-08-06
Publication date: 2020-09-29

Abstract

A kit for distinguishing and identifying paragonimus westermani cysticercus and paragonimus cysticercus comprises a primer for amplifying paragonimus westermani and a probe for detecting paragonimus westermani, and also comprises a primer for amplifying paragonimus westermani cysticercus and a probe for detecting paragonimus westermani cysticercus. The invention also provides a using method of the kit. The invention determines that the gene sequence of the conserved region of mitochondrial COX1 gene of paragonimus westermani and paragonimus is used as the target gene amplification sequence, and two pairs of specific primers and two TaqMAN probes are respectively designed and synthesized to be applied to the detection of cysticercus of paragonimus westermani and cysticercus of paragonimus westermani. The method has higher sensitivity, and can detect 30.5 copies/mu L of paragonimus westermani cyst DNA and 32.1 copies/mu L of paragonimus coeruleus cyst DNA at the lowest.

Description

Kit for distinguishing and identifying paragonimus westermani cysticercus and paragonimus cysticercus and using method

Technical Field

The invention belongs to the field of biology, and relates to a kit and a method for detecting parasites, in particular to a kit and a method for detecting paragonimus westermani and paragonimus coenurus.

Background

Paralogus (Paragonimus) belongs to the phylum Platyhelminths, the class Trematoda, the order of the reprodropula (digenera), the family of paralogous (Paragonimidae), and the genus of paralogus (Paragonimus). At present, more than 50 paragonimus (including subspecies, synonyms and the like) exist worldwide, 32 paragonimus (including subspecies, synonyms and the like) exist in China, about more than 10 kinds of pathogenic paragonimus exist, and the main species in China are paragonimus westermani (Paragonimus paragonimus), paragonimus (Paragonimus kjabini), triparenaria triparenicola (Euparagonimus triparenopodiosis) and the like.

Paragonimus westermani (p.westermani), also known as paragonimus, is a parasite that colonizes the lungs of humans, cats, dogs and other animals, and the eggs of the parasite are excreted with the excreta, enter the water to develop and hatch the larvae. The larva of Cyrtosis is invaded into first intermediate host, namely Chuanju, and after the larva of Cyrtosis, mother Leercus, child Leercus and cercaria in each period, the cercaria escapes from the Spirosoma, and then invades into second intermediate host, namely a crab or crawfish. The crayfish is infected with crayfish or river crab containing metacercaria. The baby insects can reach the lung only after moving through the human body. The paragonimiasis weiwei is generally characterized by eosinophilia in peripheral blood, cough and rust-colored sputum, and if parasites are parasitized at other parts, the symptoms can also be caused.

The life history of paragonimus sieboldii is similar to paragonimus westermani. The insect infects the human body mainly as migratory subcutaneous masses or nodules. In recent years, cases of invasion of the chest and lung by paragonimus have been reported frequently. Blood level examination was mostly manifested as a marked increase in eosinophils. The clinical misdiagnosis rate is quite high due to various manifestations of the disease.

The classification of paragonimus is a very controversial topic. Because the life history of the paragonimus is complex, the species of intermediate hosts are many and wide, the difference exists in regions and environments, the preparation of specimens in different developmental stages, the variation exists in different degrees among species and in species, and the like, the paragonimus has not been unified for more than 160 years since the first discovery.

Morphologically, adult worms are mostly classified as paragonists. On one hand, the classification and identification are carried out by professionals familiar with relevant knowledge of paragonimus, and the operation is complicated; on the other hand, the sizes and shapes of the paragonimus imago, the cysticercus and the ovum are slightly different in different environments and different host bodies. Therefore, it is difficult to classify the paragonimus morphologically. The classification of paragonimus in China mainly adopts a method combining morphology and DNA technology. Firstly, roughly distinguishing and breeding the insect species of the trematode from morphology, and carrying out classification and identification by combining a molecular technology, thereby accurately distinguishing the insect species at a gene level.

The classification research of the paragonimiasis in China has regional limitations, is mostly carried out aiming at the insect species in a certain single province or a certain region, and reports are relatively scattered; most of the molecular identification methods are researches carried out by taking adults as samples, but the adults can be obtained only by animal models, and the material consumption is high in the test process. More complicated, each experiment step needs a long time, some operation processes are easy to cause pollution, false positive is generated, and the like, so that the existing detection method is long in time consumption, expensive in detection instrument and high in requirements for personnel, identification can be carried out only by training related skills and obtaining on-duty certificates, and the requirements for on-site real-time and rapid detection cannot be met.

The real-time fluorescence quantitative PCR technology is a high-new detection technology with great development potential, is widely applied in many fields, realizes qualitative to quantitative leap of a PCR method, has the characteristics of stronger specificity, short detection period, effective solution of PCR pollution, high automation degree and the like compared with the conventional PCR, and is widely applied to the fields of basic scientific research, clinical diagnosis, disease research, drug research and development and the like.

Because the existing paragonimus adult sample is difficult to obtain, but the stream crab as the intermediate host is easy to collect, the research establishes a timely and rapid fluorescence quantitative PCR detection method aiming at cysticercus in the stream crab as the intermediate host of the paragonimus, opens up a new path of the method for detecting the cysticercus of the paragonimus, and has important application values for classification, clinical diagnosis, epidemiological investigation, geographical distribution, food safety and quarantine of the paragonimus.

Disclosure of Invention

The invention provides a kit and a method for detecting paragonimus westermani and paragonimus coenurus, and the kit and the method for detecting paragonimus westermani and paragonimus coenurus solve the technical problems of low specificity and sensitivity of a method for detecting paragonimus westermani and paragonimus coenurus in the prior art.

The invention provides a kit for distinguishing and identifying paragonimus westermani cysticercus and paragonimus cysticercus,

the upstream primer containing amplified paragonimus westermani cyst has the gene sequence shown in SEQ ID NO. 1;

the downstream primer containing amplified paragonimus westermani cyst has the gene sequence shown in SEQ ID NO. 2;

contains a probe for detecting paragonimus westermani cyst, and the gene sequence of the probe is shown in SEQ ID NO. 3;

the upstream primer containing the amplified paralymus spatialis has the gene sequence shown in SEQ ID NO. 4;

the downstream primer containing the coenurosis of the amplified paralymus stewartii has a gene sequence shown in SEQ ID NO. 5;

contains a probe for detecting coenurosis of paralymus stevensis, and the gene sequence of the probe is shown as SEQ ID NO. 6;

marking a fluorescent dye FAM at the 5 'end of a probe containing the paragonimus westermani cyst, and marking a fluorescent quenching group at the 3' end;

the fluorescent dye VIC is marked at the 5 'end of the probe containing the coenurosis of the paragonimus detection, and the fluorescent quenching group is marked at the 3' end.

Further, the kit also comprises two standard positive control plasmid DNA templates which are respectively corresponding and consistent with mitochondrial COX1 genes of paragonimus westermani and paragonimus schnei, and reagents required for real-time quantitative PCR detection, wherein the mitochondrial COX1 gene sequence of the paragonimus westermani is shown as SEQ ID No. 7; the mitochondrial COX1 gene sequence of the paralogous scholaris is shown as SEQ ID No. 8.

The invention also provides a use method of the kit for distinguishing and identifying paragonimus westermani and paragonimus coenurus, wherein coenurus genomic DNA to be detected is taken as a template, the coenurus genomic DNA is uniformly mixed with DNA polymerase, buffer solution, sterilized ultrapure water, a detection primer and a specific probe in the kit according to a proportion, real-time quantitative PCR detection is carried out, the type of the coenurus is determined according to the Ct value of a reaction curve, and therefore the fact that the stream crab is infected by the paragonimus westermani or the paragonimus coenurus is judged.

Two sets of primers related to the present invention are shown in tables 1 and 2:

TABLE 1 fluorescence quantitative PCR primer and probe gene sequence for detecting paragonimus westermani cysticercus

TABLE 2 fluorescent quantitative PCR primers and Probe Gene sequences for detecting Pleurocystis Spirosoma

Compared with the conventional PCR technology, the real-time fluorescence quantitative PCR technology has the advantages of strong specificity, high sensitivity, good repeatability, accurate quantification, high automation degree, high speed, full-closed reaction and the like. In the selection of amplified targets, the mitochondrial COX1 gene sequence is a commonly used target for parasite molecular identification. The gene sequence of COX1 gene belongs to mitochondrial genome, and the maternal genetic evolution rate is high, so that the method is suitable for analyzing intraspecific genetic difference.

The present invention utilizes the mitochondrial COX1 genes of paragonimus westermani and paragonimus schlegelii, respectively, which are highly conserved within paragonimus species, but have variable regions between different paragonimus species. The invention utilizes the characteristic of the gene, the COX1 gene is used as a target gene for real-time fluorescent quantitative PCR detection, mitochondrial COX1 genes of paragonimiasis westermani and paragonimiasis are selected (GeneBank (TM) accession numbers are U97205.1 and U97216.1 respectively), Mega6.0 is adopted for multiple comparison, respective conserved regions of the paragonimiasis westermani and paragonimiasis COX1 gene fragments are screened, and PrimerPremier 5.0 software is used for designing primers and probes. The research respectively designs specific primers and probes aiming at paragonimus westermani and paragonimus schlegeli, the designed primers and probes can only specifically detect corresponding paragonimus westermani cyst or paragonimus schlegeli cyst, the sensitivity is high, and other related parasites cannot be detected.

Compared with the prior art, the invention has the advantages of positive and obvious technical effect. The real-time fluorescent quantitative PCR detection method has good specificity, sensitivity and repeatability, can distinguish and identify paragonimus westermani and paragonimus coenurus, and can simultaneously carry out quantitative analysis on genomic DNA of the two paragonimus.

Drawings

FIG. 1 is a comparison diagram of the real-time fluorescence PCR detection technology (wherein the A diagram curves 1-3: paralogous euonymus coenurus; 4-15: paralogous speridae, triploid schistosoma, clonorchis sinensis, fasciola hepatica, trichina, ascaris, taenia bovis, genomic DNA of rabid muscle and sterile deionized water (2), B diagram curves 1-3: paralogous euonymus coenurus; 4-15: paralogous euonymus wessimus wessima, triploid euonymus, fasciola hepatica, trichina, ascaris, taenia bovis, genomic DNA of rabid muscle and sterile deionized water (2)).

FIG. 2 is a graph showing the kinetics of fluorescent PCR amplification of different copy number positive quality control standards (from left to right: 100-fold dilution of DNA with a dilution gradient of 0.305-3.05 × 10 for paragonimus westermani from 0.305 to 3.05⁹copies/μL，1～6:3.05×10⁹copies/μL、3.05×10⁷copies/μL、3.05×10⁵copies/μL、3.05×10³The dilution gradient of the paragonimus is 0.321-3.21 × 10⁹copies/μL，1～6:3.21×10⁹copies/μL、3.21×10⁷copies/μL、3.21×10⁵copies/μL、3.21×10³copies/μL、32.1copies/μL、0.321copies/μL)。

FIG. 3 is a real-time fluorescence PCR standard curve (A is paragonimus westermani real-time fluorescence PCR standard curve, B is paragonimus westermani real-time fluorescence PCR standard curve).

Detailed Description

The invention will be further illustrated with reference to the following specific examples:

1. separating cysticercus (fresh water river crab from Zhejiang Yongjia and Fujia Zhangzhou):

1.1, measuring the size of the captured stream crabs and dividing the stream crabs into male and female parts;

1.2 respectively cutting the brook crab head, brood limb and foot, putting into a mortar together with the internal organs;

1.3 mashing bamboo tube and bamboo stick (or other similar substitutes);

1.4 washing the mashed sample by using normal saline, filtering by using a 10-mesh screen, and removing crude crab shells;

1.5 filtering the filtrate by using a 40-mesh screen, putting the obtained filtrate in a conical measuring cylinder, adding water to the maximum scale position of the measuring cylinder, and naturally precipitating and washing to obtain clear water;

1.6 sucking all sediments into a glass plate, collecting cysticercosis under a stereoscopic microscope, counting and registering;

1.7 the collected coenuruses are preserved in 75% alcohol or quick frozen in a small amount of physiological saline at-80 ℃.

2. Extracting genome DNA:

2.1 taking 1-10 coenuruses with consistent morphological characteristics, putting the coenuruses into a 1.5mL centrifuge tube, adding 100 mu L PBS and a small amount of glass beads, oscillating for 5-10 min, and then extracting DNA according to a general genome extraction kit;

PCR primers and probes: the mitochondrial COX1 genes of paragonimus westermani and paragonimus schlegelii (GeneBank)^TMAccession numbers are U97205.1 and U97216.1), multiple comparisons are performed with Mega6.0, respective conserved regions of paragonimus westermani and paragonimus schlegeli are screened, and Primer and probe designs are performed using Primer Premier 5.0 software.

Designing COX1 gene sequences used by paragonimus westermani fluorescence quantitative primers and probes: gggtttggtatcgtgagccacatttgcatgaccctgaccaacaacgattccttgttcgggtactacgggctggtgtttgcgatgggggccattgtgtgtctgggtagtgttgtgtgggcgcatcacatgttcatggttggtttggatgtcaagactgctgttttctttagttctgtcacgggagtgattgggatacccacggggattaaggttttctcttggttgttcatgctgggtggaactcgtttgcggttttgggatcctgttttgtggtgaattcttgggtttatcttcctgttcaccataggtggtgtgaccggcatcattctgtcctcctccatactggatagtctgttgcatgatacgtggttcgt (shown as SEQ ID NO. 7)

Designing COX1 gene sequences used by paragonimus sp fluorescent quantitative primers and probes:

gggttcggggttgtgagacatatttgtatgactttaactaataaagattctttgtttggctattatggattggtttttgctatgggggctattgtttgtctaggaagggttgtttgggcgcatcatatgtttatggttggtctggatgttaagactgctgtgttttttagctctgttacgggggttataggtatccctacaggaattaaggttttttcttggttgtttatgttgggaggggctcgtttacggttttgggatccggtaatttggtgaattttggggtttatttttctttttacgatagggggggtaactgggattattttgtcttcatctattttggatagcttattgcatgatacttggtttgt (shown as SEQ ID NO. 8)

Primers and probes for paragonimus westermani:

PWF (forward primer): 5'-TTGTTCGGGTACTACGGGCT-3' 3 ' (SEQ ID NO.1)

PWR (reverse primer): 5'-CCGCAAACGAGTTCCACC-3' 3 ' (SEQ ID NO.2)

The probe PWP is 5 '-FAM-AGTTCTGTCACGGGAGTGATTGGG-BHQ 1-MGB-3' (SEQ ID NO.3), the 5 'end of which is marked with fluorescent dye FAM, and the 3' end is marked with a non-fluorescence quenching group.

Primers and probes for paralogous scholaris:

PSF (forward primer) 5'-CTATTATGGATTGGTTTTTG-3' (SEQ ID NO.4),

PSR (reverse primer) 5'-ACCTATAACCCCCGTAACAGAGCT-3' (SEQ ID NO.5),

the probe PSP: 5 '-VIC-GGGCTATTGTTTGTCTAGGAAGG-BHQ 1-MGB-3' (SEQ ID NO.6) was labeled with a fluorescent dye VIC at its 5 'end and a non-fluorescent quencher at its 3' end.

4. Preparing a positive quality control standard:

connecting the conventional PCR products of paragonimus westermani and paragonimus schnei with a cloning vector PUC57vector, transforming into escherichia coli DH5 alpha, storing positive recombinant bacteria, preparing plasmids according to the MiniBEST Plasmid Purification Kit instruction and quantifying;

4.1 culturing Escherichia coli, selecting a single colony from a plate culture medium, inoculating the single colony into 1-4 mL of liquid culture medium containing antibiotics, and culturing overnight at 37 ℃;

4.2 taking 1-4 mL of overnight culture bacterial liquid, centrifuging at 12000r/min for 2min, and removing the supernatant;

4.3 thoroughly suspending the bacterial pellet with 250. mu.L of Solution I (lysis reagent I) containing RNaseA 1;

4.4 adding 250 mu L of Solution II (dissolving reagent II) and slightly turning and mixing up and down for 5-6 times to fully crack the thalli to form a transparent Solution;

4.5 adding 400 mu L of 4 ℃ precooled Solution III (dissolving reagent III), slightly turning and mixing for 5-6 times up and down until compact aggregate is formed, and then standing for 2min at room temperature;

4.6 centrifuging at 12000r/min for 10min at room temperature, and taking the supernatant;

4.7 arranging the spin column in the reagent kit on a collecting tube;

4.8 transferring the supernatant obtained in the operation 4.6 to a rotating column, centrifuging at 12000r/min for 1min, and removing the filtrate;

4.9 Add 500. mu.L of Rinse A (Wash A) to spin column, centrifuge at 12000r/min for 30s, discard filtrate;

4.10 Add 700. mu.L of Rinse B (Wash B) to the spin column, centrifuge at 12000r/min for 30s, discard the filtrate;

4.11 repeat operation step 4.10;

4.12 placing the spin column on a new centrifuge tube of 1.5mL, adding 60 μ L of sterilized distilled water or dissolution buffer solution to the center of the spin column membrane, and standing at room temperature for 1 min;

4.1312000r/min for 1min to elute DNA;

after plasmid extraction, 50 mu L of the plasmid is sucked and is continuously diluted by 5 or 10 times to prepare positive quality control standard substances with different concentration gradients for quantitative detection, and the positive quality control standard substances are stored at the temperature of-20 ℃ for later use.

The specific method for extracting plasmid and then sucking 50 μ L for quantitative detection comprises diluting 10 μ L plasmid to 500 μ L, determining OD260, calculating plasmid mass, calculating molar concentration, and multiplying by Avogastron constant 6.02 × 10²³The copy number of the unit volume is calculated by the formula that the copy number of the positive plasmid copies/. mu.L ═ OD260 × 50 × 10^-9× dilution multiple × 6.02.02 6.02 × 10²³) Where 50 represents the concentration of the double-stranded DNA corresponding to an OD260 of 1 using a 1cm cuvette of 50. mu.g/mL, and 660 represents the average molecular weight of the double-stranded DNA per base pair.

5. Establishing and optimizing a reaction system:

pre-testing positive quality control standard substances with different concentration gradients, and selecting the concentration 3.05 × 10 with the Ct of about 20¹⁰copies/. mu.L (paragonimus westermani) and 3.21 × 10¹⁰copies/. mu.L (paragonimus) was used as a template for system optimization.

The steps of establishing and optimizing the reaction system comprise:

5.1 fluorescent quantitative PCR reaction reagent is Toyo Toyobo THUNDERBIRD Probe One-stepqRT-PCR Kit (including 2 x buffer, QRZ DNase);

5.2 optimizing single-factor concentration gradient of QRZ DNase under the condition of the same other conditions in a reaction system, gradually increasing the dosage of rTaq enzyme at each 0.25 mu L, and determining the optimal dosage of QRZ DNase to be 0.5 mu L through comparative analysis of test results;

5.3 optimizing the single-factor concentration gradient of the probe, under the condition that other conditions in a reaction system are the same, setting the dosage range of the probe at 0.10-0.50 mu L of each reaction, increasing the dosage of each probe by 0.05 mu L, carrying out comparative analysis on repeated tests, and determining that the optimal dosage of each probe in each reaction in the kit is 0.40 mu L;

5.4 optimization of primer concentration under the condition of the same other conditions in the reaction system, respectively setting the dosage of the upstream primer and the downstream primer at 0.10-0.90 muL for each reaction, increasing the dosage by every 0.10 muL, and performing matrix analysis to determine that the optimal dosage of the primers for each reaction of paragonimus westermani fluorescence quantitative PCR is 0.40 muL for both the upstream primer and the downstream primer; the optimal primer dosage of each reaction of the paragonimus sieboldii fluorescence quantitative PCR is that the upstream primer and the downstream primer are both 0.80 mu L;

5.5 determination of cycle parameters:

adjusting the denaturation time, annealing and extension temperature, time and cycle number properly, and selecting the cycle parameter with the shortest detection time and the best amplification curve as the temperature and time parameter of PCR, namely, pre-denaturation at 95 ℃ for 1 min; denaturation at 95 ℃ for 15s, annealing extension at 60 ℃ for 30s, 40cycles, and collection of fluorescence signal at 60 ℃.

The primers and the probes are utilized to establish a reaction system, and finally the adopted paragonimus westermani and paragonimus coenurus real-time fluorescent PCR detection system is determined to be 20 mu L, and the required components and the corresponding dosage are as follows:

6. the paragonimus westermani fluorescence quantitative PCR amplification reaction system is as follows:

sterile double distilled water 8.3 mu L

10. mu.L of 2-fold reaction buffer (2X)

Primer 1(10 pmol/. mu.L) 0.4. mu.L

Primer 2(10 pmol/. mu.L) 0.4. mu.L

Probe (10 pmol/. mu.L) 0.4. mu.L

Template DNA 2. mu.L

QRZ DNase (4U/. mu.l) 0.5. mu.L

The reaction conditions are as follows: pre-denaturation at 95 ℃ for 1 min; denaturation at 95 ℃ for 15s, annealing and extension at 60 ℃ for 30s, 40 cycles; 5min at 40 ℃, 1 cycle; the fluorescence signal was collected at 60 ℃.

7. The fluorescence quantitative PCR amplification reaction system of the Spodoptera cinerea is as follows:

sterile double distilled water 7.5 mu L

10. mu.L of 2-fold reaction buffer (2X)

Primer 1(10 pmol/. mu.L) 0.8. mu.L

Primer 2(10 pmol/. mu.L) 0.8. mu.L

Probe (10 pmol/. mu.L) 0.4. mu.L

Template DNA 2. mu.L

QRZ enzyme (4U/. mu.L) 0.5. mu.L

7. Specificity test

The established real-time fluorescence PCR detection method for paragonimus westermani and paragonimus schlegelii is used for respectively detecting the genome DNA of paragonimus westermani, paragonimus schlegelii, triploid paragonimus, fasciolopsis fascicularis, schistosoma latum, tapeworm of cattle and rabdosia lophanensis muscles and water control so as to explore the specificity of detection by the method.

As shown in FIG. 1, the present invention uses the genomic DNA of paragonimus westermani, paragonimus sella, triploid paragonimus, fasciola gigantica, clonorchis sinensis, fasciola hepatica, trichina, ascaris, taenia bovis, and rabid crab muscle to research the specificity of the detection by the method. Wherein, the curve of the graph A is 1-3: paragonimus westermani cysticercus; 4-15: paralogous fasciola, triploid fasciola, fasciola gigantica, clonorchis sinensis, fasciola hepatica, trichina, ascaris, taenia bovis, genomic DNA of crab muscle, and sterile deionized water (2); curves 1-3 of the B diagram: paralymus spinosus metacercaria; 4-15: paragonimus westermani, triploid paragonimus, fasciola gigantica, clonorchis sinensis, fasciola hepatica, trichina, ascaris, taenia bovis, genomic DNA of crab muscle, and sterile deionized water (2). As a result, only paragonimus westermani and paragonimus westermani can respectively detect corresponding amplification curves, and other parasites and healthy hosts do not have the increase of fluorescence signals, so that the method is proved to have good detection specificity.

8. Sensitivity test

Using the prepared positive quality control standard substance with different concentration gradients as a PCR template, amplifying on a fluorescent PCR instrument according to the PCR reaction system and the reaction program, obtaining Ct values with different copy numbers through computer analysis, drawing a standard curve according to the Ct values and the logarithm of the corresponding copy numbers, and calculating the amplification efficiency, wherein E is 10^-1/K-1, wherein the K value is the slope of the standard curve.

Two paragonimus positive plasmids were diluted 100-fold (paragonimus westermani dilution gradient 0.305-3.05 × 10)⁹The dilution gradient of the copes/mu L and the paragonimus schlegelii is 0.321-3.21 × 10⁹The sensitivity experiment is carried out by adopting the method established in the research, and the experimental result shows that: the sensitivity of the single fluorescent quantitative PCR identification detection method of the two paragonimias respectively reaches 30.5 copies/mu L of paragonimias weiwei and 32.1 copies/mu L of paragonimias schnei.

As shown in figure 2, the DNA of two paragonimus respectively carries out 100-fold dilution, the dilution gradient of paragonimus westermani is 0.305-3.05 × 109 copies/mu L, and the ratio is 1-6: 3.05 × 10⁹copies/μl、3.05×10⁷copies/μl、3.05×10⁵copies/μl、3.05×10³copies/. mu.l, 30.5 copies/. mu.l, 0.305 copies/. mu.l (Panel A), paragonimus strep dilution gradient 0.321-3.21 × 10⁹copies/μL，1～6:3.21×10⁹copies/μl、3.21×10⁷copies/μl、3.21×10⁵copies/μl、3.21×10³copies/. mu.l, 32.1 copies/. mu.l, 0.321 copies/. mu.l (panel B). Taking 1 mu L of the positive quality control standard substance with the concentration, taking template-free water control as negative control, carrying out amplification reaction on a fluorescence PCR instrument, and displaying that the cycle number (Ct) required by the fluorescence signal in each reaction tube reaching the threshold and the logarithm of the initial template copy number have obvious linear relation (R)²0.9998 and R²0.9997), the data points of the positive quality control standard on the standard curve and the curve fit well。

As shown in FIG. 3, A is an Paragonimus westermani real-time fluorescence PCR standard curve, and B is an Paragonimus westermani real-time fluorescence PCR standard curve. Paragonimus westermani: r²The sensitivity can reach 30.5 copies/mu L, the amplification efficiency E is 96.6%, the amplification equation Y is-6.8128 x + 37.059. Paralogous stubborn beetle R²0.9997, the amplification efficiency E91.8%, Y-7.0721 x + 45.106. NTC (no template control) no template control has no fluorescence amplification curve, and is a negative result, which indicates that the method has extremely high sensitivity.

9. Repeatability test

9.1 and 3 multi-tube simultaneous detection is carried out on the same positive quality control standard, the variation coefficient of the Ct value is calculated, and the repeatability and the stability of the detection method are inspected.

9.2 the positive quality control standard substance with different concentration gradients detected in the sensitivity test is re-detected after being stored for 30 days at the temperature of minus 20 ℃, Ct values detected twice are subjected to comparative hypothesis test, whether the obvious difference exists is observed, and the stability of the detection by the method is inspected.

9.3 the real-time fluorescence PCR of the invention is repeated for 3 times to detect the same positive quality control standard substance, and the variation coefficient of the Ct value obtained by detection is 1.2 percent (paragonimus westermani) and 0.27 percent (paragonimus westermani); the positive quality control standard substances of the same batch with different concentration gradients are detected twice (at an interval of 30d), the Ct values obtained by detection have no obvious difference through comparison hypothesis test, and the method has good repeatability and stability.

Sequence listing

<110> Chinese disease prevention and control center for prevention and control of parasitic diseases institute (national center for research on tropical diseases)

<120> kit for distinguishing and identifying paragonimus westermani and paragonimus coenurus and using method

<160>8

<170>SIPOSequenceListing 1.0

<210>1

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

ttgttcgggt actacgggct 20

<210>2

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

ccgcaaacga gttccacc 18

<210>3

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

agttctgtca cgggagtgat tggg 24

<210>4

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

ctattatgga ttggtttttg 20

<210>5

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

acctataacc cccgtaacag agct 24

<210>6

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

gggctattgt ttgtctagga agg 23

<210>7

<211>374

<212>DNA

<213> Paragonimus westernani)

<400>7

gggtttggta tcgtgagcca catttgcatg accctgacca acaacgattc cttgttcggg 60

tactacgggc tggtgtttgc gatgggggcc attgtgtgtc tgggtagtgt tgtgtgggcg 120

catcacatgt tcatggttgg tttggatgtc aagactgctg ttttctttag ttctgtcacg 180

ggagtgattg ggatacccac ggggattaag gttttctctt ggttgttcat gctgggtgga 240

actcgtttgc ggttttggga tcctgttttg tggtgaattc ttgggtttat cttcctgttc 300

accataggtg gtgtgaccgg catcattctg tcctcctcca tactggatag tctgttgcat 360

gatacgtggt tcgt 374

<210>8

<211>374

<212>DNA

<213> Paragonimus Skrjabini

<400>8

gggttcgggg ttgtgagaca tatttgtatg actttaacta ataaagattc tttgtttggc 60

tattatggat tggtttttgc tatgggggct attgtttgtc taggaagggt tgtttgggcg 120

catcatatgt ttatggttgg tctggatgtt aagactgctg tgttttttag ctctgttacg 180

ggggttatag gtatccctac aggaattaag gttttttctt ggttgtttat gttgggaggg 240

gctcgtttac ggttttgggatccggtaatt tggtgaattt tggggtttat ttttcttttt 300

acgatagggg gggtaactgg gattattttg tcttcatcta ttttggatag cttattgcat 360

gatacttggt ttgt 374

Claims

1. A kit for differentiating and identifying paragonimus westermani and paragonimus coenurus, which is characterized in that:

contains a probe for detecting paragonimus westermani cyst, and the gene sequence of the probe is shown as SEQ ID NO. 3;

the downstream primer containing the coenurosis of the amplified paralymus stewartii has a gene sequence shown as SEQ ID NO. 5;

2. The kit according to claim 1, for differentiating paragonimus westermani from paragonimus coenurus, characterized in that: the kit also comprises two standard positive control plasmid DNA templates which are respectively corresponding to and consistent with mitochondrial COX1 genes of paragonimus westermani and paragonimus schlegelii, and reagents required for real-time quantitative PCR detection, wherein the mitochondrial COX1 gene sequence of the paragonimus westermani is shown as SEQ ID NO. 7; the mitochondrial COX1 gene sequence of the paragonimus schlegelii is shown as SEQ ID NO. 8.

3. The use of a kit according to claim 1 or 2 for the differential identification of paragonimus westermani and paragonimus coenurosis, characterized in that: and (3) taking the genomic DNA of the cysticercosis to be detected and separated as a template, uniformly mixing the genomic DNA with DNA polymerase, buffer solution, sterilized ultrapure water, detection primers and specific probes in the kit according to a proportion, carrying out real-time quantitative PCR detection, and determining the type of the cysticercosis according to the Ct value of a reaction curve, thereby judging whether the stream crab is infected by paragonimiasis sinensis cysticercosis or paragonimiasis cysticercosis.