CN111808973A - Kit for identifying tripartite paragonium metacercaria and using method - Google Patents

Kit for identifying tripartite paragonium metacercaria and using method Download PDF

Info

Publication number
CN111808973A
CN111808973A CN202010783007.0A CN202010783007A CN111808973A CN 111808973 A CN111808973 A CN 111808973A CN 202010783007 A CN202010783007 A CN 202010783007A CN 111808973 A CN111808973 A CN 111808973A
Authority
CN
China
Prior art keywords
tripartite
kit
probe
dna
cysticercus
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202010783007.0A
Other languages
Chinese (zh)
Inventor
郑彬
陈韶红
卢艳
蔡玉春
艾琳
宋鹏
陈家旭
周晓农
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
National Institute of Parasitic Diseases of Chinese Center for Disease Control and Prevention
Original Assignee
National Institute of Parasitic Diseases of Chinese Center for Disease Control and Prevention
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by National Institute of Parasitic Diseases of Chinese Center for Disease Control and Prevention filed Critical National Institute of Parasitic Diseases of Chinese Center for Disease Control and Prevention
Priority to CN202010783007.0A priority Critical patent/CN111808973A/en
Publication of CN111808973A publication Critical patent/CN111808973A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a kit for identifying tripartite paragonium cysticercus, which comprises an upstream primer for amplifying tripartite paragonium cysticercus DNA, wherein a gene sequence of the upstream primer is shown as SEQ ID NO.1, a downstream primer for amplifying tripartite paragonium cysticercus DNA, wherein a gene sequence of the downstream primer is shown as SEQ ID NO.2, a probe for identifying the tripartite paragonium cysticercus DNA, wherein a gene sequence of the probe is shown as SEQ ID NO.3, a fluorescent group CY is marked at the 5 'end of the probe, and a fluorescence quenching group BHQ2 is marked at the 3' end of the probe. The invention also provides a using method of the kit. The method of the invention has good specificity; the repeatability experiment shows that the detection system provided by the invention has good stability, the variation of the detection result is small, and the control is within the statistical range.

Description

Kit for identifying tripartite paragonium metacercaria and using method
Technical Field
The invention belongs to the field of bioengineering, relates to a kit and a method for detecting parasites, and particularly relates to a kit for identifying tripartite paragonium metacercaria and a using method thereof.
Background
Tripartite paragonimus (triploid)Euparagonimuscenocopiosus) Mainly distributed in mountainous areas of Guangdong, Min, gan, Wan, Zhe, and other provinces of China. The first intermediate host of the life history is Chuanjuan snail, and the second intermediate host is fresh water crabs such as Huaxi crab. The coenuruses of the triphenic euzobium are mainly colonized in the heart of the crab, and individual coenuruses can be in soft tissues in pectoralis, foot muscles or even dorsal shells. In a reported animal experiment, tripartite paragonimus can rapidly develop into a childhood worm and cause pulmonary hemorrhage in rats and mice; the triploid and eupolyphaga can infect experimental dogs, but the time required for the polypide to mature is longer, generally more than three months, and the number of the obtained polypides is small, the migration or colonization part of the polypide in the dogs is cyst on the surface or under the surface layer of abdominal cavity, thoracic cavity and lung, and 1-2 adults can be contained in the cyst. Sanping paragonimus may also infect humans.
Because the cysticercus of the triphase paragonimus, the cysticercus of the paragonimus westermani and the cysticercus of the paralognathus are all parasitic in the fresh water crabs, and in the epidemic area of paragonimiasis, the report that the intermediate host fresh water crabs are simultaneously mixed with the cysticercus of the paragonimus westermani and the cysticercus of the triphase paragonimiasis is reported, a certain difficulty is brought to the morphological identification of the cysticercus of the three paragonimiasis. Although some researchers also adopt conventional molecular biology methods such as PCR (polymerase chain reaction) and the like in the identification of tripartite paragonimus, most of the researches are carried out by taking adults as samples, the adults can be obtained only by animal models, the material consumption in the test process is high, and the recovery rate of the adults is low. The conventional molecular detection method is long in time consumption, expensive in detection instrument and high in requirement on personnel, and can be identified only by training related skills and obtaining on-duty certificates, so that the on-site instant and rapid detection requirement cannot be met.
The real-time fluorescence PCR technology is a high and new detection technology with great development potential at present. Compared with the conventional PCR, the method has the characteristics of short time consumption, strong specificity, high automation degree for effectively solving the problem of PCR pollution and the like, solves the infection process of an animal model, and provides a new method for food inspection of aquatic products by detecting coenuruses in an intermediate host.
Because the existing Sanping paragonimiasis adult sample is difficult to obtain, but the stream crab as an intermediate host is easy to collect. The research establishes a timely and rapid fluorescence quantitative PCR detection method for cysticercus in the brook crab as an intermediate host of the tripartite paragonimus, and develops a new method for detecting the cysticercus of the tripartite paragonimus.
Disclosure of Invention
The invention aims to provide a kit for identifying tripartite paragonium metacercaria and a using method thereof, and aims to solve the technical problem that the method for identifying tripartite paragonium metacercaria in the prior art is low in specificity and sensitivity.
In order to achieve the purpose, the invention adopts the following technical scheme:
a kit for identifying tripartite paragonium metacercaria,
the upstream primer containing DNA of triploid and euzoite has the gene sequence shown in SEQ ID NO.1,
the downstream primer containing DNA of triploid and euzoite has the gene sequence shown in SEQ ID NO.2,
the gene sequence of the probe containing DNA for identifying tripartite paragonium cysticercus is shown in SEQ ID NO.3, and a fluorescent group CY is marked at the 5 'end of the probe and a fluorescence quenching group BHQ2 is marked at the 3' end of the probe.
Furthermore, the kit also comprises a standard positive control plasmid DNA template which corresponds to the mitochondrial COX1 gene of the tripartite paragonimus, and reagents required for real-time quantitative PCR detection, wherein the sequence of the mitochondrial COX1 gene of the tripartite paragonimus is shown as SEQ ID NO. 4.
The invention also provides a use method of the kit for identifying triphase-positive paralytic cysticercosis, which comprises the steps of taking genomic DNA of the coenurosis to be detected as a template, uniformly mixing the genomic DNA with DNA polymerase, buffer solution, sterilized ultrapure water, detection primers and specific probes in the kit according to a proportion, carrying out real-time quantitative PCR detection, and determining the type of the coenurosis according to the Ct value of a reaction curve, thereby judging whether the stream crab is infected by the triphase-positive paralytic cysticercosis.
Specifically, the total volume of the reaction system was 20. mu.L, wherein 10. mu.L of 2-fold reaction buffer (2 XBuffer), 0.5. mu.L of DNase (4U/. mu.L), 0.4. mu.L of each of two primers 10 pmol/. mu.L, 0.4. mu.L of probe 10 pmol/. mu.L, 2. mu.L of template DNA, and 8.3. mu.L of sterile double distilled water. Wherein 2 XBuffer and QRZ DNase adopt TOYOBO THUNDERBIRD Probe one-step qRT-PCR Kit of Toyo Boseki. The detection equipment adopts a real-time fluorescent PCR instrument.
The primer pair and the probe provided by the invention detect the mitochondrial COX1 gene of the triphenne paralogous fasciola in a real-time fluorescent quantitative PCR instrument. The sequence of the mitochondrial COX1 gene is a commonly used target for parasite molecular identification. The COX1 gene sequence belongs to mitochondrial genome, the maternal genetic evolution rate is high, and the method is suitable for analyzing intraspecific genetic difference. The triploid paralogous mouse mitochondrial COX1 gene (GeneBank (TM) accession No. AF 159594.1) was selected and multiple comparisons were made with Mega6.0 and other paralogous insects to select a region conserved in triploid paralogous insects. By comparing the amplification curve (Ct value) generated in the PCR amplification process with the generated standard base line or threshold line (standard curve Ct value), the method achieves the purpose of qualitatively detecting whether the triphibian coenuridae exists in the fresh water stream crab.
The specificity experiment of the invention shows that the method can specifically detect tripartite positive paralogous trematodes respectively, and the probe is not crossed with other parasites and hosts; sensitivity experiments show that the method has wide detection linear range, and can detect the DNA of the tripartite paragonimus at least to be 0.322 copies/mu L; no matter the test is an intra-group repeatability test or an inter-group repeatability test, the variation coefficient of the Ct value is controlled within a statistically effective range, and the stability of the test result of the method is proved to be good.
The invention connects the PCR product of triphase positive paralytic with pMD-18-T carrier, through transforming, extracting plasmid, quantifying, preparing positive quality control standard substance, diluting continuously by 100 times, making 0.322-3.22X 109A positive quality control standard substance of copies/mu L. Taking the standard substance (3.22 × 10) with Ct value of about 2010copies/. mu.L) as a positive template when the assay system was set up. And gradually changing the concentration of each component of the PCR reaction system by adopting a single-factor concentration gradient experiment, optimizing the real-time fluorescence PCR experiment conditions, adjusting the circulating parameters and establishing a two-temperature circulating real-time fluorescence PCR detection method.
According to the quantitative standard curve made from the positive quality control standard substance with different concentration gradients, the invention can show that the logarithm values and Ct values of the quantitative template numbers with different gradients have better correlation, the correlation is 0.9995, and the sensitivity can reach 0.322 copies/mu L; detection of other parasites and healthy hosts and water controls showed that the method had good specificity.
Compared with the prior art, the invention has the advantages that: through one test, an amplification curve (Ct value) generated in the PCR amplification process is compared with a standard base line or a threshold line (standard curve Ct value) generated by using the PCR amplification process, so that a detection signal for qualitatively detecting whether the triphase positive trichlorfon exists in the fresh water stream crab and parasitizing the trematodes is achieved. The method can be applied to the accurate identification of the freshwater creek infected triploid and eupolyphaga fascicularis larva cysticercus, can break through the dependence of the traditional and tedious dissection technology on dissection experience, does not need time-consuming and long waiting, and greatly improves the working efficiency. The detection system provided by the invention has good stability, the variation of the detection result is small, and the control is within the statistical range. The method of the invention has the advantages of rapidness, accuracy, high flux, high sensitivity and strong specificity.
Drawings
FIG. 1 is a comparison diagram of the real-time fluorescence PCR detection technology specificity test (wherein the A diagram curves 1-3: paralogous euonymus coenurus; 4-15: paralogous spedinium steleophaga, triploid fasciola giganteus, clonorchis sinensis, fasciola hepatica, trichina, ascaris, taenia bovis, genomic DNA of rabid muscle and sterile deionized water (2), and the B diagram curves 1-3: paralogous euonymus coenurus; 4-15: paralogous euonymus wegiana, triploid euonymus, fasciola giganteus, fasciola hepatica, trichina, ascaris, tapeworm, genomic DNA of rabid muscle and sterile deionized water (2)).
FIG. 2 is a kinetic curve of fluorescent PCR amplification of positive quality control standards with different copy numbers (from left to right, in sequence: 100-fold dilution of DNA, triploid and quadruplicate trematode dilution gradient 1-6: 3.22X 10)9copies/μo、3.22es/7copies/μo、3.22es/5copies/μo、3.22es/3copies/μo、32.2copies/μo、0.322copies/μ.) 。
FIG. 3 is a real-time fluorescence PCR standard curve.
Detailed Description
The invention will be further illustrated with reference to the following specific examples:
1. and (3) separating cysticercosis:
1.1, measuring the size of the captured stream crabs and dividing the stream crabs into male and female parts;
1.2 respectively cutting the brook crab head, brood limb and foot, putting into a mortar together with the internal organs;
1.3 mashing bamboo tube and bamboo stick (or other similar substitutes);
1.4 washing the mashed sample by using normal saline, filtering by using a 10-mesh screen, and removing crude crab shells;
1.5 filtering the filtrate by using a 40-mesh screen, putting the obtained filtrate in a conical measuring cylinder, adding water to the maximum scale position of the measuring cylinder, and naturally precipitating and washing to obtain clear water;
1.6 sucking all sediments into a glass plate, collecting cysticercosis under a stereoscopic microscope, counting and registering;
1.7 the collected coenuruses are preserved in 75% alcohol or quick frozen in a small amount of physiological saline at-80 ℃.
2. Extracting genome DNA:
2.1 taking 1-10 coenuruses with consistent morphological characteristics, putting the coenuruses into a 1.5mL centrifuge tube, adding 100 mu L PBS and a small amount of glass beads, oscillating for 5-10 min, and then extracting DNA according to a general genome extraction kit;
3. PCR primers and probes: selecting tripartite paragonimus mitochondrial COX1 gene (GeneBank)TMAccession number AF 159594.1), multiple comparisons were made with this gene of other paragonimus, using mega6.0, to screen out regions conserved in tripartite paragonimus, and Primer and probe design was performed using Primer Premier 5.0 software.
Designing a COX1 gene sequence used by a Sanping eupolyphaga fluorescent quantitative primer and a probe:
gggtttggggtggtgagacatatttgtatgactatgaccaaaaatgattccttgtttggctactatggtttggtgtttgccatgggagctattgtgtgtttgggcagtgttgtttgagctcatcacatgtttatggtgggtttagatgttaagactgctgtcttttttagatctgttactggtgtcattgggattcctactgggattaaggttttttcttggttgttcatgctggggggcactcgcttgcggttttgagatcctgtggtgtggtggatattggggtttatctttttgttcaccatagggggtgtgactggaattattttgtcttcctctattttggatagtttgttgcatgatacttggtttgtg, the sequence of the mitochondrion COX1 gene of tripartite paragonium is shown in SEQ ID NO. 4.
ECF: 5'-TGTTTGCCATGGGAGCTATT-3', (shown as SEQ ID NO. 1);
ECR: 5' -GGAATCCCAATGACACCAGTAA, (shown as SEQ ID NO. 2);
probe ECP: 5' -CY-CTCAAACAACACTGCCCAAAC-3-BHQ 2 (shown as SEQ ID NO. 3); the 5 'end is labeled with a fluorescent dye CY, and the 3' end is labeled with a fluorescence quenching group.
4. Preparing a positive quality control standard:
connecting a conventional PCR product of tripartite positive paralytic with a cloning vector PUC57 vector, transforming into escherichia coli DH5 alpha, storing positive recombinant bacteria, preparing plasmids according to the MiniBEST Plasmid Purification Kit instruction and quantifying;
4.1 culturing Escherichia coli, selecting single colony from a plate culture medium, inoculating the single colony into 1-4 mL of liquid culture medium containing antibiotics, and culturing at 37 ℃ overnight;
4.2 taking 1-4 mL of overnight culture bacterial liquid, centrifuging at 12000r/min for 2min, and removing the supernatant;
4.3 thoroughly suspending the bacterial pellet with 250. mu.L of Solution I (lysis reagent I) containing RNaseA 1;
4.4 adding 250 mu L of Solution II (dissolving reagent II) and slightly turning and mixing up and down for 5-6 times to fully crack the thalli to form a transparent Solution;
4.5 adding 400 mu L of 4 ℃ precooled Solution III (dissolving reagent III), slightly turning and mixing for 5-6 times until compact aggregate is formed, and then standing for 2min at room temperature;
4.6 centrifuging at 12000r/min for 10min at room temperature, and taking the supernatant;
4.7 arranging the spin column in the reagent kit on a collecting tube;
4.8 transferring the supernatant obtained in the operation 4.6 to a rotating column, centrifuging at 12000r/min for 1min, and removing the filtrate;
4.9 Add 500. mu.L of Rinse A (Wash A) to spin column, centrifuge at 12000r/min for 30s, discard filtrate;
4.10 Add 700. mu.L of Rinse B (Wash B) to the spin column, centrifuge at 12000r/min for 30s, discard the filtrate;
4.11 repeat operation step 4.10;
4.12 the spin column was placed in a new 1.5mL centrifuge tube, 60. mu.L of sterile distilled water or lysis buffer was added to the center of the spin column membrane, and the mixture was allowed to stand at room temperature for 1 min.
4.1312000 r/min for 1min to elute DNA;
sucking 50 μ L after plasmid extraction, and diluting continuously at 5 or 10 times to obtain positive quality control standard substance with different concentration gradients for quantitative detection, and storing at-20 deg.C;
the specific method for extracting 50 mu L of plasmid and then sucking the plasmid for quantitative detection is as follows: diluting 10 μ L plasmid to 500 μ L, measuring OD260, calculating plasmid mass, and calculating molar concentrationDegree, finally multiplied by the Avogastron constant 6.02 x 1023That is, the number of copies per unit volume, the formula is calculated as: positive plasmid copy number copies/. mu.L ═ OD 260X 50X 10-9X dilution multiple x 6.02 x 1023) /(660 × number of bases) in the formula: 50 represents the corresponding concentration of double stranded DNA of 50. mu.g/mL using a 1cm cuvette at an OD260 of 1; 660 represents the average molecular weight per base pair of double-stranded DNA;
5. establishing and optimizing a reaction system:
pre-testing positive quality control standard substances with different concentration gradients, and selecting the concentration of Ct about 20, which is 3.22 multiplied by 1010copies/. mu.o as a template for system optimization.
The steps of establishing and optimizing the reaction system comprise:
5.1 fluorescent quantitative PCR reaction using the reagent TOYOBO THUNDERBIRD Probe One-step qRT-PCRKit (including 2 x buffer, QRZ DNA enzyme);
5.2 QRZ DNase single factor concentration gradient optimization under the condition of the same other conditions in the reaction system, the dosage of QRZ DNase is 0.25-2 mu L, the dosage is increased by every 0.25 mu L, and the optimal dosage of QRZ DNase is determined to be 0.5 mu L through comparative analysis of test results;
5.3 the optimization of the single-factor concentration gradient of the probe is that under the condition of the same other conditions in a reaction system, the dosage range of the probe is 0.10-0.50 mu L per reaction, the dosage is increased by 0.05 mu L, the repeated tests are compared and analyzed, and the optimal dosage of the probe for each reaction is determined to be 0.40 mu L;
5.4 optimization of primer concentration is that under the condition of the same other conditions in a reaction system, the dosage of the upstream primer and the downstream primer is respectively set to be 0.10-0.90 muL per reaction, the dosage is gradually increased by every 0.10 muL, matrix analysis is carried out, and the optimal primer dosage of each reaction of triphase normal parallel breeding fluke fluorescence quantitative PCR is determined to be that the dosage of the upstream primer and the downstream primer is 0.40 muL;
5.5 determination of cycle parameters: properly adjusting the denaturation time, the annealing temperature, the extension temperature, the time and the cycle number, and selecting the cycle parameter with the shortest detection time and the best amplification curve as the temperature and time parameter of the PCR, namely, pre-denaturation at 95 ℃ for 1 min; denaturation at 95 ℃ for 15s, annealing extension at 60 ℃ for 30s, 40cycles, and collection of fluorescence signal at 60 ℃.
The primers and the probes are used for establishing a reaction system, and finally, the adopted tripartite positive parallel breeding real-time fluorescent PCR detection system is determined to be 20 mu L, and the required components and the corresponding dosage are as follows:
6. the PCR amplification reaction system is as follows:
sterile double distilled water 8.3 mu L
10. mu.L of 2-fold reaction buffer (2 XBuffer)
Primer 1(10 pmol/. mu.L) 0.4. mu.L
Primer 2(10 pmol/. mu.L) 0.4. mu.L
Probe (10 pmol/. mu.L) 0.4. mu.L
Template DNA 2. mu.L
QRZ DNase (4U/. mu.l) 0.5. mu.L
The reaction conditions are as follows: pre-denaturation at 95 ℃ for 1 min; denaturation at 95 ℃ for 15s, annealing and extension at 60 ℃ for 30s, 40 cycles; 5min at 40 ℃, 1 cycle; the fluorescence signal was collected at 60 ℃.
Connecting the PCR product of triploid normal and parallel breeding with pMD-18-T vector, converting, extracting plasmid, quantifying, preparing positive quality control standard substance, diluting with 100 times of the total amount, and making into 0.322-3.22 × 109Taking the positive quality control standard of copies/mu L, and taking the standard with the Ct value of about 20 (3.22 multiplied by 10)10copies/. mu.L) as a positive template when the assay system was set up. And gradually changing the concentration of each component of the PCR reaction system by adopting a single-factor concentration gradient experiment, optimizing the real-time fluorescence PCR experiment conditions, adjusting the circulating parameters and establishing a two-temperature circulating real-time fluorescence PCR detection method.
6. Specificity test
The established tripartite paragonimus real-time fluorescence PCR detection method is used for detecting genome DNA and water control of muscles of paragonimus westermani, paralgonium sturti, fasciola gigas, clonorchis sinensis, fasciola hepatica, trichinella, ascaris, tapeworm and crab, so as to explore the detection specificity of the method.
As shown in figure 1, the invention uses the genomic DNA of paragonimus westermani, paragonimus stelensis, tripartite paragonimus, fasciola gigantica, clonorchis sinensis, fasciola hepatica, trichina, ascaris, taenia bovis and rabid crab muscles to carry out experiments respectively so as to explore the specificity of the detection by the method. Wherein, the curve of the graph A is 1-3: paragonimus westermani cysticercus; 4-15: paralogous fasciola, triploid fasciola, fasciola gigantica, clonorchis sinensis, fasciola hepatica, trichina, ascaris, taenia bovis, genomic DNA of crab muscle, and sterile deionized water (2); curves 1-3 of the B diagram: paralymus spinosus metacercaria; 4-15: the kit comprises genome DNA of paragonimus westermani, triploid paragonimus, fasciola gigantica, clonorchis sinensis, fasciola hepatica, trichina, ascaris, tapeworm of cattle, and crab muscle, and sterile deionized water (2). As a result, only triploid paralymphoids can detect an amplification curve, and other parasites and healthy hosts have no increase of fluorescence signals, the method is proved to have good detection specificity and universality.
7. Sensitivity test
7.1 taking the prepared positive quality control standard substance with different concentration gradients as a PCR template, amplifying on a fluorescence PCR instrument according to the PCR reaction system and the reaction program, obtaining Ct values with different copy numbers through computer analysis, drawing a standard curve according to the Ct values and the logarithm of the corresponding copy numbers, and calculating the amplification efficiency, wherein E is 10-1/K-1, wherein the K value is the slope of the standard curve.
7.2 two positive plasmids of paragonimus are diluted 100 times (triploid paragonimus dilution gradient 0.322-3.22X 10)9copies/μ L), a sensitivity experiment is carried out by adopting the method established in the research, and the experimental result shows that: the sensitivity of the two methods for identifying and detecting the paragonimus monofluorescence quantitative PCR respectively reaches 32.1 copies/mu L of triploid paragonimus.
As shown in FIG. 2, tripartite paragonimus DNA was diluted 100-fold with a dilution gradient of 1-6: 3.22X 109copies/μL、3.22×107copies/μL、3.22×105copies/μL、3.22×103copies/μL、32.2copies/μL、0.322copies/. mu.L. Taking 1 mu L of the positive quality control standard substance with the concentration, taking sterilized double distilled water as negative control, carrying out amplification reaction, and displaying that the cycle number (Ct) required by the fluorescence signal in each reaction tube reaching the threshold value and the logarithm of the initial template copy number have obvious linear relation (R)2=0.9995), the data points of the positive quality control standard on the standard curve are well fitted with the curve.
As shown in FIG. 3, it is a Tri-planar parallel-cultured real-time fluorescence PCR standard curve, R2=0.9995, amplification efficiency E =105.40%, Y = -6.3993x + 33.957. NTC (no template control) no template control has no fluorescence amplification curve, and is a negative result, which indicates that the method has extremely high sensitivity.
8. Repeatability test
8.1 and 3 multi-tube simultaneous detection is carried out on the same positive quality control standard, the variation coefficient of the Ct value is calculated, and the repeatability and the stability of the detection method are inspected.
8.2 the positive quality control standard substance with different concentration gradients detected in the sensitivity test is re-detected after being stored for 30 days at the temperature of minus 20 ℃, Ct values detected twice are subjected to comparative hypothesis test, whether the obvious difference exists is observed, and the stability of the detection by the method is inspected.
The real-time fluorescence PCR is repeated for 3 times to detect the same positive quality control standard substance, and the variation coefficient of the Ct value obtained by detection is 2.4 percent; the positive quality control standard substances of the same batch with different concentration gradients are detected twice (at an interval of 30d), the Ct values obtained by detection have no obvious difference through comparison hypothesis test, and the method has good repeatability and stability.
Sequence listing
<110> Chinese disease prevention and control center for prevention and control of parasitic diseases institute (national center for research on tropical diseases)
<120> kit for identifying tripartite paragonimiasis metacercaria and using method
<160>4
<170>SIPOSequenceListing 1.0
<210>1
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
tgtttgccat gggagctatt 20
<210>2
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
ggaatcccaa tgacaccagt aa 22
<210>3
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
ctcaaacaac actgcccaaa c 21
<210>4
<211>375
<212>DNA
<213> triplanatus euplophora (Euparagonimus cenocopiosum Chen)
<400>4
gggtttgggg tggtgagaca tatttgtatg actatgacca aaaatgattc cttgtttggc 60
tactatggtt tggtgtttgc catgggagct attgtgtgtt tgggcagtgt tgtttgagct 120
catcacatgt ttatggtggg tttagatgtt aagactgctg tcttttttag atctgttact 180
ggtgtcattg ggattcctac tgggattaag gttttttctt ggttgttcat gctggggggc 240
actcgcttgc ggttttgaga tcctgtggtg tggtggatat tggggtttat ctttttgttc 300
accatagggg gtgtgactgg aattattttg tcttcctcta ttttggatag tttgttgcat 360
gatacttggt ttgtg 375

Claims (3)

1. A kit for identifying tripartite paragonium metacercaria, comprising:
the upstream primer contains DNA of triploid and eupolyphaga cysticercus, and the gene sequence is shown in SEQ ID NO. 1;
the downstream primer contains DNA of triploid and eupolyphaga cysticercus, and the gene sequence is shown in SEQ ID NO. 2;
the probe contains DNA for identifying triphibian paragonimiasis cysticercus, the gene sequence of the probe is shown as SEQ ID NO.3, a fluorescent group CY is marked at the 5 'end of the probe, and a fluorescence quenching group BHQ2 is marked at the 3' end of the probe.
2. The kit for identifying tripartite paragonimiasis cysticercus according to claim 1, wherein: the kit also comprises a standard positive control plasmid DNA template corresponding to the mitochondrial COX1 gene of the tripartite paragonimus, and reagents required for real-time quantitative PCR detection, wherein the sequence of the mitochondrial COX1 gene of the tripartite paragonimus is shown as SEQ ID NO. 4.
3. The use method of the kit for identifying tripartite paragonimus coenurus according to claim 1 or 2, wherein: and (3) taking the genomic DNA of the cysticercosis to be detected and separated as a template, uniformly mixing the genomic DNA with DNA polymerase, buffer solution, sterilized ultrapure water, detection primers and a specific probe in the kit in proportion, carrying out real-time quantitative PCR detection, and determining the type of the cysticercosis according to the Ct value of a reaction curve, thereby judging whether the stream crab is infected with the cysticercosis cellulosae.
CN202010783007.0A 2020-08-06 2020-08-06 Kit for identifying tripartite paragonium metacercaria and using method Pending CN111808973A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010783007.0A CN111808973A (en) 2020-08-06 2020-08-06 Kit for identifying tripartite paragonium metacercaria and using method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010783007.0A CN111808973A (en) 2020-08-06 2020-08-06 Kit for identifying tripartite paragonium metacercaria and using method

Publications (1)

Publication Number Publication Date
CN111808973A true CN111808973A (en) 2020-10-23

Family

ID=72864232

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010783007.0A Pending CN111808973A (en) 2020-08-06 2020-08-06 Kit for identifying tripartite paragonium metacercaria and using method

Country Status (1)

Country Link
CN (1) CN111808973A (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103773861A (en) * 2014-01-13 2014-05-07 深圳澳东检验检测科技有限公司 Clonorchiasis sinensis and angiostrongyliasis cantonensis real-time fluorescence PCR (Polymerase Chain Reaction) detection reagent, and kit and detection method thereof
CN104561264A (en) * 2014-11-21 2015-04-29 深圳市疾病预防控制中心 Clonorchis sinensis real-time fluorescence polymerase chain reaction (PCR) detection kit and detection method
CN108410957A (en) * 2018-05-28 2018-08-17 西安博睿康宁生物科技有限公司 Fluorescence PCR primer, probe and detection kit for detecting mycoplasma genitalium
CN110734995A (en) * 2019-12-17 2020-01-31 首都医科大学附属北京友谊医院 primer pairs and probes for detecting leishmania, detection method and kit
CN110791570A (en) * 2019-10-30 2020-02-14 浙江省医学科学院 Primer group and kit for simultaneously detecting Wei-type, Si-type and heterodiscal paragonimiasis

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103773861A (en) * 2014-01-13 2014-05-07 深圳澳东检验检测科技有限公司 Clonorchiasis sinensis and angiostrongyliasis cantonensis real-time fluorescence PCR (Polymerase Chain Reaction) detection reagent, and kit and detection method thereof
CN104561264A (en) * 2014-11-21 2015-04-29 深圳市疾病预防控制中心 Clonorchis sinensis real-time fluorescence polymerase chain reaction (PCR) detection kit and detection method
CN108410957A (en) * 2018-05-28 2018-08-17 西安博睿康宁生物科技有限公司 Fluorescence PCR primer, probe and detection kit for detecting mycoplasma genitalium
CN110791570A (en) * 2019-10-30 2020-02-14 浙江省医学科学院 Primer group and kit for simultaneously detecting Wei-type, Si-type and heterodiscal paragonimiasis
CN110734995A (en) * 2019-12-17 2020-01-31 首都医科大学附属北京友谊医院 primer pairs and probes for detecting leishmania, detection method and kit

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
胡坤敏等: "豫皖闽浙4 省溪蟹并殖吸虫囊蚴核糖体ITS2 和线粒体CO1 基因序列分析", vol. 38, no. 1, pages 89 *
赵昕等: "卫氏并殖吸虫PCR和实时荧光PCR快速检测方法的建立" *

Similar Documents

Publication Publication Date Title
CN102146466B (en) Reagent for detecting brucella and complex probe fluorescence quantitative PCR (polymerase chain reaction) brucella detection method
CN111719004A (en) Kit for distinguishing and identifying paragonimus westermani cysticercus and paragonimus cysticercus and using method
CN105039586A (en) Primer and kit for detecting duck type-II adenovirus
CN112080584A (en) Primer, probe, kit and method for detecting largemouth black bass virus
CN111676296A (en) Test strip RPA primer for detecting potato rot stem nematode and detection kit thereof
CN101613751A (en) The PCR kit for fluorescence quantitative of rapid detection toxoplasma gondii
CN109439801B (en) Real-time fluorescence RT-PCR detection kit and detection method for israel acute paralysis virus of bees
CN105176980B (en) A kind of multiple PCR method that can synchronously detect 7 kinds of fishes virus
CN111485034A (en) Fluorescent quantitative RT-PCR method for detecting fish viral nervous necrosis and corresponding kit
CN112159851A (en) Molecular identification method of eleutheronema tetradactylum and eleutheronema tetradactylum based on COI gene sequence
CN109628640B (en) RPA-LFD primer, method and kit for rapidly detecting spring viremia of carp virus
CN116694826A (en) Multiplex PCR primer probe combination and method for simultaneously detecting WSSV, IHHNV, EHP and NHP
CN111808973A (en) Kit for identifying tripartite paragonium metacercaria and using method
CN110607398A (en) RT-LAMP kit for fluorescent visual rapid detection of porcine epidemic diarrhea virus
CN113430274B (en) RPA primer, probe, kit and method for detecting liver enterocytozoon
CN112410437B (en) Real-time fluorescence quantitative PCR method for detecting trichina in sheep meat product
CN111500773B (en) Fluorescent quantitative RT-PCR primer, probe and kit for identification of serotype of epidemic hemorrhagic disease virus
CN110157836B (en) Primer, probe and method for detecting IBRV and BVDV
Zhu et al. Onsite and visual detection of ranavirus in largemouth bass (Micropterus salmoides) by an isothermal recombinase polymerase amplification method
CN109762941B (en) Liquid chip for detecting poultry death pathogen
CN103397106A (en) Hybrid snakehead rhabdovirus fluorescent quantitative PCR (polymerase chain reaction) detection kit and detection method thereof
CN111996268A (en) Vibrio alginolyticus double TaqMan probe real-time fluorescent quantitative PCR (polymerase chain reaction) detection kit and preparation method thereof
CN111926090A (en) Specific primer, probe and kit for detecting mactra veneriformis in freshwater environment
CN113621719B (en) Rapid detection method and application of Edwardsiella tarda
CN111270009B (en) Cyprinus carpioviridae TaqMan real-time fluorescent quantitative RT-PCR detection primer and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20201023

RJ01 Rejection of invention patent application after publication