CN111926090A

CN111926090A - Specific primer, probe and kit for detecting mactra veneriformis in freshwater environment

Info

Publication number: CN111926090A
Application number: CN202010943818.2A
Authority: CN
Inventors: 战爱斌; 黄雪娜; 夏志强; 李世国; 熊薇
Original assignee: Research Center for Eco Environmental Sciences of CAS
Current assignee: Research Center for Eco Environmental Sciences of CAS
Priority date: 2020-09-09
Filing date: 2020-09-09
Publication date: 2020-11-13

Abstract

A specific primer, a probe and a kit for detecting mactra veneriformis in a fresh water environment. The invention develops and obtains species-specific primers and probes aiming at the cytochrome c oxidase I gene (COI gene) of the mactra veneriformis, optimizes a fluorescent PCR reaction system and a reaction program, ensures that the kit has good species specificity and high sensitivity, and records a related detection method. The invention provides effective technical support for early monitoring and early warning of the mactra veneriformis in the freshwater environment.

Description

Specific primer, probe and kit for detecting mactra veneriformis in freshwater environment

Technical Field

The invention belongs to the technical field of environmental molecular detection, and particularly relates to a specific primer, a probe and a kit for detecting mactra veneriformis in a freshwater environment based on environmental DNA (eDNA), and a specific detection method is recorded, aiming at monitoring and early warning disaster organisms mactra veneriformis in the freshwater environment.

Background

The mactra veneriformis (Limnoperna fortunei) is also called golden mussel or Limnoperna lacustris, is a fresh water bivalve shellfish with small body type and has strong invasiveness and fouling. The mactra is originally produced in fresh water rivers and lakes in south of the Yangtze river and southeast Asia of China, and gradually invades all over the world in recent years. The marsh clams are distributed in southern areas of China, and the field investigation in recent years finds that the marsh clams successfully invade Jingjin Ji areas, while the development and construction of some large-scale water delivery projects can be a main approach for the invasion of marsh clams. Once the marsh clams are successfully invaded, the marsh clams are rapidly expanded and spread in a new water body environment, and a serious biofouling phenomenon is generated. On one hand, the invasion and the fouling of the marsh clams can quickly change the biological community structure of an invaded water area, and threaten the health and the stability of an aquatic ecosystem; on the other hand, the clams are adhered to the surfaces of some important water conservancy facilities, so that equipment corrosion, pipeline blockage and water body pollution are caused, and huge economic loss is caused. At present, effective measures for treating the problems of invasion and fouling of the clams are lacked, so that the establishment of an early detection and early warning system is the most direct and effective way for preventing and controlling ecological disasters of the clams, wherein the first problem is the detection of the clams in a water environment.

Due to the characteristics that the population scale of the marsh clam in the initial stage of invasion is extremely small, the marsh clam is often hidden under water, and individuals in the planktonic larva stage of the marsh clam slightly lack obvious external morphological characteristics, the detection of low-abundance invaded marsh clam from a complex aquatic population becomes the key for constructing the early detection/monitoring method of the marsh clam. Therefore, aiming at the current situation of invasion of the mactra veneriformis in an aquatic ecosystem, the development of a fluorescent PCR detection kit and a detection method of the mactra veneriformis based on an environmental DNA technology is urgently needed.

Disclosure of Invention

In view of the above, the main objective of the present invention is to provide a specific primer, probe and kit for detecting mactra veneriformis in a fresh water environment, so as to at least partially solve at least one of the above mentioned technical problems.

The invention realizes the purpose through the following technical scheme:

as one aspect of the invention, a specific primer for detecting mactra veneriformis in a freshwater environment is provided, and comprises a forward primer shown as SEQ ID NO.1 and a reverse primer shown as SEQ ID NO. 2.

As another aspect of the invention, a fluorescent PCR probe for detecting mactra veneriformis in a freshwater environment is provided, and the probe is a Taqman probe shown as SEQ ID NO. 3; the 5 'end of the probe sequence is marked with a fluorescent group, and the 3' end of the probe sequence is marked with a quenching group.

As a further aspect of the invention, a fluorescent PCR kit for detecting mactra veneriformis in a fresh water environment is provided, which comprises the specific primers as described above and the fluorescent PCR probe as described above.

As a further aspect of the invention, a fluorescence PCR detection method for detecting mactra veneriformis in a fresh water environment is provided, which comprises the following steps: extracting environmental DNA of a water sample to be detected; performing fluorescent PCR amplification detection by using the extracted environmental DNA as a template and the specific primer and the fluorescent PCR probe; analyzing the fluorescence PCR amplification detection result of the environmental DNA template, and judging whether the water sample to be detected contains the mactra veneriformis nucleic acid.

As a further aspect of the invention, the application of the fluorescent PCR kit in detecting the nucleic acid of the mactra veneriformis in the environment is provided.

Based on the technical scheme, the specific primer, the probe and the kit for detecting the mactra veneriformis in the freshwater environment have at least one or one part of the following beneficial effects:

(1) the invention provides a specific primer and a probe for detecting the mactra veneriformis in a fresh water environment and a detection kit utilizing or comprising the specific primer and the probe, and the kit has the advantages of strong specificity, high sensitivity, good repeatability, stable and reliable result and capability of accurately detecting the mactra veneriformis;

(2) the invention provides a method for rapidly detecting mactra veneriformis in water environment by utilizing an environmental DNA technology, and compared with the traditional field ecological investigation method, the method has the characteristics of strong specificity, high sensitivity, time and labor saving and high efficiency. The invention provides technical support for early detection/monitoring and early warning of the mactra veneriformis in the freshwater environment.

Drawings

FIG. 1 shows the amplification efficiency test results of the fluorescent quantitative PCR detection kit for Meretrix meretrix Linnaeus according to the embodiment of the present invention, wherein the standard substance is gradually diluted to 1.50 × 10 from left to right¹⁰ copies/μL、1.50×10⁹ copies/μL、1.50×10⁸copies/μL、1.50×10⁷ copies/μL、1.50×10⁶ copies/μL、1.50×10⁵ copies/μL、1.50×10⁴ copies/μL、1.50×10³ copies/μL、1.50×10²Amplification curves and negative controls for copies/. mu.L;

FIG. 2 is a COI gene standard curve of the mactra veneriformis detected by fluorescence in the embodiment of the invention;

FIG. 3 shows the application of the present invention in the detection of Meretrix meretrix Linnaeus in 15 typical water areas in the field.

Detailed Description

In order that the objects, technical solutions and advantages of the present invention will become more apparent, the present invention will be further described in detail with reference to the accompanying drawings in conjunction with the following specific embodiments.

In the process of implementing the invention, the inventor utilizes the environmental DNA technology to detect specific segments in the gene aiming at the specific primers of the gene of the mitochondrial cytochrome c oxidase I (COI gene) of the mactra veneriformis so as to identify whether the mactra veneriformis exists in the environment and quantify the nucleic acid of the mactra veneriformis. The environmental DNA (environmental DNA, eDNA) refers to DNA directly extracted from an environmental sample (such as a water body), is the sum of DNA left in the environment by different species, and then utilizes a specific gene identification fragment of a species to be detected to efficiently, specifically and sensitively detect whether the environmental DNA contains the gene identification fragment of the species to be detected by a molecular biology means such as a fluorescent quantitative PCR technology, so as to judge the distribution condition of the species to be detected in a sampling environment.

Specifically, the invention provides a specific primer for detecting mactra veneriformis in a freshwater environment, which is designed based on a mitochondrial COI gene of mactra veneriformis, wherein the length of an amplification product is 197bp and comprises a forward primer LFF and a reverse primer LFR, wherein:

the sequence of the forward primer LFF is: 5'-AGAACCCCAGCAGTTGACATAG-3' are provided.

The reverse primer LFR sequence is: 5'-CCACCTAGAACTGGTAGTGAAACTAAC-3' are provided.

The invention also provides a fluorescent PCR probe LF-probe for detecting the mactra veneriformis in the freshwater environment, the probe LF-probe is a Taqman probe, and the sequence is as follows: 5'-CTCTTCATTTAGCTGGTGCGTCGTC-3', wherein the probe LF-probe is labeled with a fluorophore FAM at the 5 'end and a fluorescence quencher BHQ1 at the 3' end.

The invention also provides a fluorescent PCR kit for detecting the mactra veneriformis in the freshwater environment, which comprises the specific primer and the fluorescent PCR probe, and the combination of the specific primer and the fluorescent PCT probe has strong specificity, good repeatability and high sensitivity, and can accurately detect the mactra veneriformis nucleic acid in the freshwater environment.

In some embodiments, the kit further comprises a pre-mix of reaction buffer and Taq enzyme, a positive control, and a negative control; wherein the positive control is in vitro recombinant plasmid of the amplified fragment of the mactra objective; the negative control was sterilized deionized water.

The invention also provides a fluorescence PCR detection method for detecting the mactra veneriformis in the freshwater environment, which comprises the following steps: extracting environmental DNA of a water sample to be detected; performing fluorescence PCR amplification detection by using the extracted environmental DNA as a template and the specific primer and the fluorescence PCR probe; analyzing the fluorescence PCR amplification detection result of the environmental DNA template, and judging whether the water sample to be detected contains the mactra veneriformis nucleic acid.

In some embodiments, the reaction system used for the fluorescent PCR amplification assay comprises: 10 μ L of

qPCR Master Mix, 6.8. mu.L of nucleic-Free Water, 200nM final forward, reverse and fluorescent PCR probes, respectively, and 2. mu.L of ambient DNA template.

In some embodiments, the reaction procedure for the fluorescent PCR amplification detection is: pre-denaturation at 95 ℃ for 120 s; denaturation at 95 ℃ for 15s, annealing at 60 ℃ and extension for 60s for 45 cycles. Under the reaction system and the reaction program, the method has good species specificity and high sensitivity.

In some embodiments, the fluorescence PCR amplification detection uses in vitro recombinant plasmid of the amplified fragment of the mactra as a positive control, and uses sterilized deionized water as a negative control to obtain the amplification curves and Ct values of the environmental DNA template, the positive control and the negative control, respectively. The Ct value is the amplification cycle number when the fluorescence signal of the amplification product reaches a set threshold value in the PCR amplification process, and has a linear relation with the logarithm of the initial copy number concentration of the template.

In some embodiments, the criteria for determining whether the test water sample contains mactra nucleic acid are: the positive control shows an S-shaped amplification curve, the negative control has no amplification curve and no Ct value, and if the water sample to be detected shows the S-shaped amplification curve, the existence of the mactra nucleic acid in the water sample to be detected is judged; and if the water sample to be detected does not have an S-shaped amplification curve and does not have a Ct value, judging that no mactra nucleic acid exists in the water sample to be detected.

In some embodiments, the fluorescence PCR detection method further comprises a step of quantitative detection of the mactra nucleic acid:

taking in-vitro recombinant plasmids of the amplified fragments of the mactra as standard products, and carrying out fluorescence PCR amplification detection on the standard products with different copy number concentrations by utilizing the specific primers and the fluorescence PCR probes to obtain Ct values;

drawing a standard curve by the logarithmic value and the Ct value of the different copy number concentrations of the standard substance, and comparing the fluorescence PCR amplification detection result of the environmental DNA template with the standard curve to obtain the copy number concentration of the mactra veneriformis nucleic acid in the water sample to be detected, wherein the copy number concentration of the mactra veneriformis nucleic acid reflects the existence quantity of the mactra veneriformis in the water sample to be detected.

The technical solutions of the present invention are described in detail below with reference to specific embodiments, and it should be noted that the specific embodiments below are only examples and are not intended to limit the present invention. The test methods used in the following examples are, unless otherwise specified, conventional methods; the materials, reagents and the like used are commercially available reagents and materials unless otherwise specified.

The primers and probes referred to in the following examples were synthesized by Beijing Rui Boxing Ke Biotechnology, Inc., and dissolved in sterilized deionized water to a final concentration of 10. mu.M before use; fluorescent quantitative PCR reagent

qPCR Master Mix was purchased from Promega (Beijing) Biotechnology Inc.; the water environment DNA in example 3 was collected from 15 samples in the field water ecological survey of 8 months in 2019; the main instrument involved in the examples was a Roche LightCycler 96 fluorescence quantitative PCR instrument.

Example 1: design and screening of specific primers and probes for species of mactra veneriformis

Downloading all mactra veneriformis mitochondrial COI gene sequences with the length of more than 500bp and other species COI sequences with the consistency of more than 70 percent with the mactra veneriformis COI sequences from an NCBI website. And performing multi-sequence comparison on the sequences by using MEGA software, and designing a plurality of pairs of specific primers of the mactra veneriformis species in a sequence conserved region of the mactra veneriformis of a target species and in a variation region of other species. Through the verification of amplification efficiency, specificity and sensitivity, a group of species specific primers of the mactra veneriformis DNA in the efficient amplification environment is screened out, and the amplification product is 197 bp. Then, a Taqman probe is designed in the amplification region, and the base sequence of the Taqman probe is shown as follows:

the sequence of the forward primer LFF is shown as SEQ ID NO. 1: 5'-AGAACCCCAGCAGTTGACATAG-3', respectively;

the sequence of the reverse primer LFF is shown as SEQ ID NO. 2: 5'-CCACCTAGAACTGGTAGTGAAACTAAC-3', respectively;

the sequence of the probe LF-probe is shown as SEQ ID NO. 3: 5 'FAM-CTCTTCATTTAGCTGGTGCGTCGTC-3' BHQ 1.

Based on the design of the specific primer, the primer binding site on the DNA template of the mactra is different from other species of similar subjects, and because only the mactra species exist in the mactra genus in which the mactra is located in the freshwater environment, the specificity of PCR detection of the mactra is ensured.

Example 2: verification of sensitivity and amplification efficiency of fluorescent PCR detection of mactra veneriformis

(1) Preparation of standards

In order to verify the amplification efficiency and detection line of the screened primers and draw a standard curve of fluorescence quantitative PCR, the DNA of the muscle tissue of the mactra veneriformis is taken as a template, and the primers are used for carrying out PCR amplification on the target amplification sequence of the mactra veneriformis. The amplification product was then ligated into a vector and transformed into DH 5. alpha. E.coli competent cells. Selecting positive clones, carrying out bacterial liquid amplification culture and plasmid extraction to obtain a recombinant plasmid vector containing a target amplification fragment; and (3) determining the concentration of the plasmid by using a Nanodrop2000 nucleic acid tester, and converting the concentration of the plasmid into the copy number according to a formula, thus obtaining the mactra veneriformis positive standard substance with known copy number concentration.

(2) Establishment of fluorescence quantitative PCR detection method based on mactra veneriformis positive standard substance

Diluting the mactra veneriformis positive standard substance with known copy number concentration to 1.50 × 10¹⁰ copies/μL、1.50×10⁹copies/μL、1.50×10⁸ copies/μL、1.50×10⁷ copies/μL、1.50×10⁶ copies/μL、1.50×10⁵ copies/μL、1.50×10⁴ copies/μL、1.50×10³ copies/μL、1.50×10² copies/μL、1.50×10¹And (3) performing fluorescent quantitative PCR amplification on the mactra veneriformis positive standard product gradient dilution prepared in the step (1) of the example 2 by using the primer pair and the probe described in the example 1, wherein the amplification system is 20 mu L and comprises the following steps: 10 μ L of

qPCR Master Mix, 6.8. mu.L of nucleic-Free Water, forward primer LFF, reverse primer LFR and probe LF-probe all at 200nM final concentration, and 2. mu.L of DNA template. The fluorescent quantitative PCR amplification procedure is as follows: pre-denaturation at 95 ℃ for 120 s; denaturation at 95 ℃ for 15s, annealing at 60 ℃ and extension for 60s for 45 cycles.

Sequencing and detecting the PCR amplification product, wherein the sequencing result is shown as SEQ ID NO. 4: AGAACCCCAGCAGTTGACATAGCTGCTTTATCTCTTCATTTAGCTGGTGCGTCGTCAATTGGCGGTTCGTTAAATTATATTACTAGTATAAAAAATATACCTGTTAAAGAAATGCGTGGTGAGCGTTTAATATTGTTTGTGTGGTCTCTTGCAGTTACATCTGTTTTGTTGTTAGTTTCACTACCAGTTCTAGGTGG, respectively; the amplification curve obtained by detection is shown in FIG. 1, and the standard substance is diluted to 1.50 × 10 in a gradient manner from left to right¹⁰ copies/μL、1.50×10⁹ copies/μL、1.50×10⁸ copies/μL、1.50×10⁷ copies/μL、1.50×10⁶ copies/μL、1.50×10⁵ copies/μL、1.50×10⁴ copies/μL、1.50×10³ copies/μL、1.50×10²Amplification curves and negative controls for copies/. mu.L;

and (3) verifying amplification efficiency: drawing a standard curve according to the amplification curve result, wherein the result is shown in FIG. 2, and the obtained regression equation of the standard curve is as follows: y-3.5107 x +43.64, where x is the logarithm of the initial copy number concentration, Y is the Ct value, correlation coefficient (R)²) The amplification efficiency is 1.00 and 97 percent, which shows that the designed primer and probe have high amplification efficiency and binding rate and proper optimized reaction conditions.

And (3) sensitivity verification: diluting positive standard substance with known concentration to 150copies/μ L, 100copies/μ L, 50copies/μ L, 25copies/μ L, 15copies/μ L, repeating detection for 10 times according to fluorescent quantitative PCR detection method and system, and determining the lowest detection line according to the standard with positive rate more than or equal to 90%. The results indicated that the template was 100% positive at 50copies and 80% positive at 25copies, so the minimum number of copies detected for this method was 50.

Example 3: application of detecting mactra veneriformis in freshwater environment by using the invention

(1) Water environment sample collection and enrichment

Water samples were collected in 8 months in 2019 in 15 typical water areas in the wild. A sampling person wears gloves and uses a 1L sterile plastic sampling bottle, the bottle mouth faces to the upstream water incoming direction, and a water sample is collected at a position 5-10cm below the sampling point. After the sampling bottles are filled with water, the sampling bottles are covered with bottle caps, sealed and marked, and then placed on ice or a vehicle-mounted refrigerator to be transported back to a laboratory. And all water samples are subjected to suction filtration on the day of sample collection, and are stored at 4 ℃ for no more than 24 hours. The water sample was suction filtered using a 0.45 μm mixed cellulose ester filter with a 47mm diameter pore size and a vacuum pump.

(2) Environmental DNA extraction

Shearing the collected filter membrane to 1-3mm with sterilizing scissors²The fragments of (4) were placed in a 1.5mL centrifuge tube according to QIAGEN DNeasy Blood&And (3) performing instructions of the Tissue DNA extraction kit to extract the water sample environment DNA. The environmental DNA concentration was determined using ultraviolet spectrophotometer detection (Nanodrop 2000).

(3) Fluorescent quantitative PCR detection of environmental DNA

The fluorescent quantitative PCR detection method established in example 2 was used to amplify the DNA sample in water environment, and the amplification curve and Ct value were obtained using the recombinant plasmid as a positive control and sterilized double distilled water as a negative control.

Analysis of detection results

The amplification results are shown in FIG. 3: the method is characterized in that the method detects the mactra veneriformis in 15 typical water environments in the field by a fluorescent quantitative PCR method, 3 sampling points are found to be masculine mactra nucleic acid, the 3 sampling points show that the mactra veneriformis exists in the 3 sampling points, and the copy number concentration of the mactra veneriformis nucleic acid measured according to the Ct value and the standard curve is that each microliter of environment DNA contains 132, 57 and 75 copies of the gene COI of the mactra veneriformis. The early warning of the outbreak of the clams can be provided for the three water areas with positive detection of the clams by the embodiment.

The above-mentioned embodiments are intended to illustrate the objects, technical solutions and advantages of the present invention in further detail, and it should be understood that the above-mentioned embodiments are only exemplary embodiments of the present invention and are not intended to limit the present invention, and any modifications, equivalents, improvements and the like made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A specific primer for detecting mactra veneriformis in a freshwater environment is characterized in that: comprises a forward primer shown as SEQ ID NO.1 and a reverse primer shown as SEQ ID NO. 2.

2. A fluorescent PCR probe for detecting mactra veneriformis in a freshwater environment is characterized in that: the probe is a Taqman probe shown as SEQ ID NO. 3;

the 5 'end of the probe sequence is marked with a fluorescent group, and the 3' end of the probe sequence is marked with a quenching group.

3. The fluorescent PCR probe of claim 2, wherein the fluorophore is FAM; the quenching group is BHQ 1.

4. A fluorescence PCR kit for detecting mactra veneriformis in a freshwater environment is characterized in that: comprising specific primers according to claim 1, and fluorescent PCR probes according to claim 2.

5. The fluorescent PCR kit of claim 4, wherein: the kit also comprises a premixed solution of a reaction buffer solution and Taq enzyme, a positive control and a negative control; the positive control is in vitro recombinant plasmid of the amplified fragment of the mactra objective; the negative control was sterilized deionized water.

6. A fluorescence PCR detection method for detecting mactra veneriformis in a fresh water environment is characterized by comprising the following steps:

extracting environmental DNA of a water sample to be detected;

performing fluorescence PCR amplification detection by using the extracted environmental DNA as a template and the specific primer according to claim 1 and the fluorescence PCR probe according to claim 2;

analyzing the fluorescence PCR amplification detection result of the environmental DNA template, and judging whether the water sample to be detected contains the mactra veneriformis nucleic acid.

7. The fluorescence PCR detection method of claim 6, wherein the reaction system used for the fluorescence PCR amplification detection comprises: 10 mu L2 is

Probe qPCR Master Mix, 6.8. mu.L of nucleic-Free Water, 200nM final concentration forward primer, reverse primer and fluorescent PCR Probe, and 2. mu.L of environmental DNA template;

preferably, the reaction procedure of the fluorescence PCR amplification detection is as follows: pre-denaturation at 95 ℃ for 120 s; denaturation at 95 ℃ for 15s, annealing at 60 ℃ and extension for 60s for 45 cycles.

8. The fluorescence PCR detection method according to claim 6, wherein the fluorescence PCR amplification detection takes in vitro recombinant plasmid of the amplified fragment of the mactra as a positive control, and sterilized deionized water as a negative control to obtain the amplification curves and Ct values of the environmental DNA template, the positive control and the negative control, respectively.

9. The fluorescence PCR detection method according to claim 8, wherein the criterion for determining whether the water sample to be detected contains the mactra nucleic acid is as follows: if the positive control shows an S-shaped amplification curve, the negative control shows no amplification curve and no Ct value, and the water sample to be detected shows an S-shaped amplification curve, determining that the clam nucleic acid exists in the water sample to be detected; and judging that no mactra nucleic acid exists in the water sample to be detected if the water sample to be detected does not have an S-shaped amplification curve and has no Ct value.

10. The fluorescent PCR detection method of claim 6, further comprising:

taking in vitro recombinant plasmids of the amplified fragment of the mactra as a standard substance, and carrying out fluorescence PCR amplification detection on the standard substance with different copy number concentrations by using the specific primer according to claim 1 and the fluorescence PCR probe according to claim 2 to obtain a Ct value;

drawing a standard curve by the logarithmic value and the Ct value of the different copy number concentrations of the standard substance, and comparing the fluorescence PCR amplification detection result of the environmental DNA template with the standard curve to obtain the copy number concentration of the nucleic acid of the mactra veneriformis in the water sample to be detected.