CN108864281B

CN108864281B - Anti-salmonella enteritidis nano antibody and application thereof

Info

Publication number: CN108864281B
Application number: CN201810769826.2A
Authority: CN
Inventors: 王妍入; 何一欣; 王建龙; 张道宏
Original assignee: Northwest A&F University
Current assignee: Northwest A&F University
Priority date: 2018-07-13
Filing date: 2018-07-13
Publication date: 2020-09-08
Anticipated expiration: 2038-07-13
Also published as: CN108864281A

Abstract

The invention relates to a nano antibody for resisting salmonella enteritidis and application thereof. The antibody has the function of binding to salmonella enteritidis. The invention discloses a nano antibody, a gene sequence for coding the nano antibody, an expression vector and a host cell of the nano antibody and a method for producing the nano antibody. The nano antibody for resisting salmonella enteritidis has the advantages of small volume, high expression efficiency, good solubility, strong stability and the like. The invention also comprises the application of the nano antibody for resisting salmonella enteritidis.

Description

Anti-salmonella enteritidis nano antibody and application thereof

Technical Field

The invention relates to the fields of molecular biology, phage display technology and proteomics, in particular to a nano antibody for resisting salmonella enteritidis and application thereof.

Background

Salmonella is gram-negative brevibacterium, and about one thousand species of salmonella is currently found, which can cause diseases of animals such as livestock, rats and birds, and cause food poisoning of humans once contaminated with foods of humans. The salmonella mainly comprises paratyphoid A, paratyphoid B, typhimurium, paratyphoid C, hog cholera, typhoid bacillus, enteritis bacillus and the like. Among them, salmonella enteritidis is very invasive, mainly pollutes meat, eggs, poultry and aquatic products, and can cause enteritis and food poisoning in humans. Statistically, in developed countries such as japan and the united states, the incidence of food poisoning caused by salmonella enteritidis accounts for approximately 80%, and has a serious influence on human health and socioeconomic performance.

The traditional detection method of salmonella enteritidis is a culture method, a sample is enriched and then is subjected to isolated culture, and the detected suspicious bacterial colony is subjected to biochemical test and serological identification. The culture method is the gold standard for detecting salmonella in various countries in the world at present, is commonly used for detecting salmonella enteritidis in food, and is also an arbitration method for salmonella detection. However, the method has the defect of long detection time, the detection result can be obtained within 4-7 days, and the requirement of rapid screening cannot be met, so that the establishment of the rapid and accurate detection method for salmonella enteritidis has important significance for guaranteeing food safety and health of consumers.

The immunoassay method is an analysis method based on antigen-antibody reaction, and has the advantages of high detection sensitivity, simple and convenient operation, low cost and the like. The core of the immunoassay method is an antibody, and monoclonal and polyclonal antibodies for resisting salmonella enteritidis exist in the market at present, however, the polyclonal antibody has the defect of poor uniformity, the production process of the monoclonal antibody is complex, the period is long, the cost is high, and an antibody with good specificity, low production cost and stable performance is urgently needed. A kind of antibody without light chain naturally exists in the camelid body, which is called heavy chain antibody, and the heavy chain antibody is cloned and expressed to obtain single-domain heavy chain antibody, which is called nano antibody because of its small volume (only about 17 KD). The nano antibody is a genetic engineering antibody, has the advantages of low production cost, high expression efficiency, convenience in genetic modification, good stability and the like, and has a very good application prospect. However, at present, no nanobody against salmonella enteritidis has been reported. Therefore, the development of effective nano-antibodies against salmonella enteritidis is urgently required.

Disclosure of Invention

The invention aims to provide an effective salmonella enteritidis resistant nano antibody and application thereof.

A nanobody against Salmonella enteritidis, the nanobody having amino acid sequence framework regions comprising FR1, FR2 and FR3 and complementary variable regions comprising CDR1, CDR2 and CDR 3;

FR1 is selected from the following sequences: 3, SEQ ID NO; and SEQ ID NO:3 sequences having more than 90% homology; FR2 is selected from the following sequences: 4, SEQ ID NO; and SEQ ID NO:4 sequences having more than 90% homology; FR3 is selected from the following sequences: 5, SEQ ID NO; and SEQ ID NO:5 sequences having more than 90% homology;

the CDR1 is selected from the following sequences: 6, SEQ ID NO; and SEQ ID NO:6 sequences having more than 90% homology; the CDR2 is selected from the following sequences: 7, SEQ ID NO; and SEQ ID NO:7 sequences having more than 90% homology; the CDR3 is selected from the following sequences: the sequence shown as SEQ ID NO. 8; and SEQ ID NO:8 sequences having more than 90% homology.

Optionally, the amino acid sequence of the nanobody is selected from the following sequences: 1 is shown in SEQ ID NO; and SEQ ID NO:1 has a homology of 90% or more.

Optionally, the DNA sequence of the nanobody is selected from the following sequences: 2, SEQ ID NO; and SEQ ID NO:2 has a homology of 90% or more.

The nano antibody for resisting salmonella enteritidis is applied to detection of salmonella enteritidis in food.

Optionally, the food product comprises drinking water, milk, beverages and fruit juices.

The kit contains the nano antibody for resisting the salmonella enteritidis.

The invention relates to a recombinant vector, wherein the vector is provided with the nano antibody for resisting salmonella enteritidis.

The invention relates to a host cell, wherein the host cell is internally provided with the nano antibody for resisting salmonella enteritidis.

A method for producing anti-salmonella enteritidis nanobody, culturing the host cell to obtain a culture solution containing the anti-salmonella enteritidis nanobody, and separating and purifying the anti-inflammatory salmonella nanobody from the culture solution.

A polynucleotide encoding the amino acid sequence of said anti-Salmonella nanobody.

The invention has the beneficial effects that:

(1) the anti-salmonella enteritidis nano antibody provided by the invention has a unique variable region sequence, so that the antibody has specific recognition and binding capacity on salmonella enteritidis.

(2) The anti-salmonella enteritidis nano antibody provided by the invention has the advantages of easy expression and high expression efficiency.

(3) The anti-salmonella enteritidis nano antibody provided by the invention has the advantages of high affinity and strong specificity.

(4) The anti-salmonella enteritidis nano antibody provided by the invention has the advantage of strong stability.

(5) Based on the anti-salmonella enteritidis nano antibody provided by the invention, a rapid detection method of salmonella enteritidis in food can be established.

Drawings

FIG. 1 is a diagram showing the electrophoretic identification of VHH gene amplified by the first round of PCR;

FIG. 2 is a diagram showing the electrophoretic identification of VHH gene amplified by the second round of PCR in one cycle;

FIG. 3 is a comparison of phage display nanobody NB 13;

FIG. 4 is an SDS-PAGE electrophoresis of anti-Salmonella enteritidis Nanobody NB 13;

FIG. 5 shows the specificity of the anti-Salmonella enteritidis Nanobody NB 13;

FIG. 6 is the thermostability of anti-Salmonella enteritidis Nanobody NB 13;

FIG. 7 is a standard inhibition curve for Salmonella enteritidis in nanobody-based food products.

Detailed Description

The noun explains:

nano-antibody: the variable region of a camelid heavy chain antibody;

amino acid sequence framework region FR1, first constant region sequence of nanobody;

amino acid sequence framework region FR2, second constant region sequence of nano antibody;

amino acid sequence framework region FR3, third constant region sequence of nanobody;

amino acid sequence complementarity determining region CDR1, first variable region sequence of nanobody;

amino acid sequence complementarity determining region CDR2, the second variable region sequence of the nanobody;

amino acid sequence complementarity determining region CDR3, a third variable region sequence of the nanobody;

the nano antibody for resisting the salmonella enteritidis is used for detecting the salmonella enteritidis in food, such as liquid food of drinking water, milk, beverage, fruit juice and the like.

Construction of anti-salmonella enteritidis phage display nano antibody library

1.1 camel immunization: selecting a camel which is not immunized with any antigen, emulsifying inactivated salmonella enteritidis and a Freund complete adjuvant according to a ratio of 1:1, and adding 10⁶The camel was immunized in cfu/mL with subcutaneous multiple injections, boosting 1 time every 2 weeks, followed by immunization with Freund's incomplete adjuvant emulsified with inactivated Salmonella enteritidis for 5 total immunizations. Blood collection is carried out on the camel 1 week after each immunization to detect the serum titer.

1.2 extraction of total RNA from blood: after the fifth immunization, camel peripheral blood is taken, lymphocytes are separated from the blood according to the routine procedures in the technical field, and total RNA is extracted.

1.3 obtaining cDNA by reverse transcription:

oligo (dT) using the total RNA obtained as a template₁₅For reverse transcription of the primer, the first strand of cDNA was synthesized to obtain a cDNA library.

1.4 amplification of Nanobody (VHH) gene fragments:

first round of PCR amplification was performed using the synthesized cDNA as template and CALL001 and CALL002 as primers. The reaction system is as follows:

vortex mixing, centrifuging for a short time, and carrying out PCR amplification reaction under the following PCR conditions:

(1)94℃2min；

(2)94℃30s；

(3)55℃30s；

(4)68℃1min；

(2) (4) amplification for 30 cycles;

(5)68℃5min。

in the above scheme, the forward primer CALL001 of the VHH amplified by PCR is:

5’-GTCCTGGCTGCTCTTCTACAAGG-3’

the reverse primer CALL002 is:

CALL002:5’-GGTACGTGCTGTTGAACTGTTCC-3’

after the PCR products are separated by 1% agarose gel electrophoresis, DNA fragments with the size of 700bp are purified and recovered by a kit, and the first round of PCR amplification VHH genes are shown in a specific electrophoresis identification picture shown in figure 1, wherein M in the picture represents DL 2000marker, and 1 represents the first round of PCR amplification VHH gene products.

And performing second round PCR amplification by using the VHH gene product amplified by the first round PCR as a template and using the CAM-FOR and the CAM-BACK as primers.

The reaction system is as follows:

(1)94℃2min；

(2)94℃30s；

(3)55℃30s；

(4)68℃1min；

(2) (4) 20 cycles of amplification;

(5)68℃5min。

in the above scheme, the forward primer CAM-FOR of the PCR amplification VHH is:

CAM-FOR：5’-GGCCCAGGCGGCCGAGTCTGGRGGAGG-3’

the reverse primer CAM-BACK is:

CAM-BACK:5’-GGCCGGCCTGGCCGGAGACGGTGACCAGGGT-3’

after the PCR product is separated by 1% agarose gel electrophoresis, a DNA fragment with the size of 400bp is purified and recovered by a kit, namely a VHH fragment, and a specific electrophoresis chart is shown in figure 2, wherein M in figure 2 represents DL 2000marker, and 1 represents a VHH gene product amplified by the second round of PCR.

1.4 construction of the vector

Digestion treatment of pComb3 xss:

the reaction solution was prepared as follows:

after the enzyme digestion product is separated by 1 percent agarose gel electrophoresis, a vector fragment with the size of 3400bp is purified and recovered by a kit.

Connection of VHH gene and double enzyme digestion treated pComb3xss vector

In-Fusion ligation was performed as follows:

the reaction was carried out overnight at 16 ℃ for 16 hours, recovered with an agarose gel DNA purification kit, and stored at-20 ℃ until use. 1.5 electrotransformation of ligation products

Adding 3 μ L of the ligation product into 50 μ L of E.coli ER2738 electrotransformation competent cells, mixing uniformly, adding into a precooled 0.1cm electrotransformation cup (Bio-RAD), and then placing on a Bio-RAD electrotransformation apparatus for electrotransformation, wherein the electrotransformation conditions are as follows: 1.8kV, 200. omega., 25. mu.F, 1mL of pre-warmed SOC broth was added to the cuvette immediately after electrotransformation, pipetted and transferred to a clean sterile 15mL shake tube. Ten times of electrotransformation were carried out as described above, and the bacteria solutions after ten times of electrotransformation were mixed and thawed by gentle shaking at 37 ℃ for 1 hour.

1.6 construction of phage display Nanobody library against Salmonella enteritidis

Transferring the recovered bacteria liquid into 200mL SB culture medium, and shaking at 37 ℃ and 250rpm to OD₆₀₀At a value of 0.5, 1mL of 1 × 10¹²pfu helper phage M13KO7, after standing at 37 ℃ for 1h, shaking for 2h, adding kanamycin to a final concentration of 70. mu.g/mL, and shaking overnight the next day, overnight bacteria were centrifuged at 4 ℃ 10000rpm for 15min, the supernatant was transferred to a sterile centrifuge flask, 1/4 volumes of 5 XPEG/NaCl were added, after standing on ice for 2h, centrifuged at 4 ℃ 12000rpm for 20min, and 10mL of sterile resuspension solution (containing 1 × protease inhibitor, 0.02% NaN) was used₃And 0.5% BSA in PBS buffer) to dissolve the precipitateThe increased anti-salmonella enteritidis phage display nano antibody library.

Second, panning and identification of anti-salmonella enteritidis nano antibody

2.1 panning of anti-salmonella enteritidis nano-antibody:

coating inactivated salmonella enteritidis on an enzyme label plate, sealing with 3% skimmed milk powder, adding 100 μ L phage display nano antibody library into each well, standing at 37 ℃ for 2h, discarding the supernatant, washing the plate with 0.05% PBST solution for 6 times, and adding 100 μ L glycine solution (pH 2.2) to elute the adsorbed phage display nano antibody. The eluted phage were amplified and subjected to a second round of panning, which was the same as the first round of panning. 4 rounds of panning were performed as such, and after each panning, the titers of eluted and added phage-displayed nanobodies were determined.

2.2 identification of anti-salmonella enteritidis nano-antibody:

the panned phage display nanobodies were identified by ELISA. The specific operation is as follows: the ELISA plate is coated with inactivated Salmonella enteritidis with a certain concentration, sealed by 3% skimmed milk powder, added with 100 mu L phage supernatant, kept stand at 37 ℃ for 1h, discarded, washed with 0.05% PBST solution for 6 times, added with 100 mu L enzyme-labeled anti-M13 secondary antibody, and incubated at 37 ℃ for 1 h. After washing the plate, adding TMB substrate for color development, incubating for 15min, adding stop solution, and reading OD value of each well by using a microplate reader.

Through a direct ELISA method, the phage display nano antibody capable of being combined with the salmonella enteritidis is selected, as shown in figure 3, the phage display nano antibody NB13 capable of being strongly combined with the salmonella enteritidis is a positive phage, and the positive phage is sent to a sequencing company for gene sequencing. Sequencing results were analyzed by Bioedit software, and the antibody gene sequences were analyzed to determine the framework regions and complementarity determining regions of the antibody sequences, using the IMGT website (www.http:// www.imgt.org /).

The amino acid sequence of the amino acid sequence framework region FR1 of the anti-salmonella enteritidis nano antibody NB13 is shown as SEQ ID NO. 3;

the amino acid sequence of the amino acid sequence framework region FR2 of the anti-salmonella enteritidis nano antibody NB13 is shown as SEQ ID NO. 4;

the amino acid sequence of the amino acid sequence framework region FR3 of the anti-salmonella enteritidis nano antibody NB13 is shown as SEQ ID NO. 5;

the amino acid sequence of the complementary determining region CDR1 of the anti-salmonella enteritidis nano antibody NB13 is shown as SEQ ID NO. 6;

the amino acid sequence of the complementary determining region CDR2 of the anti-salmonella enteritidis nano antibody NB13 is shown as SEQ ID NO. 7;

the amino acid sequence of the complementary determining region CDR3 of the anti-salmonella enteritidis nano antibody NB13 is shown as SEQ ID NO. 8;

the amino acid sequence of the anti-salmonella enteritidis nano antibody NB13 is shown as SEQ ID NO. 1;

the DNA sequence of the anti-salmonella enteritidis nano antibody NB13 is shown in SEQ ID NO. 2.

Expression of anti-enteritis salmonella nano antibody

The plasmid of phage display nanobody NB13 was extracted and heat shock transformed into host cell TOP 10F'. The TOP 10F' cells containing the nucleotide sequence of the nano antibody NB13 were cultured overnight, the next day, the cells were precipitated, the cell walls were disrupted by sonication, and the nano antibody was purified by a nickel column. The purification effect was identified by SDS-PAGE, and the results are shown in FIG. 4, M represents takarapremix protein marker; in fig. 4, 1 shows a nano anti-salmonella enteritidis nano antibody NB 13. The concentration of the nano antibody is measured by a Bradford method, and the expression efficiency of the nano antibody is 5mg/L of culture medium through calculation.

Fourth, specificity analysis of anti-salmonella enteritidis nano antibody

The interaction of the anti-salmonella enteritidis nano antibody NB13 and 5 different food-borne pathogenic bacteria was determined by ELISA method. Five pathogenic bacteria of salmonella enteritidis, salmonella typhimurium, enterobacter sakazakii, staphylococcus aureus and escherichia coli are respectively coated on an enzyme label plate, after the five pathogenic bacteria are sealed, 100 mu L of nano antibody NB13 solution is added, incubation is carried out for 1h at 37 ℃, after the plate is washed by PBST for three times, anti-HA-HRP secondary antibody is added, standing is carried out for 1h at 37 ℃, after the plate is washed by PBST for six times, TMB solution is added for developing for 15min, sulfuric acid solution is added to stop the reaction, and the specificity of the nano antibody is judged by measuring the absorbance value of each hole under 450 nm. The result is shown in fig. 5, only the OD value of the hole coated with the salmonella enteritidis is higher, and the OD values of other holes are equivalent to the blank, which shows that the nano antibody NB13 has strong specificity to the salmonella enteritidis.

Fifthly, analysis of thermal stability of anti-salmonella enteritidis nano antibody

After incubation of the salmonella enteritidis nano-antibody for 0.5h, 1h, 1.5h and 2h at 70 ℃, respectively, the activity change of the nano-antibody is detected by ELISA and compared with the activity of the nano-antibody without heat treatment. The result is shown in fig. 6, the nanobody still can maintain 60% of activity after being treated at 70 ℃ for 1h, which indicates that the nanobody has higher thermal stability.

Sixthly, establishing a detection method for salmonella enteritidis in food

According to the screening pairing, a monoclonal antibody 2B4 (disclosed by CN 107688094A) for resisting salmonella enteritidis is selected as a capture antibody, and NB13-HRP is used as a detection antibody to carry out double-antibody sandwich immunoassay for detecting salmonella enteritidis. Coating the capture antibody 2B4 on a 96-well enzyme label plate, wherein the coating concentration of each well is 10 mu g/mL, and the temperature is 4 ℃ overnight; the next day, the supernatant was discarded, the plate was washed three times with 0.05% PBST, and each well was sealed with 3% skim milk powder to prepare 20-10⁸CFU/mL Salmonella enteritidis solution, 50. mu.L of standard bacterial solution and 50. mu.L of detection antibody (i.e., Nanobody NB13) were added to each well, and incubated at 37 ℃ for 1 h. Washing the plate for six times with 0.05% PBST, adding TMB substrate developing solution, developing at room temperature for 15min, adding 2M sulfuric acid solution to terminate the reaction, detecting the OD value of each well at 450nm, and drawing a standard curve, wherein the standard curve is shown in FIG. 7. The detection limit of the method is 10⁴CFU/mL。

Example 1 detection of Salmonella enteritidis in milk

Milk is purchased from the market, after the flat plate counting method is adopted to identify salmonella enteritidis, 1CFU/mL salmonella is added, after 24 hours of bacteria increase, the nano antibody NB13 is adopted to carry out detection by utilizing the established double antibody sandwich enzyme-linked immunoassay method. As can be seen from Table 1, the established ELISA method can detect the Salmonella enteritidis in the milk sample after 24h enrichment.

TABLE 1 enzyme-linked immunoassay for Salmonella enteritidis in enriched milk

Nucleotide sequence list electronic file

<110> northwest agriculture and forestry science and technology university

<120> salmonella enteritidis-resistant nano antibody and application thereof

<160>12

<210>1

<211>117

<212>PRT

<213> camel (Bactrian camel)

<220> amino acid sequence of nano antibody for resisting salmonella enteritidis

<400>1

Glu Ser Gly Gly Gly Ser Val Gln Ala Gly

Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser

Gly Phe Pro Ser Ser Asp Ile Cys Met Gly

Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg

Glu Arg Val Ala Ala Ile Thr Ser Glu Gly

Tyr Thr Ser Ile Ala Asp Ser Val Lys Gly

Arg Phe Thr Ile Ser Gln Asp Lys Ala Lys

Asn Thr Leu Asp Leu Leu Met Asn Asn Leu

Lys Pro Glu Asp Thr Ala Met Tyr Tyr Cys

Ala Ala His Arg Gly Ala Trp Cys Tyr His

Ala Pro Arg Leu Phe Asn Phe Trp Gly Gln

Gly Thr Gln Val Thr Val Ser

<210>2

<211>351

<212>DNA

<213> camel (Bactrian camel)

<220> nucleotide sequence of nano antibody for resisting salmonella enteritidis

<400>2

gagtctggaggaggctcggtgcaggctggagggtctctgag

actctcctgtgcagcctctggatttcccagtagtgacatct

gcatgggctggttccgccaggctccagggaaggagcgcgag

agagtcgcggctattactagtgaaggttacacaagcatcgc

agactccgtgaagggccgattcaccatctcccaagacaagg

ccaagaacactcttgatctactaatgaacaatttgaaacct

gaggacactgccatgtactactgtgcggcccatcgaggagc

ttggtgttatcacgcaccgcggctgtttaatttctggggcc

aggggacccaggtcaccgtctcc

<210>3

<211>20

<212>PRT

<213> camel (Bactrian camel)

<220> amino acid sequence framework region FR1 of nano antibody for resisting salmonella enteritidis

<400>3

Glu Ser Gly Gly Gly Ser Val Gln Ala Gly

Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser

<210>4

<211>16

<212>PRT

<213> camel (Bactrian camel)

<220> amino acid sequence framework region FR2 of nano antibody for resisting salmonella enteritidis

<400>4

Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg

Glu Arg Val Ala Ala Ile

<210>5

<211>37

<212>PRT

<213> camel (Bactrian camel)

<220> amino acid sequence framework region FR3 of nano antibody for resisting salmonella enteritidis

<400>5

Ala Asp Ser Val Lys Gly Arg Phe Thr Ile

Ser Gln Asp Lys Ala Lys Asn Thr Leu Asp

Leu Leu Met Asn Asn Leu Lys Pro Glu Asp

Thr Ala Met Tyr Tyr Cys Ala

<210>6

<211>10

<212>PRT

<213> camel (Bactrian camel)

<220> amino acid sequence complementarity determining region CDR1 of nano antibody for resisting salmonella enteritidis

<400>6

Gly Phe Pro Ser Ser Asp Ile Cys Met Gly

<210>7

<211>8

<212>PRT

<213> camel (Bactrian camel)

<220> amino acid sequence complementarity determining region CDR2 of nano antibody for resisting salmonella enteritidis

<400>7

Thr Ser Glu Gly Tyr Thr Ser Ile

<210>8

<211>26

<212>PRT

<213> camel (Bactrian camel)

<220> amino acid sequence complementarity determining region CDR3 of nano antibody for resisting salmonella enteritidis

<400>8

Ala His Arg Gly Ala Trp Cys Tyr His Ala

Pro Arg Leu Phe Asn Phe Trp Gly Gln Gly

Thr Gln Val Thr Val Ser

<210>9

<211>23

<212>DNA

<213> Artificial Synthesis

<220> PCR amplification VHH Forward primer CALL001

<400>9

5’-GTCCTGGCTGCTCTTCTACAAGG-3’

<210>10

<211>23

<212>DNA

<213> Artificial Synthesis

<220> PCR amplification VHH reverse primer CALL002

<400>10

5’- GGTACGTGCTGTTGAACTGTTCC-3’

<210>11

<211>27

<212>DNA

<213> Artificial Synthesis

<220> PCR amplification VHH Forward primer CAM-FOR

<400>11

5’-GGCCCAGGCGGCCGAGTCTGGRGGAGG-3’

<210>12

<211>31

<212>DNA

<213> Artificial Synthesis

<220> PCR amplification of VHH reverse primer CAM-BACK

<400>12

5’- GGCCGGCCTGGCCGGAGACGGTGACCAGGGT-3’。

Claims

1. The nano antibody for resisting salmonella enteritidis is characterized in that the amino acid sequence of the nano antibody is as follows: 1, SEQ ID NO.

2. Use of the nanobody against salmonella enteritidis according to claim 1 for the detection of salmonella enteritidis in food products.

3. Use according to claim 2, wherein the food products comprise drinking water, milk and fruit juices.

4. A Salmonella enteritidis assay kit, comprising the Salmonella enteritidis-resistant nanobody of claim 1.

5. A polynucleotide encoding the amino acid sequence of the nano-antibody against salmonella of claim 1.