CN108864281A - A kind of nano antibody of anti-Bacterium enteritidis and its application - Google Patents
A kind of nano antibody of anti-Bacterium enteritidis and its application Download PDFInfo
- Publication number
- CN108864281A CN108864281A CN201810769826.2A CN201810769826A CN108864281A CN 108864281 A CN108864281 A CN 108864281A CN 201810769826 A CN201810769826 A CN 201810769826A CN 108864281 A CN108864281 A CN 108864281A
- Authority
- CN
- China
- Prior art keywords
- nano antibody
- sequence
- seq
- bacterium enteritidis
- enteritidis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/12—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria
- C07K16/1203—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria
- C07K16/1228—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
- C07K16/1235—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia from Salmonella (G)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
- G01N33/56916—Enterobacteria, e.g. shigella, salmonella, klebsiella, serratia
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/565—Complementarity determining region [CDR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/567—Framework region [FR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/569—Single domain, e.g. dAb, sdAb, VHH, VNAR or nanobody®
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/94—Stability, e.g. half-life, pH, temperature or enzyme-resistance
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Urology & Nephrology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Hematology (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biotechnology (AREA)
- Cell Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Virology (AREA)
- Food Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a kind of nano antibody of anti-Bacterium enteritidis and its applications.The antibody has the function in conjunction with Bacterium enteritidis.The invention discloses this nano antibody and encode the gene order of the nano antibody, the expression vector and host cell of the nano antibody and the method for producing the nano antibody.The nano antibody of anti-Bacterium enteritidis of the invention has many advantages, such as that small in size, expression efficiency is high, dissolubility is good, stability is strong.The invention also includes the applications of the nano antibody of anti-Bacterium enteritidis.
Description
Technical field
The present invention relates to molecular biology, display technique of bacteriophage and proteomics fields, and in particular to Yi Zhongkang
The nano antibody of Bacterium enteritidis and its application.
Background technique
Salmonella is Gram-negative brevibacterium, presently found to have about more than 1,000 kinds, can cause domestic animal, muroid and fowl
The Animal diseases such as class will cause human foods to be poisoned once polluted the food of the mankind.Salmonella mainly includes paratyphoid
First bacillus, paratyphoid B bacillus, bacillus typhi murium, paratyphoid C bacillus, hog cholera bacillus, typhoid bacillus and bacillus enteritidis etc..
Wherein, Bacterium enteritidis has very strong invasive, mainly pollutes meat, egg, fowl and aquatic products, can cause mankind's enteritis and
Food poisoning.According to statistics, caused in the developed countries such as Japan, the U.S., the food poisoning of generation by Bacterium enteritidis
Account for nearly 80%, cause serious influence to human health and social economy.
The traditional detection method of Bacterium enteritidis is cultivation, after sample is carried out increasing bacterium, then is separately cultured, right
The suspicious bacterium colony of detection carries out biochemical test and serological Identification.Cultivation is the gold mark of current countries in the world detection salmonella
Standard is commonly used to the referee method that the detection of Bacterium enteritidis and salmonella are examined in food.However, this method has
Have the shortcomings that detection time is long, generally requires just obtain testing result in 4~7 days, be unable to satisfy the requirement of rapid screening, because
This, establishes the detection method of fast and accurately Bacterium enteritidis, to ensure food safety and the health of consumer have it is important
Meaning.
Immunoassay method is the analysis method based on antigen-antibody reaction, have detection sensitivity it is high, it is easy to operate, at
This low advantage.The core of immunoassay method is antibody, had currently on the market anti-Bacterium enteritidis monoclonal and
Polyclonal antibody, however, polyclonal antibody has the shortcomings that homogeneity is poor, the production process of monoclonal antibody is complicated, and the period is long,
Higher cost, the antibody that there is an urgent need to a species specificity is good, production cost is low, performance is stable.It is naturally deposited in camellid body
In the antibody of a kind of missing light chain, referred to as heavy chain antibody, heavy chain antibody clonal expression be can get into single domain heavy chain antibody, because of its body
Product small (only 17KD or so), be otherwise known as nano antibody.Nano antibody is a kind of genetic engineering antibody, low with production cost,
The advantages such as expression efficiency is high, is convenient for genetic modification, stability good, have extraordinary application prospect.However, currently, anti-enteritis
The nano antibody of salmonella has not been reported.Therefore, there is an urgent need to develop the nano antibodies of effective anti-Bacterium enteritidis.
Summary of the invention
It is an object of the present invention to provide a kind of nano antibody of effective anti-Bacterium enteritidis and its applications.
A kind of nano antibody of anti-Bacterium enteritidis, the amino acid sequence framework region of the nano antibody include FR1,
FR2 and FR3, complementary variable domain include CDR1, CDR2 and CDR3；
The FR1 is selected from the sequence of following one kind：SEQ ID NO:Sequence shown in 3；With SEQ ID NO：3 have 90%
The sequence of the above homology；The FR2 is selected from the sequence of following one kind：SEQ ID NO:Sequence shown in 4；With SEQ ID NO：
4 sequences with 90% or more homology；The FR3 is selected from the sequence of following one kind：SEQ ID NO:Sequence shown in 5；With
SEQ ID NO：5 sequences with 90% or more homology；
The CDR1 is selected from the sequence of following one kind：SEQ ID NO:Sequence shown in 6；With SEQ ID NO：6 have
The sequence of 90% or more homology；The CDR2 is selected from the sequence of following one kind：SEQ ID NO:Sequence shown in 7；With SEQ
ID NO：7 sequences with 90% or more homology；The CDR3 is selected from the sequence of following one kind：SEQ ID NO:Shown in 8
Sequence；With SEQ ID NO：8 sequences with 90% or more homology.
Optionally, the amino acid sequence of the nano antibody is selected from the sequence of following one kind：SEQ ID NO:Sequence shown in 1
Column；With SEQ ID NO：1 sequence with 90% or more homology.
Optionally, the DNA sequence dna of the nano antibody is selected from the sequence of following one kind：SEQ ID NO:Sequence shown in 2；
With SEQ ID NO：2 sequences with 90% or more homology.
Application of the nano antibody of anti-Bacterium enteritidis of the present invention for Bacterium enteritidis detection in food.
Optionally, the food includes drinking water, milk, beverage and fruit juice.
A kind of salmonella enteritidis detection reagent kit contains anti-Salmonella of the present invention in the kit
The nano antibody of bacterium.
A kind of recombinant vector has the nano antibody of anti-Bacterium enteritidis of the present invention on the carrier.
A kind of host cell, the interior nanometer with anti-Bacterium enteritidis of the present invention of the host cell are anti-
Body.
A method of anti-Bacterium enteritidis nano antibody is produced, the host cell is cultivated, is obtained containing described
The culture solution of the nano antibody of anti-Bacterium enteritidis isolates and purifies receiving for the anti-inflammatory salmonella from the culture solution
Meter Kang Ti.
A kind of polynucleotides encode the amino acid sequence of the nano antibody of the anti-salmonella.
The beneficial effects of the present invention are：
(1) anti-Bacterium enteritidis nano antibody provided by the invention has unique variable region sequences, so that described anti-
Body has special identification and binding ability to Bacterium enteritidis.
(2) anti-Bacterium enteritidis nano antibody provided by the invention has the advantages that be easy to express and expression efficiency is high.
(3) anti-Bacterium enteritidis nano antibody provided by the invention has the advantages of affinity is high, high specificity.
(4) anti-Bacterium enteritidis nano antibody provided by the invention, has the advantages that stability is strong.
(5) it is based on anti-Bacterium enteritidis nano antibody provided by the present invention, Bacterium enteritidis in food can be established
Rapid detection method.
Detailed description of the invention
Fig. 1 is first round PCR amplification VHH gene electrophoretic identification in one；
Fig. 2 is the second wheel PCR amplification VHH gene electrophoretic identification in one；
Fig. 3 is phage display nano antibody NB13 comparison diagram；
Fig. 4 is the SDS-PAGE electrophoresis of anti-Bacterium enteritidis nano antibody NB13；
Fig. 5 is the specificity of anti-Bacterium enteritidis nano antibody NB13；
Fig. 6 is the thermal stability of anti-Bacterium enteritidis nano antibody NB13；
Fig. 7 is the standard suppression curve of Bacterium enteritidis in the food based on nano antibody.
Specific embodiment
Explanation of nouns：
Nano antibody：The variable region of Cameloid heavy chain antibody；
Amino acid sequence framework region FR1, the first segment constant-region sequences of nano antibody；
Amino acid sequence framework region FR2, the second segment constant-region sequences of nano antibody；
Amino acid sequence framework region FR3, the third section constant-region sequences of nano antibody；
Amino acid sequence complementary determining region CDR1, the first segment variable region sequences of nano antibody；
Amino acid sequence complementary determining region CDR2, the second segment variable region sequences of nano antibody；
Amino acid sequence complementary determining region CDR3, the third section variable region sequences of nano antibody；
The nano antibody of anti-Bacterium enteritidis of the invention is used in food, such as drinking water, milk, beverage, fruit juice
The detection of Bacterium enteritidis in equal liquid foods.
One, anti-Salmonella enteritidis bacteriophage shows the building in nano antibody library
1.1 camels are immunized：A camel without any antigen is immunized is chosen, by the Bacterium enteritidis of inactivation and not
Formula Freund's complete adjuvant presses 1:After 1 ratio emulsification, with 106Camel is immunized in the amount of cfu/mL by the way of subcutaneous multi-point injection, often
Every 2 weeks booster immunization 1 time, then immune changes the not Bacterium enteritidis of formula Freund's incomplete adjuvant and inactivation emulsification into, and 5 are immunized altogether
It is secondary.1 week after immune every time, to camel, blood was collected detects serum titer.
The extraction of 1.2 blood total serum IgEs：After 5th time is immune, camel peripheral blood is taken, by the art conventional program, from
Lymphocyte is separated in blood, extracts total serum IgE.
1.3 reverse transcriptions obtain cDNA：
Using the total serum IgE of acquisition as template, oligo (dT)15Reverse transcription is carried out for primer, synthesizes the first chain of cDNA, is obtained
CDNA library.
The amplification of 1.4 nano antibodies (VHH) genetic fragment：
Using the cDNA of synthesis as template, CALL001 and CALL002 are primer, carry out first round PCR amplification.Reaction system
It is as follows：
It is vortexed and mixes, after of short duration centrifugation, carry out pcr amplification reaction, PCR condition is：
(1)94℃2min；
(2)94℃30s；
(3)55℃30s；
(4)68℃1min；
(2)~(4) 30 circulations are expanded；
(5)68℃5min。
In above scheme, its forward primer of PCR amplification VHH CALL001 is：
5’-GTCCTGGCTGCTCTTCTACAAGG-3’
Reverse primer CALL002 is：
CALL002:5’-GGTACGTGCTGTTGAACTGTTCC-3’
PCR product is after 1% agarose gel electrophoresis separation, with the DNA piece of kits recycling 700bp size
Section is first round PCR amplification VHH gene, and specific electrophoretic identification is shown in Fig. 1, and M indicates 2000 marker of DL in figure, and 1 indicates
First round PCR amplification VHH gene product.
Using first round PCR amplification VHH gene product as template, CAM-FOR and CAM-BACK are primer, carry out the second wheel
PCR amplification.
Reaction system is as follows：
It is vortexed and mixes, after of short duration centrifugation, carry out pcr amplification reaction, PCR condition is：
(1)94℃2min；
(2)94℃30s；
(3)55℃30s；
(4)68℃1min；
(2)~(4) 20 circulations are expanded；
(5)68℃5min。
In above scheme, its forward primer of PCR amplification VHH CAM-FOR is：
CAM-FOR：5'-GGCCCAGGCGGCCGAGTCTGGRGGAGG-3'
Reverse primer CAM-BACK is：
CAM-BACK:5’-GGCCGGCCTGGCCGGAGACGGTGACCAGGGT-3’
PCR product is after 1% agarose gel electrophoresis separation, with the DNA piece of kits recycling 400bp size
Section, as VHH segment, specific electrophoretogram are shown in Fig. 2, and M indicates DL 2000marker in Fig. 2, and 1 indicates the second wheel PCR amplification
VHH gene product.
The building of 1.4 carriers
Digestion handles pComb3xss：
Reaction solution is prepared according to following system：
Digestion products are after 1% agarose gel electrophoresis separation, with the load of kits recycling 3400bp size
Body segment.
The connection of VHH gene and the pComb3xss carrier of double digestion processing
In-Fusion connection is carried out according to following system：
16 DEG C reaction overnight 16 hours, recycled with Ago-Gel DNA purification kit, -20 DEG C save it is stand-by.
The electrotransformation of 1.5 connection products
3 μ L are taken to be added in 50 μ L E.coli ER2738 Electroporation-competent cells above-mentioned connection product, after mixing,
It is added in the 0.1cm electrotransformation cup (Bio-RAD) of pre-cooling, is then placed in Bio-rad electric converter and carries out electrotransformation, electricity turns
Change condition：1.8kV, 200 Ω, 25 μ F are added the SOC fluid nutrient medium of 1mL preheating after electrotransformation in electrotransformation cup immediately, blow
A clean sterilizing 15mL is transferred to after beating to shake in tube.Turn as described above, carrying out ten electricity, the bacterium solution after ten electricity are turned is mixed
It closes, 37 DEG C slowly shake recovery 1h.
1.6 anti-Salmonella enteritidis bacteriophages show the building in nano antibody library
Bacterium solution after recovery is all transferred in 200mL SB culture medium, is shaken in 37 DEG C of 250rpm to OD600Value is 0.5
When, 1mL 1 × 10 is added12After the helper phage M13KO7,37 DEG C of standing 1h of pfu, continues to shake 2h, kanamycins is added extremely
Final concentration of 70 μ g/mL, and shake overnight.Overnight bacterium is centrifuged 15min in 4 DEG C of 10000rpm, supernatant is transferred to nothing by next day
In the centrifugal bottle of bacterium, the 5x PEG/NaCl of 1/4 volume is added, after standing 2h on ice, 4 DEG C of 12000rpm are centrifuged 20min, use
10mL sterile resuspension solution (contains 1 × protease inhibitors, 0.02%NaN3With the PBS buffer solution of 0.5%BSA) dissolution precipitating
Anti- Salmonella enteritidis bacteriophage after being expanded shows nano antibody library.
Two, the elutriation and identification of anti-Bacterium enteritidis nano antibody
The elutriation of 2.1 anti-Bacterium enteritidis nano antibodies：
The Bacterium enteritidis of inactivation is coated on ELISA Plate, after 3% skimmed milk power closing, 100 μ L are added in every hole
Phage display nano antibody library, 37 DEG C of standing 2h abandon supernatant, and with PBST solution board-washing 6 times of 0.05%, 100 μ L are added
The phage display nano antibody of glycine solution (pH 2.2) elution absorption.After the Phage amplification of elution, second is carried out
Elutriation is taken turns, panning process is identical as first round elutriation.4 wheel elutriations are so carried out, after each elutriation, measurement is eluted and what is be added bites
The titre of phage display nano antibody.
The identification of 2.2 anti-Bacterium enteritidis nano antibodies：
It is identified by phage display nano antibody of the ELISA to elutriation.Concrete operations are：By ELISA Plate with centainly
The Bacterium enteritidis of the inactivation of concentration is coated with, and after 3% skimmed milk power closing, 100 μ L bacteriophage supernatants is added, 37 DEG C quiet
1h is set, supernatant is abandoned, with PBST solution board-washing 6 times of 0.05%, the 100 anti-M13 secondary antibodies of μ L enzyme mark, 37 DEG C of incubation 1h are added.Board-washing
Afterwards, tmb substrate colour developing is added, is incubated for 15min, terminate liquid is added, the OD value in each hole is read with microplate reader.
By Salmonella method, choose can with the phage display nano antibody in conjunction with Bacterium enteritidis, such as Fig. 3 institute
Show, there can be the phage display nano antibody NB13 combined more by force with Bacterium enteritidis is positive bacteriophage, is sent
Gene sequencing is carried out to sequencing company.Sequencing result is analyzed with Bioedit software, logs in the website IMGT
(www.http://www.imgt.org/), antibody gene sequences are analyzed, determine framework region and the complementation of antibody sequence
Determine area.
The amino acid sequence such as SEQ ID of the amino acid sequence framework region FR1 of anti-Bacterium enteritidis nano antibody NB13
NO:Shown in 3；
The amino acid sequence such as SEQ ID of the amino acid sequence framework region FR2 of anti-Bacterium enteritidis nano antibody NB13
NO:Shown in 4；
The amino acid sequence such as SEQ ID of the amino acid sequence framework region FR3 of anti-Bacterium enteritidis nano antibody NB13
NO:Shown in 5；
The amino acid sequence such as SEQ of the amino acid sequence complementary determining region CDR1 of anti-Bacterium enteritidis nano antibody NB13
ID NO:Shown in 6；
The amino acid sequence such as SEQ of the amino acid sequence complementary determining region CDR2 of anti-Bacterium enteritidis nano antibody NB13
ID NO:Shown in 7；
The amino acid sequence such as SEQ of the amino acid sequence complementary determining region CDR3 of anti-Bacterium enteritidis nano antibody NB13
ID NO:Shown in 8；
The amino acid sequence such as SEQ ID NO of anti-Bacterium enteritidis nano antibody NB13:Shown in 1；
The DNA sequence dna such as SEQ ID NO of anti-Bacterium enteritidis nano antibody NB13:Shown in 2.
Three, the expression of anti-Bacterium enteritidis nano antibody
The plasmid of phage display nano antibody NB13 is extracted, thermal shock is converted into host cell TOP10F '.It is incubated overnight
TOP10F ' cell containing nano antibody NB13 nucleotide sequence, next day precipitate thallus, keep cell wall broken with ultrasonic method, lead to
Cross ni-sepharose purification nano antibody.Purification effect is identified using SDS-PAGE, as a result sees Fig. 4, M indicates takara in Fig. 4
premix protein marker；1 indicates the anti-Bacterium enteritidis nano antibody NB13 of nanometer in Fig. 4.Using Bradford method
Nano antibody concentration is surveyed, the expression efficiency by can be calculated the nano antibody is 5mg/L culture medium.
Four, the specificity analysis of anti-Bacterium enteritidis nano antibody
By ELISA method, the mutual of anti-Bacterium enteritidis nano antibody NB13 food-borne pathogens different from 5 kinds is measured
Effect.Be coated with respectively on ELISA Plate Bacterium enteritidis, salmonella typhimurium, Enterobacter sakazakii, staphylococcus aureus,
After closing, 100 μ L nano antibody NB13 solution are added, 37 DEG C of incubation 1h, PBST board-washing is three times in five kinds of pathogenic bacteria of Escherichia coli
Afterwards, it is added anti-HA-HRP secondary antibody, 37 DEG C of standing 1h after PBST board-washing six times, are added TMB solution and develop the color 15min, it is molten that sulfuric acid is added
Liquid terminates reaction, and the specificity of nano antibody is judged by measuring the absorbance value of each hole at 450 nm.As a result such as Fig. 5, only
The hole OD value for being coated with Bacterium enteritidis is higher, other each hole OD values are suitable with blank, show nano antibody of the invention
NB13 has to the very strong specificity of Bacterium enteritidis.
Five, the thermal stability analysis of anti-Bacterium enteritidis nano antibody
By Bacterium enteritidis nano antibody after 70 DEG C of incubations 0.5h, 1h, 1.5h and 2h, detected by ELISA
The activity change of nano antibody, and be compared with the activity for the nano antibody not heated.As a result such as Fig. 6, the nanometer are anti-
Body is still able to maintain 60% activity, shows nano antibody thermal stability with higher after 1h processing at 70 DEG C.
Six, the detection method of Bacterium enteritidis in food is established
It is matched according to screening, chooses anti-Bacterium enteritidis monoclonal antibody 2B4 (disclosed in CN107688094A) conduct
Antibody is captured, NB13-HRP is that detection antibody carries out double-antibody sandwich immunization detection Bacterium enteritidis.Antibody 2B4 will be captured
It is coated in 96 hole elisa Plates, the peridium concentration in each hole is 10 μ g/mL, and 4 DEG C overnight；Next day abandons supernatant, with 0.05%
PBST board-washing three times after, close each hole with 3% skimmed milk power, prepare 20~10 respectively8The Bacterium enteritidis of CFU/mL is molten
50 μ L standard bacterium solutions and 50 μ L detection antibody (i.e. nano antibody NB13), 37 DEG C of incubation 1h are added in liquid, every hole.0.05%PBST is washed
Plate six times, tmb substrate developing solution is added, color development at room temperature 15min is added 2M sulfuric acid solution and terminates reaction, at 450nm, detection
The OD value in each hole, draws standard curve, and standard curve is as shown in Figure 7.The detection of this method is limited to 104CFU/mL。
The detection of Bacterium enteritidis in 1. milk of embodiment
Commercially milk adds the sand of 1CFU/mL using colony counting method identification without after Bacterium enteritidis
Door Salmonella utilizes the double antibody sandwich enzyme immunoassay established using nano antibody NB13 of the invention after increasing bacterium for 24 hours
Method is detected.As can be seen from Table 1, the enzyme-linked immunosorbent assay established can detecte milk sample after increasing bacterium for 24 hours
Contain Bacterium enteritidis in product.
The Bacterium enteritidis in milk after 1 enzyme-linked immunosorbent assay of table detection increasing bacterium
Nucleotides sequence list electronic document
<110>Xibei Univ. of Agricultural & Forest Science & Technology
<120>A kind of nano antibody of anti-Bacterium enteritidis and its application
<160>12
<210>1
<211>120
<212>PRT
<213>Camel（Bactrian camel）
<220>The amino acid sequence of the nano antibody of anti-Bacterium enteritidis
<400>1
Glu Ser Gly Gly Gly Ser Val Gln Ala Gly Gly Ser Leu Arg Leu Ser Cys Ala
Ala Ser Gly Phe Pro
Ser Ser Asp Ile Cys Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu
Arg Val Ala Ala Ile
Thr Ser Glu Gly Tyr Thr Ser Ile Ala Asp Ser Val Lys Gly Arg Phe Thr Ile
Ser Gln Asp Lys Ala
Lys Asn Thr Leu Asp Leu Leu Met Asn Asn Leu Lys Pro Glu Asp Thr Ala Met
Tyr Tyr Cys Ala Ala His Arg Gly Ala Trp Cys Tyr His Ala Pro Arg Leu Phe Asn
Phe Trp Gly Gln Gly Thr Gln Val Thr Gln Val Thr Val Ser
<210>2
<211>351
<212>DNA
<213>Camel（Bactrian camel）
<220>The nucleotide sequence of the nano antibody of anti-Bacterium enteritidis
<400>2
gagtctggaggaggctcggtgcaggctggagggtctctgagactctcctgtgcagcctctggatttcccagta
gtgacatctgcatgggctggttccgccaggctccagggaaggagcgcgagagagtcgcggctattactagtgaaggt
tacacaagcatcgcagactccgtgaagggccgattcaccatctcccaagacaaggccaagaacactcttgatctact
aatgaacaatttgaaacctgaggacactgccatgtactactgtgcggcccatcgaggagcttggtgttatcacgcac
cgcggctgtttaatttctggggccaggggacccaggtcaccgtctcc
<210>3
<211>20
<212>PRT
<213>Camel（Bactrian camel）
<220>The amino acid sequence framework region FR1 of the nano antibody of anti-Bacterium enteritidis
<400>3
Glu Ser Gly Gly Gly Ser Val Gln Ala Gly Gly Ser Leu Arg Leu Ser Cys Ala
Ala Ser
<210>4
<211>15
<212>PRT
<213>Camel（Bactrian camel）
<220>The amino acid sequence framework region FR2 of the nano antibody of anti-Bacterium enteritidis
<400>4
Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Arg Val Ala Ala Ile
<210>5
<211>35
<212>PRT
<213>Camel（Bactrian camel）
<220>The amino acid sequence framework region FR3 of the nano antibody of anti-Bacterium enteritidis
<400>5
Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Gln Asp Lys Ala Lys Asn Thr
Leu Asp Leu Leu Met Asn Asn Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr Cys Ala
<210>6
<211>10
<212>PRT
<213>Camel（Bactrian camel）
<220>The amino acid sequence complementary determining region CDR1 of the nano antibody of anti-Bacterium enteritidis
<400>6
Gly Phe Pro Ser Ser Asp Ile Cys Met Gly
<210>7
<211>5
<212>PRT
<213>Camel（Bactrian camel）
<220>The amino acid sequence complementary determining region CDR2 of the nano antibody of anti-Bacterium enteritidis
<400>7
Thr Ser Glu Gly Tyr Thr Ser Ile
<210>8
<211>25
<212>PRT
<213>Camel（Bactrian camel）
<220>The amino acid sequence complementary determining region CDR3 of the nano antibody of anti-Bacterium enteritidis
<400>8
Ala His Arg Gly Ala Trp Cys Tyr His Ala Pro Arg Leu Phe Asn Phe Trp Gly
Gln Gly Thr Gln Val Thr Gln Val Thr Val Ser
<210>9
<211>23
<212>DNA
<213>It is artificial synthesized
<220>PCR amplification VHH forward primer CALL001
<400>9
5’-GTCCTGGCTGCTCTTCTACAAGG-3’
<210>10
<211>23
<212>DNA
<213>It is artificial synthesized
<220>PCR amplification VHH reverse primer CALL002
<400>10
5’- GGTACGTGCTGTTGAACTGTTCC-3’
<210>11
<211>27
<212>DNA
<213>It is artificial synthesized
<220>PCR amplification VHH forward primer CAM-FOR
<400>11
5’-GGCCCAGGCGGCCGAGTCTGGRGGAGG-3’
<210>12
<211>31
<212>DNA
<213>It is artificial synthesized
<220>PCR amplification VHH reverse primer CAM-BACK
<400>12
5’- GGCCGGCCTGGCCGGAGACGGTGACCAGGGT-3’。
Claims (10)
1. a kind of nano antibody of anti-Bacterium enteritidis, which is characterized in that the amino acid sequence frame of the nano antibody
Area includes FR1, FR2 and FR3, and complementary variable domain includes CDR1, CDR2 and CDR3；
The FR1 is selected from the sequence of following one kind：SEQ ID NO:Sequence shown in 3；With SEQ ID NO：3 have 90% or more
The sequence of homology；The FR2 is selected from the sequence of following one kind：SEQ ID NO:Sequence shown in 4；With SEQ ID NO：4 tools
There is the sequence of 90% or more homology；The FR3 is selected from the sequence of following one kind：SEQ ID NO:Sequence shown in 5；With SEQ
ID NO：5 sequences with 90% or more homology；
The CDR1 is selected from the sequence of following one kind：SEQ ID NO:Sequence shown in 6；With SEQ ID NO：6 have 90% with
The sequence of upper homology；The CDR2 is selected from the sequence of following one kind：SEQ ID NO:Sequence shown in 7；With SEQ ID NO：7
Sequence with 90% or more homology；The CDR3 is selected from the sequence of following one kind：SEQ ID NO:Sequence shown in 8；With
SEQ ID NO：8 sequences with 90% or more homology.
2. a kind of nano antibody of anti-Bacterium enteritidis, which is characterized in that the amino acid sequence of the nano antibody is selected from
The sequence of following one kind：SEQ ID NO:Sequence shown in 1；With SEQ ID NO：1 sequence with 90% or more homology.
3. a kind of nano antibody of anti-Bacterium enteritidis, which is characterized in that the DNA sequence dna of the nano antibody is selected from following
A kind of sequence：SEQ ID NO:Sequence shown in 2；With SEQ ID NO：2 sequences with 90% or more homology.
4. the nano antibody of anti-Bacterium enteritidis described in claim 1-3 any claim is for enteritis sramana in food
The application of Salmonella detection.
5. application according to claim 4, which is characterized in that the food includes drinking water, milk, beverage and fruit
Juice.
6. a kind of salmonella enteritidis detection reagent kit, which is characterized in that any containing claim 1-3 in the kit
The nano antibody of anti-Bacterium enteritidis described in claim.
7. a kind of recombinant vector, which is characterized in that with anti-described in claim 1-3 any claim on the carrier
The nano antibody of Bacterium enteritidis.
8. a kind of host cell, which is characterized in that with described in claim 1-3 any claim in the host cell
Anti- Bacterium enteritidis nano antibody.
9. a kind of method for producing anti-Bacterium enteritidis nano antibody, which is characterized in that cultivate host according to any one of claims 8
Cell obtains the culture solution of the nano antibody containing the anti-Bacterium enteritidis, isolates and purifies from the culture solution described
Anti-inflammatory salmonella nano antibody.
10. a kind of polynucleotides, which is characterized in that encode the nano antibody of anti-salmonella as claimed in claim 1 or 2
Amino acid sequence.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810769826.2A CN108864281B (en) | 2018-07-13 | 2018-07-13 | Anti-salmonella enteritidis nano antibody and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810769826.2A CN108864281B (en) | 2018-07-13 | 2018-07-13 | Anti-salmonella enteritidis nano antibody and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108864281A true CN108864281A (en) | 2018-11-23 |
| CN108864281B CN108864281B (en) | 2020-09-08 |
Family
ID=64301801
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810769826.2A Active CN108864281B (en) | 2018-07-13 | 2018-07-13 | Anti-salmonella enteritidis nano antibody and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108864281B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112574301A (en) * | 2020-12-31 | 2021-03-30 | 西北农林科技大学 | Anti-salmonella typhimurium nano antibody and application thereof |
| CN112707963A (en) * | 2021-01-26 | 2021-04-27 | 西北农林科技大学 | Nano antibody, recombinant vector, host cell for broad-spectrum recognition of salmonella and application thereof |
| CN113652358A (en) * | 2021-09-15 | 2021-11-16 | 合肥工业大学 | New application of hypocrellin-based photodynamic treatment to inhibition of growth of Cronobacter sakazakii |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20020056452A (en) * | 2000-12-29 | 2002-07-10 | 김정우 | Egg yolk antibody against salmonella |
| CN101400701A (en) * | 2006-03-10 | 2009-04-01 | Cj第一制糖株式会社 | Growth inhibitory composition against pathogenic bacteria of meat based food stuff comprising igy |
| CN104479015A (en) * | 2014-12-04 | 2015-04-01 | 东南大学 | Nano antibody aiming at NGAL epitope and application thereof |
| CN104804090A (en) * | 2014-01-29 | 2015-07-29 | 天津胜发生物技术有限公司 | Nano antibody for resisting B cell growth stimulating factor and application |
| CN107074934A (en) * | 2014-03-27 | 2017-08-18 | 萨姆巴德哈·高什 | Single-chain antibody of the expression for salmonella in lactobacillus |
-
2018
- 2018-07-13 CN CN201810769826.2A patent/CN108864281B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20020056452A (en) * | 2000-12-29 | 2002-07-10 | 김정우 | Egg yolk antibody against salmonella |
| CN101400701A (en) * | 2006-03-10 | 2009-04-01 | Cj第一制糖株式会社 | Growth inhibitory composition against pathogenic bacteria of meat based food stuff comprising igy |
| CN104804090A (en) * | 2014-01-29 | 2015-07-29 | 天津胜发生物技术有限公司 | Nano antibody for resisting B cell growth stimulating factor and application |
| CN107074934A (en) * | 2014-03-27 | 2017-08-18 | 萨姆巴德哈·高什 | Single-chain antibody of the expression for salmonella in lactobacillus |
| CN104479015A (en) * | 2014-12-04 | 2015-04-01 | 东南大学 | Nano antibody aiming at NGAL epitope and application thereof |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112574301A (en) * | 2020-12-31 | 2021-03-30 | 西北农林科技大学 | Anti-salmonella typhimurium nano antibody and application thereof |
| CN112574301B (en) * | 2020-12-31 | 2022-04-29 | 西北农林科技大学 | Anti-salmonella typhimurium nano antibody and application thereof |
| CN112707963A (en) * | 2021-01-26 | 2021-04-27 | 西北农林科技大学 | Nano antibody, recombinant vector, host cell for broad-spectrum recognition of salmonella and application thereof |
| CN113652358A (en) * | 2021-09-15 | 2021-11-16 | 合肥工业大学 | New application of hypocrellin-based photodynamic treatment to inhibition of growth of Cronobacter sakazakii |
| CN113652358B (en) * | 2021-09-15 | 2023-09-12 | 合肥工业大学 | Use of hypocrellin-based photodynamic treatment for inhibiting growth of Cronobacter crellin |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108864281B (en) | 2020-09-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108864281A (en) | A kind of nano antibody of anti-Bacterium enteritidis and its application | |
| CN116023479B (en) | Bovine viral diarrhea virus nano antibody and preparation method and application thereof | |
| CN110526967A (en) | A kind of staphylococcus aureus toxin A nano antibody A13, application and kit | |
| Xu et al. | Rapid detection of Campylobacter jejuni using fluorescent microspheres as label for immunochromatographic strip test | |
| CN110563839A (en) | Staphylococcus aureus enterotoxin B nano antibody B1, application and kit | |
| CN109678962A (en) | A kind of Cdk5 nano antibody and screening technique | |
| CN112707963A (en) | Nano antibody, recombinant vector, host cell for broad-spectrum recognition of salmonella and application thereof | |
| Xu et al. | Establishment of a sensitive time-resolved fluoroimmunoassay for detection of Bacillus thuringiensis Cry1Ie toxin based nanobody from a phage display library | |
| CN104926940B (en) | A kind of people source insecticidal proteins and preparation method and application | |
| CN108892723A (en) | For detecting single domain heavy chain antibody, the preparation method and application of Porcine epidemic diarrhea virus | |
| Ding et al. | Magnetic microbead enzyme-linked immunoassay based on phage encoded protein RBP 41-mediated for rapid and sensitive detection of Salmonella in food matrices | |
| CN104845981B (en) | Babesiamicrofti Bm1524 antigens and its application | |
| CN103837684A (en) | Antibody reagent for rapidly detecting salmonellas and detection method thereof | |
| CN115925913B (en) | Nanobody BC16 capable of specifically recognizing staphylococcus aureus enterotoxin B, C and application thereof | |
| CN113461814B (en) | Nano antibody for specifically recognizing vibrio parahaemolyticus, recombinant vector, host cell and application thereof | |
| CN114106168B (en) | Nanobody capable of specifically recognizing enterobacter sakazakii and application thereof | |
| CN107056946A (en) | A kind of Fab antibody and preparation method and application of anti-diethoxy thiophosphate organophosphorus pesticide | |
| CN106749656B (en) | A kind of anti-mouse RCN3 protein monoclonal ScFv antibody and its Panning methods | |
| CN103848895B (en) | The linear dodecapeptide antigenic epitope of aflatoxin B1 and its application | |
| CN113185610B (en) | Staphylococcus aureus enterotoxin A nano antibody, application and kit | |
| CN108226491A (en) | The preparation of Listeria monocytogenes LLO colloidal golds and Preliminary Applications | |
| CN113583119A (en) | Anti-staphylococcus aureus nanobody Nb56, application and kit | |
| CN109762065B (en) | Single-domain heavy chain antibody Nb72 for vibrio fluvialis | |
| CN104327166B (en) | The dodecapeptide antigenic epitope of ochratoxin A and its application | |
| CN108359009B (en) | Brucella single-chain antibody and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |