CN112574301B

CN112574301B - Anti-salmonella typhimurium nano antibody and application thereof

Info

Publication number: CN112574301B
Application number: CN202011620940.2A
Authority: CN
Inventors: 王妍入; 张翠; 任亚荣; 王建龙; 季艳伟
Original assignee: Northwest A&F University
Current assignee: Northwest A&F University
Priority date: 2020-12-31
Filing date: 2020-12-31
Publication date: 2022-04-29
Anticipated expiration: 2040-12-31
Also published as: CN112574301A

Abstract

The invention provides an anti-salmonella typhimurium nano antibody ST-Nb9, wherein the amino acid sequence of the anti-salmonella typhimurium nano antibody ST-Nb9 comprises four framework regions FR1, FR2, FR3 and FR4, and also comprises three complementary determining regions CDR1, CDR2 and CDR 3; the sequence of FR1 is shown as SEQ NO. 1, the sequence of FR2 is shown as SEQ NO. 2, the sequence of FR3 is shown as SEQ NO. 3, and the sequence of FR4 is shown as SEQ NO. 4; the sequence of the CDR1 is shown as SEQ NO. 5, the sequence of the CDR2 is shown as SEQ NO. 6, and the sequence of the CDR3 is shown as SEQ NO. 7. The anti-salmonella typhimurium nano antibody provided by the invention has a unique variable region sequence, so that the antibody has specific recognition and binding capacity on salmonella enteritidis. The anti-salmonella typhimurium nano antibody provided by the invention has the advantages of easiness in expression and high expression efficiency.

Description

Anti-salmonella typhimurium nano antibody and application thereof

Technical Field

The invention belongs to the technical field of molecular biology, and discloses a nano antibody for resisting salmonella typhimurium and application thereof.

Background

Salmonella is a global food-borne disease. After people ingest bacteria-containing food, diarrhea, vomiting and fever can occur, children with typhoid fever and low immunity can have symptoms of septicemia, dehydration, acidosis, anuresis, heart failure and the like, and the life can be threatened when first aid is not in time. More than 2000 serotypes of salmonella are known, and clinically common serotypes are mainly salmonella typhimurium, salmonella enteritidis and the like. The application of good and standard production operation process and management systems such as hazard analysis and key point control (HACCP) and the like can greatly reduce the occurrence of food-borne pathogenic bacteria.

At present, methods for detecting salmonella mainly comprise a biochemical culture method, an immunological detection method and a molecular detection method. The traditional biochemical culture method is a national standard method for detecting salmonella, and although sensitive and reliable, the traditional biochemical culture method can not meet the requirement of rapid detection because the traditional biochemical culture method needs multiple steps of enrichment, separation, screening and biochemical identification: the molecular detection method comprises the traditional PCR, the real-time fluorescent quantitative PCR (RT-PCR) and the loop-mediated isothermal amplification (LAMP).

However, the methods have the problems of high detection cost and high technical requirements on detection personnel. Enzyme-linked immunosorbent assay (ELISA) is widely used in clinical, environmental monitoring and academic research by virtue of its overwhelming advantages of high sensitivity, low cost and high throughput. However, most current immunological techniques generally rely on monoclonal antibodies (mabs) or polyclonal antibodies (pabs), neither of which are resistant to extreme environments such as high temperature, organic solvents, and strong ions. And the failure rate of the monoclonal antibody in cell fusion is high, the early screening process is long and complex, the occurrence of lucky factors for generating high-quality monoclonal antibodies is good, and the common defect of poor specificity of polyclonal antibodies is that the wide application of the traditional IgG antibody in analysis and research is greatly limited.

The nano antibody technology is developed and obtained by applying a molecular biology technology on the basis of the traditional antibody, and is the smallest known antibody molecule capable of combining with an antigen at present. Originally discovered in camelid blood by the belgium scientist Hamers R, common antibody proteins were composed of two heavy chains and two light chains, while the novel antibodies found in camelid blood naturally lack the light chain and heavy chain constant region 1(CH1) heavy chain antibodies, and the Variable regions thereof were cloned to obtain single domain antibodies composed of only one heavy chain Variable region, called single domain heavy chain antibodies (VHH), also known as nanobodies (Nb). Compared with polyclonal antibodies and monoclonal antibodies, the nano-antibody has the following advantages:

1) the nano antibody has high stability and good water solubility.

2) The long CDR3 region is provided, and the CDRs region and other self structural domains do not have a pair-wise complementary relationship, so that the nano antibody has more flexibility and convexity, and the small volume (12-15 kD, 2 multiplied by 4nm) enables the nano antibody to be better combined with cracks and cavities on the surface of an antigen, thereby improving the antigen specificity and affinity of the nano antibody. For bacteria or macromolecular proteins with complex surface structures, the nano antibody is more favorable for overcoming the steric effect of the surface structures so as to be efficiently recognized with surface antigens.

3) Can be synthesized and expressed in a large amount in a microbial system, and creates conditions for the low-cost and high-efficiency production of the nano antibody.

4) At present, the nano antibody aiming at the salmonella typhimurium is not reported, so that the development of the nano antibody aiming at the salmonella typhimurium, which has high affinity, high specificity and low cost, is beneficial to further improving the sensitivity and specificity of the immunological detection of the salmonella typhimurium so as to meet the requirement of on-site detection.

Disclosure of Invention

Aiming at the defects of the prior art, the invention aims to provide the anti-salmonella typhimurium nano antibody and the application thereof, and solve the problems that the antibody in the prior art has weak specific recognition and binding capacity on salmonella enteritidis, is not easy to express and has low expression efficiency.

In order to achieve the purpose, the technical scheme is as follows: an anti-salmonella typhimurium nano antibody ST-Nb9, wherein the amino acid sequence of the anti-salmonella typhimurium nano antibody ST-Nb9 comprises four framework regions FR1, FR2, FR3 and FR4, and also comprises three complementarity determining regions CDR1, CDR2 and CDR 3;

the sequence of FR1 is shown as SEQ NO. 1, the sequence of FR2 is shown as SEQ NO. 2, the sequence of FR3 is shown as SEQ NO. 3, and the sequence of FR4 is shown as SEQ NO. 4;

the sequence of the CDR1 is shown as SEQ NO. 5, the sequence of the CDR2 is shown as SEQ NO. 6, and the sequence of the CDR3 is shown as SEQ NO. 7.

The invention also has the following technical characteristics:

the amino acid sequence of the anti-salmonella typhimurium nano antibody ST-Nb9 is shown in SEQ NO. 8.

The nano antibody ST-Nb9 for resisting the salmonella typhimurium is applied to detection of the salmonella typhimurium in food.

The food comprises drinking water, milk and fruit juice.

A salmonella typhimurium detection kit contains the anti-salmonella typhimurium nano antibody ST-Nb 9.

A polynucleotide for coding the amino acid sequence of the nano antibody of the anti-salmonella typhimurium.

Compared with the prior art, the invention has the beneficial technical effects that:

the anti-salmonella typhimurium nano antibody provided by the invention has a unique variable region sequence, so that the antibody has specific recognition and binding capacity on salmonella enteritidis.

(II) the anti-salmonella typhimurium nano antibody provided by the invention has the advantages of easy expression and high expression efficiency.

(III) the anti-salmonella typhimurium nano antibody provided by the invention has the advantages of high affinity and strong specificity.

(IV) the anti-salmonella typhimurium nano antibody provided by the invention has the advantage of strong stability.

Drawings

FIG. 1 shows the indirect ELISA identification result of positive clones.

FIG. 2 is a sandwich ELISA standard curve established by nano antibody ST-Nb9 and phage display nano antibody, and the linear range is 5X 10⁴-3×10⁸CFU/mL，R²LOD of 5.1 × 10 ═ 0.99⁴CFU/mL。

FIG. 3 is a specificity analysis of the Nanobody ST-Nb 9.

FIG. 4 is a thermal stability analysis of Nanobody ST-Nb 9.

The details of the present invention are explained in further detail below with reference to the drawings and examples.

Detailed Description

The following embodiments of the present invention are provided, and it should be noted that the present invention is not limited to the following embodiments, and all equivalent changes based on the technical solutions of the present invention are within the protection scope of the present invention.

The invention adopts inactivated salmonella typhimurium to immunize bactrian camel, extracts RNA of the bactrian camel from peripheral blood lymphocytes of the immunized bactrian camel, and specifically amplifies camel single-chain antibody variable region genes, thereby constructing a nano antibody gene bank and analyzing the capacity and diversity of the bank. By using phage display technology, a nano antibody capable of being specifically combined with salmonella typhimurium is screened from a nano antibody library, a nano antibody expression vector is constructed, and prokaryotic expression, purification and identification are carried out on the nano antibody expression vector, so that the required nano antibody is obtained.

Example 1:

construction of phage display nano antibody immune library

1) Camel immunization: diluting 5mL of the solution to 10⁸Emulsifying the CFU/mL inactivated Salmonella typhimurium bacterial liquid with an equal volume of Freund complete adjuvant, performing subcutaneous multipoint injection on a healthy bactrian camel, immunizing once every two weeks for five times, immunizing for five times in total, performing antigen emulsification on the second to fifth times by using Freund incomplete adjuvant, and starting blood sampling detection after four-immunization. Boosting the immunity 7-10 days after the fourth immunization, then taking 20mL of blood by using a jugular vein of a blood collection tube after one week of boosting, simultaneously, slightly inverting the blood collection tube to avoid blood coagulation, treating the blood by using a filter in a LeukoLOCK RNA (Invitrogen) kit, then flushing the filter by using 3mL of phosphate buffer solution and 3mL of RNAlater buffer solution in sequence, retaining lymphocytes in the filter, and finally sealing and storing the filter for 4 ℃ to prepare RNA.

2) Extracting camel bloodLeukocyte total RNA in liquid: mixing 70 mu L of pH adjusting buffer solution with 2.5mL of lysate; the sealed filter is opened, melted at room temperature and the small amount of RNAlater buffer remaining in the filter is flushed out by a syringe; sucking 2.5mL of the prepared lysate by using a 3mL syringe, and collecting an effluent liquid; add 2.5mL nuclease free ddH₂O, mixing uniformly, adding 25 mu L of proteinase K, and oscillating the centrifugal tube at room temperature at 250rpm for 5 min; mixing RNA and magnetic beads uniformly, adding 50 mu L of the mixed solution into the lysate, mixing uniformly, adding 2.5mL of isopropanol, and slightly shaking at room temperature for 5 min; centrifuging at 2000g for 3min to precipitate the magnetic beads, and carefully removing the supernatant; adding 600 mu L of washing solution 1 into the magnetic beads, uniformly mixing the solution by using a pipettor, and transferring the solution to a 1.5mL centrifuge tube; centrifuging 16000g of the centrifugal tube for 30-60 s to aggregate magnetic beads, and discarding the supernatant; adding 750 μ L of 2/3, vortexing for 15s to re-disperse the aggregated beads, and centrifuging at 16000g for 30s to collect the beads; opening the centrifuge tube for 2min at room temperature, preparing TURBO DNase mixed solution, adding 4 μ L into 296 μ L LeukoLOCK DNase buffer solution, mixing, adding into the centrifuge tube, and mixing by vortex; adding 300 mu L of lysis solution (pH adjusting buffer solution is not added) and 300 mu L of isopropanol, uniformly mixing, centrifuging 16000g for 30s, removing supernatant, adding 750 mu L of washing solution 2/3, vortexing for 15-30 s, centrifuging 16000g for 30s, collecting magnetic beads, and repeatedly washing the magnetic beads with washing solution 2/3 once; placing the centrifugal tube in the open state for 3min to volatilize the solution in the tube; adding two 30 μ L eluents to dissolve the magnetic beads, centrifuging for 2min at 16000g to obtain supernatant as extracted RNA, transferring to an RNase-free centrifuge tube, and storing at 4 deg.C for use.

3) Synthesis of cDNA: cDNA was synthesized using RNA as a template. Taking 3 PCR tubes of 200. mu.L, adding 1. mu.L dNTP mix, 1. mu.L oligo (dT) and 8. mu.L RNA respectively; the mixture is subjected to water bath at 65 ℃ for 5min, the secondary structure of the template is opened, and the mixture is immediately placed on ice to be cooled for 1min, so that the RNA of the template is denatured; then, a reaction mixed solution is prepared in a centrifuge tube, and the reaction system is as follows:

10×RT buffer	6μL
		25mM MgCl₂	12μL
0.1M DTT	6μL
		RNaseOUT(40U/μL)	3μL
SuperScript 3RT(200U/μL)	3μL

heating the reaction mixture, and terminating the reaction at 50 deg.C for 50min and then at 85 deg.C for 5 min; then quickly placed on ice for cooling. Adding 1 mu L of RNase into each tube respectively, and mixing uniformly; heating at 37 deg.C for 20min to complete first strand cDNA synthesis, packaging, and storing at-20 deg.C.

4) Amplification of the VHH gene; the gene of the heavy chain antibody VHH is amplified by adopting a nested PCR method, and the sequences of primers used in two rounds of PCR are as follows:

CALL001：GTCCTGGCTGCTCTTCTACAAGG

CALL002：GGTACGTGCTGTTGAACTGTTCC

F：5’-GGCCCAGGCGGCCGAGTCTGGRGGAGG-3’

R：5’-GGCCGGCCTGGCCGGAGACGGTGACCWGGGT-3’。

first round PCR: using cDNA as a template, and using a primer CALL001 and a primer CALL002 to perform first round PCR amplification, wherein the reaction system is as follows:

reaction conditions are as follows: 94 ℃ for 2 min; 30s at 94 ℃; 30s at 55 ℃; at 72 ℃, 1min, 30 cycles; 72 ℃ for 5 min. Storing at 4 ℃. And (3) identifying the PCR product by using 1% agarose gel electrophoresis, cutting a target band near 700bp, recovering the PCR product by using a Tiangen gum recovery kit according to the operation steps of the instruction, and determining the concentration of the recovered product for the next experiment.

Second round PCR: taking a first round of PCR gel recovered product (a band near 700 bp) as a template, amplifying a VHH gene fragment by using primers VHH-SfiI-For and VHH-SfiI-Back, wherein the reaction system is as follows:

10x PCR buffer	5μL
		50mM MgSO₄	1.5μL
10mM dNTP	1μL
		primer VHH-SfiI-For (10 μ M)	1μL
Primer VHH-SfiI-Back (10 mu M)	1μL
		ddH₂O	40.3μL
DNA polymerase	0.2μL

Reaction conditions are as follows: 94 ℃ for 2 min; 30s at 94 ℃; 30s at 55 ℃; at 68 ℃, 1min, and 30 cycles; 68 ℃ for 5 min. The PCR product was electrophoresed through 1.5% agarose gel, the band of interest (around 400 bp) was excised, the PCR product was recovered using the Tiangen gel recovery kit according to the instructions, and the concentration of the recovered product was determined for the next experiment.

Construction and identification of phage display nanobody library:

1) enzyme digestion reaction of vector and insert: the pComb3Xss phagemid vector and the VHH fragment were digested overnight at 50 ℃ with SfiI enzyme (Thermo Scientific) in the following reaction scheme:

ddH₂ O	15μL	17μL
				10×Fast Digest buffer	2μL	2μL
DNA	2μL pComb3X Plasmid DNA	10μL PCR products
			Fast Digest enzyme	1μL	1μL

detecting whether the enzyme digestion is complete by 1% agarose gel electrophoresis, and purifying and recovering the enzyme digestion product by adopting a PCR product purification kit (Tiangen).

2) Ligation of vector and insert: ligation was performed overnight at 16 ℃ with T4 ligase (Thermo Scientific), and the specific ligation system was as follows:

pComb3X enzyme digestion product	1.4μg
		VHH gene fragments	0.495μg
10x T4 DNA Ligase buffer	20μL
		T4 ligase	10μL
ddH2O	Make up to 200. mu.L

The ligation products were purified according to the PCR product purification kit (Tiangen) protocol using 30. mu.LddH₂The ligation product was eluted and the DNA concentration was determined using Nanodrop and stored at-20 ℃ until use.

3) Electrotransformation of ligation products

Add 3. mu.L of ligation product to 50. mu.L of competent cell E.coli ER2738, mix well and stand on ice for 1 min. Transferring the mixture into a 1mm electric shock cup for electric shock transformation, wherein the electric shock transformation conditions are as follows: 1.8kV, 200. omega. at 25. mu.F, 950. mu.L of LB medium was immediately added to the cuvette and incubated at 37 ℃ and 250rpm for 1 h. The bacterial liquid was spread on an LB-Amp plate and cultured in an inverted state at 37 ℃ overnight.

4) Rescue of initial library

Adding all the electro-transformed bacteria liquid into 200mL of SB culture medium, and culturing until OD is reached₆₀₀0.6 to 0.8; adding helper phage (Thermo Scientific), culturing at 37 deg.C and 250rpm for 2h, adding kanamycin to final concentration of 50 μ g/mL, and culturing at 37 deg.C overnight; centrifuging at 4 deg.C and 8000rpm for 15min the next day, and collecting supernatant; adding 1/4 volume of 5 XPEG-NaCl solution, and standing on ice for 2 h; centrifuging at 12000rpm for 20min at 4 deg.C, discarding the supernatant, and resuspending the precipitate with 1mL PBS containing 0.5% BSA; taking 10 μ L to determine the storage capacity, adding glycerol with the final concentration of 50% to the rest, and storing at-80 ℃.

Example 2: affinity panning and identification of Nanobodies

1) Affinity panning of the nano-antibody: first, inactivated Salmonella typhimurium was diluted to 10 with PBS (pH7.4)⁸CFU/mL, 4 ℃ coated overnight. The following day, after washing 3 times with 0.05% PBST, 3% skimmed milk powder was added and blocked at 37 ℃ for 1 hour. Then washed 3 times with PBST, 150. mu.L of camelid single domain heavy chain antibody pool was added to each well and incubated at 37 ℃ for 1 hour. Unbound phage were discarded and the plate was washed 10 times manually with PBST, eluted 8min with 100. mu.L of Glycine-HCl (0.2M, pH2.2), and immediately neutralized with 4. mu.L of Tris-HCl (1M, pH 9.1). Titer was determined by taking 10 μ L of eluted phage, and the remaining e.coli ER2738 strain used for infection culture to log phase was amplified. On the third day, amplified phages were precipitated with PEG/NaCl and the titer of the phages was determined.

In the second and third rounds of panning, to remove non-specific adsorption, 3% BSA and 3% OVA blocking were used, respectively, and the rest of the procedure was as above. The enrichment results of phage for each round of panning were as follows:

number of elutriations	Amplification titer (pfu/mL)	Eluent titer (pfu/mL)
			First wheel	1.94×10¹²	1.5×10⁷
Second wheel	5.6×10¹²	1.36×10⁹
			Third wheel	6.9×10¹²	1.49×10⁹

2) Identification of positive phage clones: randomly picking 10 clones from the plate for determining the phage titer after the second round and the third round of panning, amplifying the phage, and identifying positive phage clones by adopting an enzyme-linked immunosorbent assay method. The specific method comprises the following steps: first, inactivated Salmonella typhimurium was diluted to 10 with PBS (pH7.4)⁸CFU/mL, 4 ℃ coated overnight. The following day after washing 3 times with PBST (10mM PBS, 0.05% Tween-20(v/v)), 300. mu.L of 3% skim milk powder was added and blocked at 37 ℃ for 1 hour; removing the blocking solution, washing with PBST for 3 times, adding 100 μ L phage amplification solution, and incubating at 37 deg.C for 1 hr with PBS as negative control; adding 1: HRP-labeled secondary anti-M13 phage antibody (Santa Cruz Biotechnology) 100. mu.L at 5000-fold dilution, incubated for 1 hour at 37 ℃; adding 100 μ L TMB substrate solution, and developing at 37 deg.C for 15min in dark; add 50. mu.L of stop solution (2M H)₂SO₄) Terminating the reaction; the absorbance at 450nm was measured with a microplate reader (Thermo Scientific Multiskan FC). Selection of OD₄₅₀Phage clones 2 times larger than the negative control were positive clones, resulting in 10 positive clones (shown in FIG. 1).

Example 3: sequencing of nano antibody coding gene and determination of amino acid sequence thereof

And (3) carrying out DNA sequencing on the 10 positive clones, analyzing the sequencing result by using Bioedit software to obtain an anti-salmonella typhimurium nano antibody ST-Nb9, and determining a framework region and a complementary determining region of an antibody sequence.

The FR1 amino acid sequence of the framework region of the anti-salmonella typhimurium nano antibody ST-Nb9 is shown as SEQ NO 1;

the FR2 amino acid sequence of the framework region of the anti-salmonella typhimurium nano antibody ST-Nb9 is shown as SEQ NO 2;

the FR3 amino acid sequence of the framework region of the anti-salmonella typhimurium nano antibody ST-Nb9 is shown as SEQ NO 3;

the FR4 amino acid sequence of the framework region of the anti-salmonella typhimurium nano antibody ST-Nb9 is shown as SEQ NO 4;

the amino acid sequence of the complementary determining region CDR1 of the anti-salmonella typhimurium nano antibody ST-Nb9 is shown as SEQ NO. 5;

the amino acid sequence of the complementary determining region CDR2 of the anti-salmonella typhimurium nano antibody ST-Nb9 is shown as SEQ NO 6;

the amino acid sequence of the complementary determining region CDR3 of the anti-salmonella typhimurium nano antibody ST-Nb9 is shown as SEQ NO. 7;

the amino acid sequence of the anti-salmonella typhimurium nano antibody ST-Nb9 is shown in SEQ NO: 8.

Example 4: preparation of Nanobodies

Extracting the plasmid of the ST-Nb9 clone, and transferring the recombinant expression vector into the competence of escherichia coli Top 10'. A single colony from the transformation plate was inoculated in 2mL of SB liquid medium, cultured overnight at 37 ℃ with shaking at 250r/min, and the overnight culture was incubated at a rate of 1: inoculating 100 inoculum sizes in 200mL of SB/Amp culture medium, and performing shaking culture at 37 ℃ at 250 r/min; when the concentration of the cultured cells OD₆₀₀When the concentration reaches 0.6-0.8, adding IPTG with the final concentration of 0.1mM into the culture, and oscillating at 37 ℃ and 250r/min for overnight culture; the culture was centrifuged at 8000rpm at 4 ℃ for 15min to collect the pellet. The centrifuged cells were weighed and the pellet in the tube was washed with B-PER cell lysateAnd (3) cracking, adding about 4mL of B-PER cell lysate into each gram of thallus, shaking and uniformly mixing to dissolve the precipitate, standing at room temperature for 15-20min, centrifuging at 10000rpm for 30min to obtain a supernatant, and performing affinity chromatography purification on the supernatant to obtain the expressed nano antibody ST-Nb 9.

Example 5: establishment of a Standard Curve

The method for identifying the sensitivity by adopting the double-antibody sandwich ELISA comprises the following steps: ST-Nb9 was diluted to 5. mu.g/mL with PBS (pH7.4), coated overnight at 4 ℃, washed 3 times the next day with PBST (10mM PBS, 0.05% Tween-20(v/v)), added 300. mu.L of 3% skim milk powder, and blocked for 1 hour at 37 ℃; salmonella typhimurium from 10⁸cfu/mL was diluted to 10 with a triple gradient³cfu/mL, PBS as negative control, 37 degrees C were incubated for 1 hours; then 100. mu.L of the solution was added to dilute the solution to 4X 10¹⁰pfu/mL of phage display detection antibody, incubated at 37 ℃ for 1 hour; adding 1: 100 μ L of HRP-labeled M13 phage secondary antibody was diluted 5000 and incubated at 37 ℃ for 1 hour; adding 100 μ L TMB substrate solution, developing in dark for 15min, and measuring OD₄₅₀Drawing a standard curve (shown in figure 2) with a linear range of 5 x 10⁴-3×10⁸CFU/mL, linear relationship is R²0.99, the lowest detection limit is 5 × 10⁴CFU/mL, showed better sensitivity.

Example 6: specificity analysis and thermal stability detection of anti-salmonella typhimurium nano antibody ST-Nb9

1) The specific analysis of the anti-salmonella typhimurium nano antibody ST-Nb9 comprises the following steps: inactivated Salmonella typhimurium was diluted to 10 with PBS (pH7.4)⁸cfu/mL, and simultaneously diluting eight common food-borne pathogenic bacteria including Candida albicans (C.albicans), Campylobacter (C.coli), Escherichia coli (E.coli), Staphylococcus aureus (S.aureus), Salmonella enteritidis (S.enteritidis), Salmonella harderi (S.Hadar), Salmonella london (S.London) and Salmonella paratyphi (S.Paratyphi) to 10⁸cfu/mL, 4 ℃ coating overnight; after washing 3 times with PBST (10mM PBS, 0.05% Tween-20(v/v)), 300. mu.L of 3% skim milk powder was added and blocked at 37 ℃ for 1 hour; after washing 3 times with PBST (10mM PBS, 0.05% Tween-20(v/v)), 1 was added00 mu L of salmonella typhimurium resistant nano antibody ST-Nb9, and incubating for 1 hour at 37 ℃; after washing 3 times with PBST (10mM PBS, 0.05% Tween-20(v/v)), 100. mu.L of HRP-labeled anti-HA antibody was added and incubated at 37 ℃ for 1 hour; after washing 6 times with PBST (10mM PBS, 0.05% Tween-20(v/v)), 100. mu.L of TMB substrate solution was added, and color development was carried out in the dark for 15min, and 50. mu.L of 2M H was added₂SO₄After the reaction is terminated by the stop solution, the absorbance OD is measured₄₅₀. The results are shown in fig. 3, and the ST-Nb9 has no cross reaction with candida albicans (c.albicans), campylobacter (c.coli), escherichia coli (e.coli), staphylococcus aureus (s.aureus), salmonella enteritidis (s.enteritidis), salmonella hadamari (s.hadar), salmonella london (s.london) and salmonella paratyphi (s.paratyphi), indicating that the selected anti-salmonella typhimurium nanobody ST-Nb9 shows better specificity.

2) And (3) detecting the thermal stability of the anti-salmonella typhimurium nano antibody ST-Nb 9: salmonella typhimurium was diluted to 10 with PBS (pH7.4)⁸CFU/mL, 4 ℃ coating overnight; the following day after washing 3 times with PBST (10mM PBS, 0.05% Tween-20(v/v)), 300. mu.L of 3% skim milk powder was added and blocked at 37 ℃ for 1 hour; PBST (10mM PBS, 0.05% Tween-20(v/v)) 3 times washing; the nanobody was diluted to 5 μ g/mL with PBS, and a monoclonal antibody (home made in the laboratory) was raised to a concentration of 1: 10000 dilution, respectively placing in water bath at 4, 20, 40, 60, 75, 85 and 95 ℃ for 5min, recovering to room temperature, then respectively adding 100 mu L of the diluted solution into the processed plate holes, and incubating for 1 hour at 37 ℃; adding 1: 100 μ L of HRP-labeled anti-HA antibody was diluted 5000, and incubated at 37 ℃ for 1 hour; adding 100 μ L TMB substrate solution, developing in dark for 15min, and measuring OD₄₅₀. Comparing the percentage of absorbance values under different temperature treatment conditions with the percentage of absorbance values at 4 ℃, the results are shown in fig. 4, along with the increase of temperature, the binding percentage of the nano antibody is not obviously reduced, the performance is still stabilized at 75% after heating at 95 ℃ for 5min, but the monoclonal antibody is obviously reduced after heating at 60 ℃, which indicates that the nano antibody has outstanding thermal stability compared with the monoclonal antibody.

Nucleotide sequence list electronic file

<110> northwest agriculture and forestry science and technology university

<120> nano antibody for resisting salmonella typhimurium and application

<160>8

<210>1

<211>17

<212>PRT

<213> camel (Bactrian camel)

<220> amino acid sequence framework region FR1 of nano antibody ST-Nb9 for resisting salmonella typhimurium

<400>1

Glu Ser Gly Gly Gly Ser Val Gln Ala Gly Gly Ser Leu Arg Leu Ser Cys

<210>2

<211>16

<212> PRT

<213> camel (Bactrian camel)

<220> amino acid sequence framework region FR2 of nano antibody ST-Nb9 for resisting salmonella typhimurium

<400>2

Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val Ala Ala Ile

<210>3

<211>37

<212>PRT

<213> camel (Bactrian camel)

<220> amino acid sequence framework region FR3 of nano antibody ST-Nb9 for resisting salmonella typhimurium

<400>3

Glu Ser Val Arg Gly Arg Phe Thr Ile Ser Lys Asp Gly Ala Lys Asn Thr Leu Asn Leu Gln Met Asn Ser Leu Asn Pro Glu Asp Ser Ala Ile Tyr Tyr Cys Ala Ala

<210>4

<211>10

<212>PRT

<213> camel (Bactrian camel)

<220> amino acid sequence framework region FR4 of nano antibody ST-Nb9 for resisting salmonella typhimurium

<400>4

Trp Gly Gln Gly Thr Gln Val Thr Val Ser

<210>5

<211>13

<212>PRT

<213> camel (Bactrian camel)

<220> amino acid sequence complementarity determining region CRD1 of nano antibody ST-Nb9 for resisting salmonella typhimurium

<400>5

Ala Ala Ser Gly Ile Thr Phe Ser Thr Tyr Asn Met Ala

<210>6

<211>14

<212>PRT

<213> camel (Bactrian camel)

<220> amino acid sequence complementarity determining region CRD2 of nano antibody ST-Nb9 for resisting salmonella typhimurium

<400>6

Arg Lys Asp Gly Ser Thr Ala Tyr Ala

<210>7

<211>20

<212>PRT

<213> camel (Bactrian camel)

<220> amino acid sequence complementarity determining region CRD3 of nano antibody ST-Nb9 for resisting salmonella typhimurium

<400>7

Asp Arg Ser Trp Trp Leu Leu Ser Gly Pro Gln Asn Tyr Arg Tyr

<210>8

<211>127

<212>PRT

<213> camel (Bactrian camel)

<220> amino acid sequence of nano antibody ST-Nb9 for resisting salmonella typhimurium

<400>8

Glu Ser Gly Gly Gly Ser Val Gln Ala Gly Gly Ser Leu Arg Leu 15

Ser Cys Ala Val Ser Arg Ala Thr Asp Thr Arg Tyr Cys Met Gly 30

Trp Phe Arg Gln Ala Pro Gly Lys Gly Arg Glu Gly Val Ala Val 45

Ile Arg Lys Asp Gly Ser Thr Ala Tyr Ala Glu Ser Val Arg Gly 60

Arg Phe Thr Ile Ser Lys Asp Gly Ala Lys Asn Thr Leu Asn Leu 75

Gln Met Asn Ser Leu Asn Pro Glu Asp Ser Ala Ile Tyr Tyr Cys 90

Ala Ala Asp Arg Ser Trp Trp Leu Leu Ser Gly Pro Gln Asn Tyr 105

Arg Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser 117

<210>9

<211>23

<212>DNA

<213> Artificial Synthesis

<220> PCR amplification VHH Forward primer CALL001

<400>9

5’-GTCCTGGCTGCTCTTCTACAAGG-3’

<210>10

<211>23

<212>DNA

<213> Artificial Synthesis

<220> PCR amplification VHH reverse primer CALL002

<400>10

5’- GGTACGTGCTGTTGAACTGTTCC-3’

<210>11

<211>27

<212>DNA

<213> Artificial Synthesis

<220> PCR amplification VHH Forward primer CAM-FOR

<400>11

5’-GGCCCAGGCGGCCGAGTCTGGRGGAGG-3’

<210>12

<211>31

<212>DNA

<213> Artificial Synthesis

<220> PCR amplification of VHH reverse primer CAM-BACK

<400>12

5’- GGCCGGCCTGGCCGGAGACGGTGACCAGGGT-3’。

Claims

1. An anti-salmonella typhimurium nano antibody ST-Nb9 is characterized in that the amino acid sequence of the anti-salmonella typhimurium nano antibody ST-Nb9 comprises four framework regions FR1, FR2, FR3 and FR4, and also comprises three complementarity determining regions CDR1, CDR2 and CDR 3;

the sequence of FR1 is shown as SEQ ID NO. 1, the sequence of FR2 is shown as SEQ ID NO. 2, the sequence of FR3 is shown as SEQ ID NO. 3, and the sequence of FR4 is shown as SEQ ID NO. 4;

the sequence of the CDR1 is shown as SEQ ID NO. 5, the sequence of the CDR2 is shown as SEQ ID NO. 6, and the sequence of the CDR3 is shown as SEQ ID NO. 7.

2. The anti-salmonella typhimurium nanobody ST-Nb9 of claim 1, wherein the amino acid sequence of the anti-salmonella typhimurium nanobody ST-Nb9 is shown in SEQ ID No. 8.

3. The use of the anti-salmonella typhimurium nanobody ST-Nb9 as claimed in any of claims 1-2 for the detection of salmonella typhimurium in food.

4. The use according to claim 3, wherein the food products comprise drinking water, milk and fruit juices.

5. A Salmonella typhimurium detection kit, characterized in that the kit contains the anti-Salmonella typhimurium nano antibody ST-Nb9 of any one of claims 1-2.

6. A polynucleotide encoding the amino acid sequence of the anti-salmonella typhimurium nanobody ST-Nb9 according to claim 1 or 2.