CN105177016A - Anti-chloramphenicol-scFv antibody gene and application thereof - Google Patents

Abstract

The invention provides an anti-chloramphenicol-scFv antibody gene and application thereof, relating to screening of specific single chain antibody genes, sequencing of specific single-chain antibody genes, preparation of single-chain antibodies and activity determination of antibodies. The antibody gene comprises nucleotide sequences for coding a heavy chain variable region (117 amino acids), a flexible chain region (15 amino acids) and a light chain variable region (108 amino acids), which are disclosed as SEQ ID No.1 and SEQ ID No.2 in the sequence table. The antibody gene and alkaline phosphatase can be subjected to fusion expression to obtain the active single-chain antibody; and the activity detection result shows that the detection sensitivity of the antibody for chloramphenicol is 2.97(g/kg). The antibody has important application value in chloramphenicol detection.

Description

The antibody gene of chloramphenicol resistance scFv and application

Technical field

The present invention relates to gene engineering technology field and field of immunological detection, be specifically related to antibody gene and the application of a kind of chloramphenicol resistance scFv.

Technical background

Paraxin is a kind of Broad spectrum antibiotics, is the earliest to find from the Venezuela actinomycetes soil, but mainly produces by the means of chemosynthesis now.Paraxin can not only effectively act on gram-positive microorganism and Gram-negative bacteria, also inhibited to Rickettsiae, mycoplasma and chlamydozoan.The antifungal mechanism of this medicine is the Reversible binding by the rrna 50s subunit with bacterium, stops aminoacyl-tRNA to be combined with rrna, the effect of inhibiting peptide acyltransferase, thus reach antibacterial, the effect of sterilization.Due to paraxin low price and drug effect is remarkable, be therefore widely used in treating septicemia, lung, Digestive tract and urinary system infection in Animal husbandry production.In aquaculture field, due to the wide spectrum of paraxin, efficiently sterilizing ability, be also once widely used for the fish disease that treatment gas one Zymomonas mobilis etc. causes.From paraxin in 1949 be applied to clinical after, at some infectious diseases, especially typhoid fever obtains good efficacy in the groove, but also finds that this product can cause serious lethality Toxicity in blood system in nineteen fifty.

At present, increasing country all starts the residue problem paying much attention to paraxin veterinary drug.European Union, the U.S. etc. all limit residual chloromycetin limit standard for " zero tolerance " in relevant laws and regulations, Japan also must not be defined as about the residual quantity of paraxin and detects in " Positive List System " within 2006, to implement, for this reason, the Ministry of Agriculture of China is own deletes paraxin from " Chinese veterinary pharmacopoeia " of 2000, in " animal food residue of veterinary drug regulation ", then clear stipulaties paraxin must not detect in the middle of food, once find that its residual quantity exceeds standard, forbid outlet.The Ministry of Agriculture announces in " food animal forbidding veterinary drug and the compound inventory thereof " that No. 193 (2002-4-27) issue, and paraxin is classified as forbidding medicine.

Because this kind of antibiotic content is atomic, therefore require super-sensitive detection technique.The determination method of chloramphenicol residues reported has gas-chromatography (GC) method, Enzyme-linked Immunosorbent Assay (ELISA) etc.GC method uses highly sensitive electron capture detector, thus requires strict to the purification of sample, and adds the analysis process time.This just urgently needs a kind of method of new rapid detection; Though common euzymelinked immunosorbent assay (ELISA) is highly sensitive, sample capacity is large, have that laboratory animal requirement is large, breeding cycle is long, different animals is individual to agricultural and veterinary chemicals sensitivity difference, causes the problems such as antibody variability is large; Monoclonal antibody as second generation antibody, due to preparation and screening process loaded down with trivial details, and require very high to operative technique, the cytogenetics after clone is the reason such as instability easily, is unfavorable for widespread use.

The Heterosis of genetic engineering antibody is easy in saving laboratory animal and feeding time, technology, be easy to put into production, genetic information has operability.

Summary of the invention

The object of the invention is to overcome the deficiencies in the prior art part, a kind of with strong points, scFv antibody of chloramphenicol resistance that stability is high, easy to prepare and the gene order of this antibody of encoding are provided.

The object of the invention is to be achieved through the following technical solutions:

An antibody gene of chloramphenicol resistance scFv, it comprises heavy chain gene and light chain gene, and this gene is made up of 714 Nucleotide, and the sequence of described heavy chain gene is shown in sequence 1, and the gene order of light chain gene is shown in sequence 2.

The antibody of the chloramphenicol resistance scFv encoded by the antibody gene of chloramphenicol resistance scFv.

And variable region of heavy chain is made up of 117 amino acid, flexible link zone is by 15 amino acid, and variable region of light chain is made up of 108 amino acid.

The carrier of the antibody gene containing chloramphenicol resistance scFv.

The genetic engineering bacterium of the antibody gene containing chloramphenicol resistance scFv.

The carrier of the genetic engineering bacterium of the antibody gene containing chloramphenicol resistance scFv or the antibody gene containing chloramphenicol resistance scFv is preparing the application in chloramphenicol resistance scFv antibody.

A screening method for chloramphenicol antibody gene variable region of heavy chain and variable region of light chain, step is as follows

(1) pcr amplification is carried out in the variable region of heavy chain of antibody gene, variable region of light chain, be connected with carrier T and transformation of E. coli competent cell, carry out large scale sequencing after screening positive clone, utilize sequence alignment program to carry out sequence alignment analysis to the structure after order-checking;

(2) paraxin monoclonal antibody is carried out enzymolysis, obtain Fab proteolytie fragrnent, and the heavy chain after hydrolysis and light chain are carried out Mass Spectrometric Identification respectively;

(3) be aminoacid sequence by large scale sequencing results conversion, the amino acid fragment obtained with Mass Spectrometric Identification result carries out sequence alignment analysis, the sequence that screening is consistent with simple qualification result from sequencing result, thus the variable region of heavy chain and the variable region of light chain that obtain target antibody gene.

Advantage of the present invention and positively effect:

(1) the application is by consulting a large amount of NCBI design data degenerate primer, this primer can cover the diversity of mouse source heavy chain of antibody and light chain all sidedly, especially light chain primer is except comprising general kappa light chain primer, further comprises lambda light chain primer, with the loss of the gene of preventing portion subhead.

(2) the present invention selects hybridoma as the gene source preparing chloramphenicol resistance scFv antibody, and eliminate immunity, that feeding animals brings is loaded down with trivial details, specific aim is stronger;

(3) the present invention establish a kind of newly, the method for acquisition specific antibody gene that reliability is strong, the Mass Spectrometric Identification of antibody and large scale sequencing are compared, thus obtain target antibody gene;

(4) preparation method of the present invention saves time, technology is easy, be easy to that development downstream produces, genetic information can operate and stable.

Accompanying drawing explanation

Fig. 1 is the amplification of chloramphenicol antibody variable region.1:VL fragment in figure; 2:VL fragment; M:DNAMarkerDL2000.

Fig. 2 is the detection of paraxin Fab.M:ProteinMolecularWeightMarker in figure; 1,2,3: the paraxin Fab after purifying.

Fig. 3 is variable region of light chain sequencing result and mass spectrographic comparison.In figure, Sequence is the aminoacid sequence of VL, and 1,2,3,4 is mass spectrum sequencing result.

Fig. 4 is variable region of heavy chain sequencing result and mass spectrographic comparison.In figure, Sequence is the aminoacid sequence of VH, and 1,2,3,4,5,6 is mass spectrum sequencing result.

Fig. 5 is the amplification of single-chain antibody gene (scFv).1、2：scFv；M：DNAMarkerDL2000。

Fig. 6 is that PCR screens scFv-pMD18-T positive colony.1-18:PCR the selection result; M:DNAMarkerDL2000.

Fig. 7 is that PCR screens recombinant expression plasmid.M:DNAMarkerDL2000; 1-10:PCR the selection result.

Fig. 8 is the digestion verification of recombinant expression plasmid.M1:DNAMarkerDL2000; M2:DNAMarker1kb; 1-4: the enzyme of recombinant expression plasmid is cut.

Fig. 9 is the abduction delivering of paraxin single-chain antibody.M: standard protein molecular weight; Before 1:CAPscfv-pLIP6/GN-BL21 induction; 2,3,4,5, after the different clone strain induction of 6:CAPscfv-pLIP6/GN-BL21

Figure 10 is the detection of single-chain antibody expression-form.M:ProteinMolecularWeightMarker; Before No. 1:CAPscfv-pLIP6/GN-BL211 induction; After No. 2:CAPscfv-pLIP6/GN-BL211 induction;

Supernatant after 3:CAPscfv-pLIP6/GN-BL211 fragmentation; No. 4:CAPscfv-pLIP6/GN-BL211 broken postprecipitation;

After No. 5:CAPscfv-pLIP6/GN-BL215 induction; Supernatant after 6:CAPscfv-pLIP6/GN-BL215 fragmentation;

No. 7:CAPscfv-pLIP6/GN-BL215 broken postprecipitation.

Figure 11 is the detection after single-chain antibody purifying.M:ProteinMolecularWeightMarker; Before No. 1:CAPscfv-pLIP6/GN-BL211 induction; After No. 2:CAPscfv-pLIP6/GN-BL211 induction; After 2:CAPscfv-pLIP6/GN-BL211 purifying.

Figure 12 is the Activity determination of single-chain antibody.

Concrete embodiment

In order to understand the present invention, below in conjunction with embodiment, the invention will be further described: following embodiment is illustrative, is not determinate, can not limit protection scope of the present invention with following embodiment.

In order to realize the object of the invention, applicant utilizes recombinant DNA technology, heavy chain of antibody, the chain variable region gene for paraxin with the mouse source hybridoma cell strain 10A3B6E of Broadspectrum specificity are carried out amplification in vitro, after checking order in a large number, the mass spectral results of sequencing result and Fab form antibody is carried out sequence alignment, filters out target gene.

The present invention utilizes amalgamation and expression technology, obtains the single-chain antibody (scFv) with paraxin specific recognition activity.Through Overlap extension PCR, with 15 amino acid (aminoacid sequence (GGGGS) ₃gene order GGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCG)) heavy chain screened, light chain connect into scFv antibody gene segments by the flexible peptide linker that forms, and the scFv gene fragment of gained is inserted on pLIP6/GN expression vector, construction recombination plasmid chemical conversion, in expression type Host Strains, obtain the chloramphenicol resistance scFv antibody of amalgamation and expression.

Present invention also offers chloramphenicol antibody gene variable region of heavy chain and light-chain variable sequence, respectively as SEQIDNo.1 and SEQIDNo.2; And scFv heavy chain, light chain aminoacid sequence, as sequence 18 and sequence 19.

Present invention also offers the degenerate primer by NCBI design, for the said gene that increases.Wherein light chain amplimer also introduces lambda strand primer, to cover the diversity of antibody variable region except conventional kappa primer.

Present invention also offers the host cell of carrier containing said gene and carrier.Present invention also offers above-mentioned scFv antibody, the gene of this antibody of encoding, the carrier containing this gene, the host cell containing this carrier preparing the application in chloramphenicol resistance scFv antibody.

Experimental technique in following examples, if no special instructions, is ordinary method.

The reagent material used in following examples, if no special instructions, is the purchase of routine biochemistry reagent suppliers and obtains.

In following examples due to paraxin universal hapten when synthesizing referred to as CAP, so all referred to as CAP during following corresponding cell, gene, bacterial classification etc. have been mentioned relevant paraxin.

The extraction of embodiment 1:CAP monoclonal cell total serum IgE and the synthesis of cDNA

1, the extraction of CAP monoclonal cell strain 10A3B6E total serum IgE

Get the fresh monoclonal cell strain 10A3B6E obtained by this laboratory screening, utilize QigenRneasyMiniKit to carry total serum IgE, cell strain 10A3B6E can produce the monoclonal antibody of anti-CAP.

(1) culturing cell is to 3-4 × 10 ⁶individual, the centrifugal 5min of 300 × g, removes supernatant;

(2) prepare lysate: BufferRLT: beta-mercaptoethanol=1ml:10 μ l;

(3) in the cell after centrifugal, add 350 μ lBufferRLT lysis buffers, flick tube wall, with liquid-transfering gun piping and druming, damping fluid is fully contacted with cell;

(4) add the ethanolic soln of 70% of equal volume, liquid-transfering gun is inhaled gently and is played mixing, notes not centrifugal;

(5) get the silicagel column in QigenRneasyMiniKit, load on 2ml collection tube, shift all samples in pillar, under room temperature, the centrifugal 15s of 12000rpm, discards waste liquid;

(6) add 700 μ lBufferRW1 in post, under room temperature, the centrifugal 15s of 12000rpm, discards effluent liquid;

(7) add the RPE damping fluid of 500 μ l alcohol dilutions, washing pillar, 10000rpm, centrifugal 15s, abandons supernatant;

(8) add 500 μ lRPE damping fluids and move into pillar, froth lid, 10000rpm under room temperature, centrifugal 2min, rinse pillar;

(9) pillar is put into the new 2ml collection tube that a test kit provides, at full speed centrifugal 1min;

(10) in 1.5ml centrifuge tube posts transfer provided to QigenRneasyMiniKit, that gets 50 μ l is added drop-wise on the film of pillar without RNA enzyme water (test kit provides) is carefully unsettled, leaves standstill 3-5min, gently cover lid, the centrifugal 1min of 10000rpm under room temperature, eluted rna;

Wash-out RNA packing, mark after, frozen in-80 DEG C.

2, the synthesis of CAP-cDNA

(1) add following component to 1.5ml centrifuge tube:

(2) get togather lid, centrifuge tube is put into 70 DEG C of water-bath 5min, be then put into immediately on ice, at least 5min, centrifugal 10s collects enriched material and keeps initial volume, puts on ice always;

(3) prepare reverse transcription system, each component is put on ice always;

(4) the reaction system that previous step prepares mixes with the reaction system of the first step, final volume 20 μ l;

(5) anneal: 25 DEG C, 5min;

(6) extend: 42 DEG C, 1h;

(7) packing ,-80 DEG C frozen.

The structure of embodiment 2:CAP-scFv expression plasmid

1, pcr amplification V _h, V _l

The primer: (after VL, after primer and scFv, primer is that primer is equivalent in use and uses)

Wherein K is kappa primer, and L is lambda primer, also to increase lambda chain, so primer before not having independent lambda with primer before kappa.

PCR system (50 μ l):

PCR program:

Through pcr amplification, product utilization agarose gel electrophoresis detects, and result as shown in Figure 1.

2, Qiagen gel purification kit glue is utilized to reclaim object fragment

(1) prepare clean centrifuge tube, weigh;

(2) cut the object fragment on sepharose with clean blade, put into centrifuge tube;

(3) weigh, calculate the glue weight cut, add the BufferQG of 3 times of volumes in 1 times of volume gel;

(4) hatch for 50 DEG C, 10min, until glue dissolves completely, put upside down once every 2-3min;

(5), after glue dissolves completely, check whether solution colour is yellow, as solution colour becomes safran or purple, add the mixing of 10ul3M sodium-acetate;

(6) double gel volume Virahol in solution, mixing (100mg-100ul Virahol);

(7) the silicon gel column in test kit is put into 2ml collection tube;

(8) in conjunction with DNA: solution is added on pillar, centrifugal 1min, 13000rpm (liquor capacity is once centrifugal again more than 800ul);

(9) use up effluent liquid, pillar is put back in centrifuge tube again;

(10) add 0.5mlBufferQG on pillar, centrifugal 1min, 13000rpm;

(11) wash-out: use up effluent liquid, add 750ulBufferPE on pillar, centrifugal 1min;

(11) use up effluent liquid, centrifugal 1min, 13000rpm;

(12) pillar is put into a clean 1.5ml centrifuge tube;

(13) elution DNA, adding 50ulBufferEB or pH is in the middle of 7.0-8.5 water to film, centrifugal 1min;

3, eppendorfBio-PhotoMeterplus is utilized to measure V _hand V _lconcentration

4, the Sequencing and analysis of sequence

(1) Mass Spectrometric Identification of antibody

Paraxin monoclonal antibody is carried out purifying, after utilizing papoid to be hydrolyzed, utilize ProteinA adsorb antibodies constant region, obtain the Fab of purifying, utilize SDS-PAGE to carry out detecting (Fig. 2), heavy chain and light chain are cut down carry out Mass Spectrometric Identification respectively.

(2) sequencing of antibody gene variable region

Be connected in carrier T by variable region of heavy chain and variable region of light chain, carry out mass-producing order-checking, often kind sequencing fragment 20-30 clone, the nucleotide sequence that order-checking obtains is translated into aminoacid sequence, and with mass spectrum sequencing result, compare (Fig. 3,4).According to comparison result, select the V the most close with mass spectrum sequencing result _hno. 15 and V _lno. 1 is continued subsequent experimental.

5, CAP-scFv synthesis

(1) pre-splicing system:

PCR program:

Gained PCR primer is used for the formal splicing of scFv.

(2) scFv formally splices system

PCR program:

Through pcr amplification, product agarose gel electrophoresis detects, and the results are shown in Figure 5.Cut the object band of about about 750bp, reclaim with Qiagen gel purification kit glue, eppendorfBio-PhotoMeterplus measures concentration ,-20 DEG C of preservations.

6, subclone experiment

A.scFv connects pMD18-Tvector

Linked system:

16 DEG C connect 16h.

B. product conversion JM109 competent cell is connected

(1) 100 μ LJM109 competent cells placements are thawed on ice.

(2) connection product 10 μ L is joined in 50 μ L competent cells, place 30min on ice after mixing gently.

(3) by mixture 42 DEG C of water-bath 60s, then place cooled on ice 2min rapidly, attention can not be rocked.

(4) 800 μ LLB liquid nutrient mediums are added, 37 DEG C, 200rpm shaking culture 1h.

(5) 5000rpm, centrifugal 5min, outwells substratum, on the LB solid medium flat board approximately staying 100 μ L to be coated with containing microbiotic Amp, 37 DEG C of grow overnight.

C. positive colony is verified

Mono-clonal bacterium colony on picking Amp flat board is resuspended in 10 μ L sterilized waters, does bacterium colony PCR experiment with M13 universal primer.The results are shown in Figure 6.

(1) PCR system:

(2) pcr amplification program:

(3) agarose gel electrophoresis detects PCR primer.

D. recombinant plasmid scFv-pMD18-T is obtained

(1) mono-clonal on picking Amp flat board, is transferred in LB liquid nutrient medium, 37 DEG C, 200rpm, incubated overnight.

(2) the little extraction reagent kit of sky root plasmid extracts recombinant plasmid scFv-T, and step is as follows:

1. column equilibration step: adsorption column is put into collection tube, adds 500 μ L balance liquid BL, the centrifugal 1min of 13000rpm in adsorption column, inhales and abandons waste liquid in collection tube, put back in collection tube by adsorption column.

2. get the bacterium liquid of 1-5mL incubated overnight, join in centrifuge tube, the centrifugal 1min of 13000rpm, as far as possible supernatant is abandoned in suction, and bacterium liquid is more, can centrifugal several times after by microorganism collection in same centrifuge tube.

3. to containing adding 250 μ LBufferP1 (BufferP1 will guarantee to have added RNaseA before the use) in the centrifuge tube of bacterial sediment, use pipettor piping and druming or the thorough suspended bacterial precipitation of vortex, if thalline is thoroughly mixing, can cracking be affected, cause extracted amount and purity on the low side.

4. continue in centrifuge tube, add 250 μ LBufferP2, spin upside down mixing 6-8 time, operation wants gentle, and guarantee the abundant cracking of thalline, now bacterium liquid can become limpid thickness, and the time used does not exceed 5min, in order to avoid plasmid sustains damage.

5. in centrifuge tube, add 350 μ LBufferP3, leniently spin upside down 6-8 time immediately, now there will be white flock precipitate, the centrifugal 10min of 13000rpm.

6. carefully draw supernatant, note not being drawn onto precipitation, supernatant is joined in adsorption column

7. the centrifugal 1min of 13000rpm, inhale and abandon waste liquid in collection tube, adsorption column puts back to collection tube.

8. in adsorption column, add 700 μ LBufferPW (BufferPW will add dehydrated alcohol before using), the centrifugal 1min of 13000rpm, inhales and abandons waste liquid in collection tube, placed back in collection tube by adsorption column.

9. in adsorption column, add 500 μ LBufferPW (please check whether and add dehydrated alcohol), the centrifugal 1min of 13000rpm, inhale and abandon waste liquid in collection tube, adsorption column is placed back in collection tube.

10. the centrifugal 2min of 13000rpm, inhales and abandons waste liquid in collection tube.Adsorption column is uncapped and is placed in room temperature 10min, thoroughly to dry BufferPW remaining on adsorption film.

(11) getting adsorption column is positioned in clean centrifuge tube, and to the unsettled dropping 50 in adsorption film middle part μ L sterilized water, room temperature places the centrifugal 1min of 1-2min, 13000rpm, is collected by plasmid solution in centrifuge tube, preserves plasmid for-20 DEG C.

7, the structure of CAP-scFv-pLIP6/GN expression plasmid

The double digestion of A.scFv-pMD18-T recombinant plasmid and pLIP6/GN empty plasmid.

(1) cut scFv-T with restriction enzyme SfiI enzyme, it is as follows that enzyme cuts system:

50 DEG C of water-baths are incubated overnight.

(2) continue enzyme with restriction enzyme NotI and cut scFv-T, the previous step enzyme system of cutting is got

Go out water-bath, be cooled to room temperature, in system, add 1 μ LNotI, 37 DEG C of water-bath incubation 1.5h.

(3) scFv connects pLIP6/GN

Linked system:

16 DEG C connect 16h.

B. product conversion JM109 competent cell is connected

(1) 100 μ LJM109 competent cells placements are thawed on ice.

(2) connection product 10 μ L is joined in 50 μ L competent cells, place 30min on ice after mixing gently.

(3) by mixture 42 DEG C of water-bath 60s, then place cooled on ice 2min rapidly, attention can not be rocked.

(4) 800 μ LLB liquid nutrient mediums are added, 37 DEG C, 200rpm shaking culture 1h.

(5) 5000rpm, centrifugal 5min, outwells substratum, on the LB solid medium flat board approximately staying 100 μ L to be coated with containing microbiotic Amp, 37 DEG C of grow overnight.

C. positive colony is verified

(1) bacterium colony PCR verifies

1. the mono-clonal bacterium colony on picking Amp flat board is resuspended in 10 μ L sterilized waters, does bacterium colony PCR experiment with phoA universal primer.

2. PCR system:

3. pcr amplification program:

4. agarose gel electrophoresis detects PCR primer.The results are shown in Figure 7.

(2) digestion verification

Extract bacterium colony PCR and be verified as positive monoclonal plasmid, with SfiI and NotI double digestion, agarose gel electrophoresis detects digestion products.The results are shown in Figure 8.

(3) check order

Verify correct strain inoculation incubated overnight in LB-Amp.Bacterium liquid delivers to the order-checking of Beijing Jin Wei intelligence biotech firm, and the primer is phoA.Finally utilize MEGA5 software by sequencing result with known V _hno. 15, V _lno. 1 contrasts with Linker sequence, and the bacterial strain that scFv gene order is consistent is CAPscFv-pLIP6/GN-BL21 bacterial strain.

Embodiment 3:CAP-scFv-pLIP6/GN expression vector recombinant expressed

1, the preparation of BL21 (DE3) competent cell

(1) BL21 (DE3) bacterial classification that-80 DEG C are preserved is rule on LB solid plate, be inverted overnight incubation for 37 DEG C.

(2) picking mono-clonal, is inoculated in 5mLLB liquid nutrient medium, 37 DEG C, 180rpm, overnight incubation.

(4) getting the bacterium liquid of 100 μ L incubated overnight, be forwarded in 100mLPsi substratum, 37 DEG C of about shaking culture 3h, is about 0.4-0.5 to OD600.

(5) bacterium liquid is gone in 100mL sterile centrifugation tube, place 30min on ice.4 DEG C, the centrifugal 3min of 4000rpm.

(6) abandon supernatant, add 80mLtfb I, blow and beat gently with pipettor, abundant re-suspended cell, be placed in 20min on ice.4000rpm4 DEG C of centrifugal 3min.

(7) abandon supernatant, add 10mLtfb II, blow and beat gently with pipettor, abundant re-suspended cell, be placed in 20min on ice.100 μ L packing on ice chest, liquid nitrogen flash freezer, is stored in-80 DEG C of refrigerators for subsequent use.

2, the preparation of expression strain

By 6 recombinant plasmid CAPscFv1,2,3,4,5,6-pLIP6/GN proceeds to respectively and expresses in bacterium e. coli bl21 (DE3) competent cell.The mono-clonal that picking transformation plate grows, is inoculated in LB-Amp substratum and carries out 37 DEG C of incubated overnight.

3, abduction delivering and SDS-PAGE detect

The abduction delivering of A.CAPscFv-pLIP6/GN-BL21

Get the bacterium liquid of 50 μ L incubated overnight, be transferred in new 5mLLB nutrient solution (containing 100 μ g/mLAmp) in 1:100 ratio, cultivate about 3h, when OD600 reaches 0.8-1.0, adding IPTG to final concentration is 0.1mM, 25 DEG C of 180rpm overnight incubation, carry out scFv abduction delivering.

B. ultrasonication and SDS-PAGE detection is carried out.

In e. coli bl21 (DE3), whether can carry out normal expression in order to detecting CAPscFv, utilizing SDS-PAGE to detect, and probed into the expression position of target protein and whether formed inclusion body.SDS-PAGE step is as follows:

(1) sample pre-treatments

Get 500 μ L bacterium liquid before induction, the centrifugal 5min of 5000rpm, gets 200 μ L PBS resuspended, as contrast before induction; Culture after residue 4.5mL induction, the centrifugal 5min of 5000rpm, removes supernatant, and thalline 2.5mLPBS carries out resuspended.Get wherein 500 μ L bacterium liquid and be stored in 4 DEG C, be i.e. whole protein after induction.Residue 2mL carries out ultrasonication in mixture of ice and water.Condition: ultrasonic 1s, interval 3s, omnidistance 99 times, power 250W.

By the bacterium liquid of ultrasonication at 4 DEG C, the centrifugal 8min of 13000rpm, cleer and peaceful precipitation in collection, precipitation 2mLPBS is resuspended.Get respectively 15 μ L induce before and after bacterium liquid, cleer and peacefully in fragmentation be deposited in PCR pipe, add 12 μ L2 × SDS-PAGE sample-loading buffers and 3 μ L beta-mercaptoethanols, mix, use boiling water boiling 5min, for subsequent use.

(2) preparation of poly amic acid gel:

12% separation gel: water 1.6mL, 30% acrylamide 2mL, 1.5MTris-HCl (pH=8.3) 1.3mL, 10%SDS50 μ L, 10% ammonium persulphate 50 μ L, TEMED4 μ L.Each component is mixing rapidly after adding, and adds in the glue plate assembled, and during to be added to offset plate about 2/3 height, layer Virahol seals thereon, and envelope is to whole offset plate top.Whether room temperature places about 1h (depending on room temperature), and offset plate is integral inclined, observe and solidify, if solidify removal Virahol, blot with filter paper, gets clean comb and inserts glue plate gap.

6% concentrated glue: water 1.4mL, 30% acrylamide 0.33mL, 1.5MTris-HCl (pH=6.8) 0.25mL, 10%SDS20 μ L, 10% ammonium persulphate 20 μ L, TEMED4 μ L.Each component mixes after adding immediately, along comb gap encapsulating, depresses comb gently, drive bubble away when glue is filled soon, and room temperature places 40min.Rock comb gently, observe concentrated glue and whether solidify, take out comb after to be solidified, namely complete glue process.

(3)SDS-PAGE：

According to electrophoresis apparatus specification sheets, gel slab is fixed on support, puts into electrophoresis chamber, add 1 × electrophoretic buffer.Negative pole place adds electrophoresis liquid to there be not loading hole, and positive pole place is to there be not positive pole, and with loading pin by forward and backward for the induction of 3 thalline, broken supernatant, deposit sample add in loading hole successively, each 15 μ L.10 μ L albumen Marker on the left of sample.Electrophoresis apparatus is connected with power supply, first with 80V voltage, tetrabromophenol sulfonphthalein band was run the intersection of concentrated glue and separation gel, then run glue with 100V voltage and take away 0.5cm place bottom offset plate to tetrabromophenol sulfonphthalein bar, stop electrophoresis.

(4) dyeing and decolouring

Carefully dismantled by device after electrophoresis, gel is placed in 200mL coomassie brilliant blue R_250 staining fluid and dyes, and room temperature jog spends the night.Turn sky, gel is clean with aseptic water washing, decolour twice.Decolour each 100mL destainer (methyl alcohol 7mL, ethanol 30mL, water 63mL) 10min, utilizes imager imaging after clear to band.The results are shown in Figure 9,10.

C. purifying CAPscFv antibody

With the supernatant after the ultrasonication of Ni-NTA column purification.Step is as follows:

(1) agents useful for same all needs ultrasonic 15 minutes before the use, to remove the bubble in solution.

(2) 10mL1*BindBuffer slowly adds in pillar, leaves standstill 30 minutes at 4 DEG C.

(3) open the stopper at two ends, allow liquid slowly flow out, add the supernatant liquor 5mL after ultrasonication, at 4 DEG C, leave standstill 60 minutes.

(4) open the stopper at two ends, allow liquid slowly flow out, add 10mL1*washingbuffer, collect effluent liquid.

(5) add 4mL1*elutionbuffer, collect effluent liquid.

D.SDS-PAGE detects the albumen after purifying.The results are shown in Figure 11.Protein sample corresponding to the swimming lane that band is single, at 4 DEG C, is dialysed 3 days with PBS.

Embodiment 4: indirect competitive ELISA detects CAPscFv

Indirect competitive ELISA is utilized to carry out preliminary evaluation to the CAPscFv activity after purifying.Coating antigen is CAP-OVA, and confining liquid is the milk powder of 0.5%, and paraxin is as standard substance.Calculate IC50 value.Indirect competitive ELISA step is as follows:

(1) bag quilt: get CAP-OVA, 0.1 μ g/ hole Bao Bei96 hole enzyme plate 12-16h.

(2) wash plate: incline coating buffer, PBST washes 3 times, pats dry.

(3) close: every hole adds 200 μ L, the milk powder of 0.5%, 37 DEG C of closed 1h.

(4) plate is washed: incline deblocking liquid, and PBST washes 3 times, pats dry.

(5) in enzyme plate, add standard substance 50 μ L respectively.

(6) add antibody: the CAPscFv after purifying is diluted 6 times, get 50 μ L and join in the enzyme plate of each concentration standards, hatch 1h for 37 DEG C.

(7) plate is washed: incline scFv antibody supernatant, and PBST washes 4 times, pats dry.

(8) develop the color: add AP chromogenic substrate pNPP, 100 μ L/ holes, 37 DEG C of colour developing 20min.

(9) stop: add 3MNaOH stop buffer, 50 μ L/ holes, read OD by microplate reader under 405nm wavelength ₄₀₅numerical value.

Through indirect competitive ELISA, CAPscFv PBS dilutes 6 times, colour developing 20min.ELISA result is as follows:

Paraxin standardized solution, from the downward four times of dilutions of 500ng/mL six concentration, measures with indirect competitive ELISA method.Calculate inhibiting rate according to absorbance, the standard establishing ELISA method as shown in figure 12 suppresses curve, can obtain equation of linear regression y=15.733ln (x)+32.868 (R by four points ²=0.9988), by calculating, detection sensitivity (IC50 value) is 2.97 ± 0.52ng/mL, detectability (IC15 value) is 0.33 ± 0.11ng/mL, and this detection sensitivity can be used for the preliminary examination of residual chloromycetin in food samples.

Claims (7)

1. an antibody gene of chloramphenicol resistance scFv, is characterized in that: it comprises heavy chain gene and light chain gene, and this gene is made up of 714 Nucleotide, and the sequence of described heavy chain gene is shown in sequence 1, and the gene order of light chain gene is shown in sequence 2.

2. by the antibody of the chloramphenicol resistance scFv of genes encoding described in claim 1.

3. the antibody of chloramphenicol resistance scFv according to claim 2, is characterized in that: variable region of heavy chain is made up of 117 amino acid, and flexible link zone is by 15 amino acid, and variable region of light chain is made up of 108 amino acid.

4. the carrier containing antibody gene according to claim 1.

5. the genetic engineering bacterium containing antibody gene according to claim 1.

6. carrier according to claim 4 or genetic engineering bacterium according to claim 5 are preparing the application in chloramphenicol resistance scFv antibody.

7. a screening method for chloramphenicol antibody gene variable region of heavy chain and variable region of light chain, is characterized in that: step is as follows

(1) pcr amplification is carried out in the variable region of heavy chain of antibody gene, variable region of light chain, be connected with carrier T and transformation of E. coli competent cell, carry out large scale sequencing after screening positive clone, utilize sequence alignment program to carry out sequence alignment analysis to the structure after order-checking;

(2) paraxin monoclonal antibody is carried out enzymolysis, obtain Fab proteolytie fragrnent, and the heavy chain after hydrolysis and light chain are carried out Mass Spectrometric Identification respectively;

(3) be aminoacid sequence by large scale sequencing results conversion, the amino acid fragment obtained with Mass Spectrometric Identification result carries out sequence alignment analysis, the sequence that screening is consistent with simple qualification result from sequencing result, thus the variable region of heavy chain and the variable region of light chain that obtain target antibody gene.