CN108823243A

CN108823243A - A method of conversion sorghum cDNA library improves rice varieties

Info

Publication number: CN108823243A
Application number: CN201810733069.3A
Authority: CN
Inventors: 乔保建; 付锡江; 任代胜; 夏祥华; 陶元平; 彭冲
Original assignee: Anhui Yuan Liang Rice Industry Co Ltd
Current assignee: Anhui Yuan Liang Rice Industry Co Ltd
Priority date: 2018-07-05
Filing date: 2018-07-05
Publication date: 2018-11-16

Abstract

The invention discloses a kind of methods of conversion sorghum cDNA library improvement rice varieties, are related to molecular biology field.The cDNA library that the present invention passes through building sorghum, and entered in rice genome by agrobacterium mediation converted, high throughput improvement rice varieties, screening has the individual of excellent genes characteristic in the transgenosis system of acquisition, transgenosis system is compared with wild type, apparent variation is showed in terms of plant height, tiller, heading stage, resistance starch content, species test is analysis shows that part Transgenic Rice system is related to yield promotion.The present invention is short, high-efficient with the time, rice mutant character is abundant.Transgenosis verifying analysis is carried out to the rice plant for occurring changing, genetic background is clear, screens available excellent genes and improves for the targeting of subsequent rice.

Description

A method of conversion sorghum cDNA library improves rice varieties

Technical field

The present invention relates to molecular biology domain, in particular to a kind of side of conversion sorghum cDNA library improvement rice varieties Method.

Background technique

Rice yield is all agricultural science and technology worker focus of attention and hot spot all the time concerning world food safety. We can improve rice yield by various means at present, for example, fertilising laxative, scientific farming, Rational Irrigation, develop it is miscellaneous Rice is handed over, develops ratooning rice, triple cropping of rice plantation, rice etc. is improved by transgenic technology.With the development of the society, to build at us If friendly environment society and in the case where requiring food safety, rice is improved energetically, saving chemical fertilizer and go and buy Chinese medicine less is one and knows together, And just there is two o'clock to merit attention here, first is that develop hybrid paddy rice, such as red lotus type hybrid paddy rice " excellent No. 8 of road " and " excellent No. 10 of Lip river ', With high yield, high-quality, wide suitable, saving agriculture chemical；Second is that excavating Fineness gene rice transformation improves rice yield and degeneration-resistant anti- Pest and disease damage ability such as significantly improves the sorghum gene shrunken-2 (Sh2) of rice yield, Bph14/I S brown planthopper resistant gene Deng.

The host that research finds that Agrobacterium is infected is more, and Agrobacterium transgenosis is first in dicotyledon (such as arabidopsis and tobacco Deng) in applied, be also applied monocotyledon (rice, sorghum, sorghum, wheat etc.) is inner later.Agrobacterium turns The unique advantage that efficient and its of gene technology have, so that multiple large size mutant libraries are fabricated success；Researcher can be with The flanking sequence of insertion point, and some flanking sequences are identified using certain methods such as connector PCR, cyclisation PCR, TaiL-PCR etc. Oneself is submitted on website for other researchers in need reference and is analyzed information, and benefit is just omitted our expenses When laborious map based cloning work.

The advantages of transgenic technology of mediated by agriculture bacillus.1, due to the T-DNA sequence of insertion be it is known, this can be from The relationship of forward genetics technique study gene and phenotype, and clone gene is more relatively easy；Although 2, Agrobacterium transgenosis Multiple copies can be inserted into, but it is comparatively still very low, be conducive to obtain the homozygous single plant that can stablize heredity, meet Meng Dare heredity law of segregation etc.；3, current research shows that T-DNA is inserted with Preference, but also have randomness, and in large size It is applied in the building of mutant library.

Sorghum is grass family annual herb plant, be the fifth-largest crops in the world as corn, millet and sugarcane all It is C4 plant.Sorghum have very strong environmental suitability, be widely cultivated, drought resisting, high temperature resistant, in terms of than other Crop is stronger, and the loss that the surface of cauline leaf has one layer of white wax that can reduce moisture content, African northeast arid area and Southern US Plain normally can plant sorghum that is to say, bright adapt to extreme environment such as high temperature and very little rainfall.It is tight in fresh water Lack again, in the case where global warming and population huge explosion, the status of this crops that can be grown in arid area of sorghum More highlight.Therefore, sorghum has more Fineness gene resources in these areas.In addition, sorghum genome is about 730Mb, this is bigger than rice genome by 75%, but the gene order of genome one third and density are similar to rice.7% Gene is specific to sorghum, and from evolution angle analysis, it is very strong that most newly generated gene and microRNA may impart jowar O good in view of the sorghum environmental suitability of drought-resistant ability (Paterson et al.2009), more particularly to adapting to hot arid Area, so sorghum becomes a model organism for studying tropical crops, transgenic research work is concerned.Rice and height There is very high synteny between this two species gene of fine strain of millet, therefore we can also study the gene function of sorghum in rice.Sorghum Certain merits it is for example resistant to lodging, amylose content is high, it is drought-enduring can be used for improveing current rice varieties, and modern molecular Biology Breeding technology not only overcomes the gene exchange obstacle across kind, while also improving breeding speed and quality, in addition, The gene function of sorghum can be studied in transgenic paddy rice.

Currently, rice breeding is divided into conventional hybridization breeding and gene recombination, conventional hybridization breeding has genetic background It is single, screening period long disadvantage, can not efficiently concentrating excellent genes, gene recombination is limited to the survey to term single gene again Sequence, positioning and clone, can not the excellent Transgenic Rice of high flux screening.Therefore, one kind is developed quickly, it is simple, efficient High-throughput conversion sorghum cDNA library improvement rice varieties method it is very necessary.

Summary of the invention

The technical problems to be solved by the invention：For at present to present in the utilization of sorghum genetic resources and rice breeding Problem, the invention discloses one kind quickly, the side of simple, the efficient high-throughput cDNA library improvement rice varieties for converting sorghum Method.

In order to solve the above technical problems, the present invention provides technical solution below：

A method of conversion sorghum cDNA library improves rice varieties, includes following operating procedure：

(1) building of sorghum cDNA library；

(2) sorghum cDNA library sequence is analyzed：It, will by 50 random monoclonal sequencing analysis in the library E.coil sorghum cDNA Sequencing sequence uploads to ncbi database and carries out sorghum gene BLAST analysis, records for example matched gene of information of relevant matches Accession number, percentage, CDS (coding sequence), gene annotation etc. carry out cDNA integrity analysis and ORF prediction；

(3) E.coli sorghum cDNA library plasmid in large scale extracts；

(4) preparation of Agrobacterium competent cell, method are as follows：

Picking Agrobacterium single colonie is inoculated in the YEB fluid nutrient medium of 5mL 100 μ g/mL containing streptomysin, and 28 DEG C, 250rpm cultivates 12h；It draws 2mL culture and is transferred to 50mL YEB fluid nutrient medium, continue culture to OD₆₀₀Value is 0.5~1.0, Bacterium solution is gone in sterile centrifugation tube, ice bath 30min, 5000rpm are centrifuged 5min；With the sterile CaCl of 20mmoL/L of 1.7mL₂ Thallus is resuspended, adds 300 microlitres of sterile glycerols, after mixing, is sub-packed in sterile 0.5mL microcentrifugal tube by every 200 μ L of pipe In, -70 DEG C deposit it is spare.

(5) sorghum purpose cDNA is overexpressed Library plasmid and is transferred to Agrobacterium, and method is as follows：

(A) it is placed in from -70 DEG C of taking-up Agrobacterium competence and melts on ice first；

(B) 2mg recombinant plasmid dna is added in the LBA4404 competent cell of 200 μ L, then ice bath 5min goes to liquid 8min is freezed in nitrogen, after incubating 5min in 37 DEG C of ice baths rapidly, 800 μ L antibiotic-free YEB fluid nutrient mediums of addition, 28 DEG C, 250rpm expresses culture 4h~5h in advance, then applies and spreads YEB plate containing kanamycin, streptomysin, 28 DEG C of culture 36h；

(C) clump count grown on plate is counted, picking single bacterium is fallen within containing 50 μ g/mL kanamycins, 100 μ g/mL chains Bacterium is shaken in the YEB fluid nutrient medium of mycin, 28 DEG C, 250rpm cultivates 12h, 5000rpm, is centrifuged 10min, collects thallus, sterile Water washing is resuspended with 20% glycerine water solution afterwards three times, and -20 DEG C save backup；

(6) mediated by agriculture bacillus sorghum cDNA conversion improvement rice varieties：

(a) glume clean and bright, current year seed is selected, glume is peelled off, 100mL is put on aseptic operating platform It in the conical flask of sterilizing, is cleaned seed 3 times with the distilled water of sterilizing, then with 75% alcohol disinfecting 2 times, then each 1min is used The distillation of sterilizing is washed after 3 removing alcohol, is sterilized 15min with 0.15% mercuric chloride, is during which shaken with hands conical flask, discard Mercuric chloride is cleaned seed 3 times with aqua sterilisa, then eliminates extra moisture, and seed is inoculated into B5 by 10 seeds of every plate On solid medium, sealed membrane is sealed, and under 28 DEG C of dark conditions, is cultivated 30 days；

(b) yellow embryo callus is inoculated on new subculture medium, 28 DEG C are protected from light culture 25d, select bright orange Color, drying compact embryogenic callus be inoculated on precultivation medium, this culture medium is added with 50 μ g/mL acetyl cloves of final concentration Ketone is cultivated 4 days under 28 DEG C of dark conditions；

(c) Agrobacterium containing sorghum cDNA is coated on containing 50 μ g/mL kanamycins, 100 μ g/mL streptomysins On YEB solid medium, 28 DEG C of dark culturings for 24 hours, on aseptic operating platform, draw Agrobacterium suspension medium gently with pipette tips The Agrobacterium containing sorghum cDNA is blown and beaten, these solution is then drawn again and is added in 50mL Agrobacterium suspension medium, simultaneously The acetosyringone of 50 μ L, 50mg/mL is added, demarcates OD₆₀₀It is 0.5, is then added and grows 5 days callus on AS, 42 Heat shock 30min under the conditions of DEG C；

(d) it eliminates bacterium solution as far as possible on aseptic operating platform, callus is spread out to be placed in and sterilized is put down with filter paper Ware up-draught 1h then, is transferred into co-culture medium, 24 DEG C until callus surface moisture is dried, dark Lower culture 5d；

(e) on aseptic operating platform, it is to be gone out in 250mL triangular flask with 2L that the callus after co-cultivation, which is put into size, The ddH of bacterium₂O is washed 5 times, is washed 2 times with the aseptic double-distilled water containing 100 μ g/mL streptomysins, each duration 15min, and use is hand It is dynamic, then callus is spread out and carries out dry tack free on the plate with aseptic filter paper；

(f) callus of above-mentioned dry tack free is inoculated into containing 50 μ g/mL kanamycins, 100 μ g/mL streptomysins It is screened on screening and culturing medium, every plate places callus 15, cultivates 24 days under 28 DEG C of dark conditions, then by callus group Knit be inoculated into it is new containing carrying out programmed screening on 50 μ g/mL kanamycins, 100 μ g/mL streptomysin screening and culturing mediums, 28 DEG C It is cultivated 24 days under dark condition；

(g) callus by the yellow grown densification breaks up, and prepares differential medium placement 4~6 days, then, Callus to be broken up is inoculated on culture medium, is grown 15~20 days under 28 DEG C of light, seedling is long to 3~5cm, moves it to It takes root on 1/2MS root media；

(h) hardening can be carried out to it when transgenic seedling root system is flourishing enough, can adapt to soil-grown environment, it will Then plus sterile ddH it, which is placed in planting environment, grows 3 days,₂O hardening 4d directly takes out transgenic seedling from culture medium And it cultivates into soil；

(i) the Transgenic Rice system that transgenosis obtains screens excellent by plantation and the Phenotypic Observation in T0 generation, T1 generation and T2 generation Good rice strain.

Preferably, the sorghum cDNA library building includes following operating procedure：

(1) sorghum Total RNAs extraction, liquid feeding nitrogen grind the young stem of sorghum in mortar, extract various materials respectively with TRIzoL The total serum IgE of material, and take a small amount of RNA for agarose gel electrophoresis and measure its OD₂₆₀/OD₂₈₀, OD₂₆₀/OD₂₃₀Value；

(2) referring to Creator SMART cDNA Construction Kit specification using LD PCR method synthesis one Two chains, and the cDNA product of synthesis is then carried out homogenization processing with DSN double-stranded specific nuclease by electrophoresis detection result, Sample after homogenization carries out PCR amplification, and electrophoresis detection result；

(3) end adds A after the PCR product purification and recovery after uniforming, and adds A product with PCR clean up Kit recycling, It is connected on pGBI121S2B carrier, is transformed into E.coli, be coated on the LB plate containing 50 μ g/mL kanamycins and trained It supports and carries out the identification of PCR amplification rear electrophoresis using 60 single colonies of the M13 universal primer to random picking, estimated according to electrophoresis result The size and small fragment rate of Insert Fragment are counted, and calculates storage capacity.

Preferably, the agrobacterium strains are LBA4404, and E.coli bacterial strain is DH-5 α, and the rice varieties are middle flower 11。

Preferably, transgenosis system T0 generation plantation and greenhouse, bagging selfing, T1~T2 are planted for group in outdoor crop field, Every part of material plants 30~50 plants, and 10 plants of every row, conventional rice Cultivate administration screens excellent rice strain.

Preferably, the E.coli sorghum cDNA library plasmid in large scale method for extracting is as follows：

(A) the E.coli sorghum purpose library bacterium solution of 400 μ L is taken to be connected to the 1L conical flask containing 200mL YEB fluid nutrient medium In, add 200 μ L, 50mg/mL kanamycins, 37 DEG C, 300rpm cultivates 16h；

(B) it takes four 100mL centrifuge tubes to be centrifuged bacterium solution, collects precipitating, condition is 4 DEG C, and 12000g is centrifuged 2min；

(C) each centrifuge tube is separately added into 10mLP1, and P1 will ensure that RNase A and LyseBLue is added before using, and then will Precipitating mixes, and not have lumpy precipitate；

(D) each centrifuge tube is respectively added the P2 of 10mL37 DEG C of preheating and buckles lid immediately, and movement is soft, turns upside down 10 Secondary thorough mixing bacterium solution, until bacterial suspension becomes indigo plant, 25 DEG C of incubation time 3min of room temperature；

(L) P3 of 10mL pre-cooling should be added in every pipe in time after above-mentioned bacterium solution becomes basket, and existing side by side engraves lower gentle inversion 10 times Mix bacterium solution, it is seen that blue becomes clear, White Flocculus occurs, then be incubated for 20min on ice；

(M) after being incubated for, 4 DEG C, 12000g is centrifuged 30min, draws supernatant, discards precipitating；

(N) it is centrifuged again with 4 DEG C, 12000g is centrifuged 15min, equally absorption supernatant；

(O) pillar is balanced with QBT equilibrium liquid, takes a QIAGEN-tip 500, QBT 10mL is added, is made by gravity With making QBT liquid flow sky naturally；

(P) pillar is added in the supernatant containing plasmid, flows down it naturally through filter membrane, wash 3 times with cleaning solution QC, often Secondary 30mL, the empty mode of stream cleans pillar naturally, then uses 15mL plasmid eluent QF eluted dna；

(Q) DNA is precipitated, the isopropanol of 0.7 times of volume of eluent is added into eluent, mixing of turning upside down at once, so 4 DEG C afterwards, 12000g is centrifuged 30min, discards supernatant；

(R) 75% alcohol washes of 8mL are used, 12000g is centrifuged 15min, abandons supernatant；

(L) precipitating 15min is spontaneously dried, adds 100 μ LTE, PH8.0 dissolution precipitatings, with Nanodroping measurement plasmid Concentration.

Preferably, the sorghum variety is three all sorghums.

The beneficial effect that the present invention obtains：

The gene of sorghum is entered in rice genome by the building high throughput conversion of cDNA library, turns base in acquisition Because being middle individual of the screening with excellent genes characteristic, transgenosis system is compared with wild type, in plant height, tiller, heading stage, resistance Apparent variation is showed in terms of content of starch, species test is analysis shows that part Transgenic Rice system is related to yield promotion.This Invention is short, high-efficient with the time, rice mutant character is abundant.Transgenosis verifying point is carried out to the rice plant for occurring changing Analysis, genetic background is clear, screens available excellent genes for subsequent rice and targets improvement.

Detailed description of the invention

Fig. 1 kanamycins primer PCR identifies positive transgenic strain

M：DNA Marker

Specific embodiment

Below by the description to embodiment, specific embodiments of the present invention will be described in further detail, with side Those skilled in the art is helped to have more complete, accurate and deep understanding to inventive concept of the invention, technical solution.

Embodiment 1：

It converts sorghum cDNA library and improves rice varieties, steps are as follows：

The building of (1) three all sorghum cDNA library：

(1.1) sorghum Total RNAs extraction, liquid feeding nitrogen grind the young stem of three all sorghums in mortar, are extracted respectively with TRIzoL The total serum IgE of a variety of materials, and take a small amount of RNA for agarose gel electrophoresis and measure its OD₂₆₀/OD₂₈₀, OD₂₆₀/OD₂₃₀Value；

(1.2) it is synthesized referring to Creator SMART cDNA Construction Kit specification using LD PCR method One or two chains, and electrophoresis detection result then carries out the cDNA product of synthesis at homogenization with DSN double-stranded specific nuclease Reason, the sample after homogenization carry out PCR amplification, and electrophoresis detection result；

(1.3) end adds A (condition is template after the PCR product purification and recovery after uniforming:5 μ L, 10 × PCRBuffer: 5 μ L, dNTPmix:1 μ L, rTaq enzyme:0.3 μ L, H₂O:38.7 μ L, 72 DEG C, 30min), with PCR clean up Kit recycling plus A Product is connected on pGBI121S2B carrier, is transformed into competence E.coli DH-5 α, is coated on containing kanamycins (50 μ g/ ML LB plate) carries out culture and carries out PCR amplification rear electrophoresis mirror using 60 single colonies of the M13 universal primer to random picking It is fixed, the size and small fragment rate of Insert Fragment are estimated according to electrophoresis result, and calculate storage capacity；

(2) sorghum cDNA library sequence is analyzed：It, will by 50 random monoclonal sequencing analysis in the library E.coil sorghum cDNA Sequencing sequence uploads to ncbi database and carries out sorghum gene BLAST analysis, records for example matched gene of information of relevant matches Accession number, percentage, CDS (coding sequence), gene annotation etc. carry out cDNA integrity analysis and ORF prediction, choose Select 46 have ORF, wherein 26 clone have with sorghum gene consistent CDS NCBI on, by this 26 clone be used for after Continuous plasmid extracts and conversion.

(3) E.coli DH-5 α sorghum cDNA library plasmid in large scale extracts：

(A) the E.coli DH-5 α sorghum purpose library bacterium solution of 400uL is taken to be connected to the 1L taper containing 200mL YEB culture medium In bottle, add 200 μ L, 50mg/mL kanamycins, 37 DEG C, 300rpm cultivates 16h；

(C) each centrifuge tube adds 10mL P1 (P1 will ensure that RNase A and LyseBLue is added before using) respectively, then will Precipitating mixes, and not have lumpy precipitate；

(D) each centrifuge tube is respectively added the P2 of 37 DEG C of 10mL preheatings and buckles lid immediately, and movement is soft, turns upside down 10 thorough mixing bacterium solutions, until bacterial suspension becomes indigo plant, 25 DEG C of incubation time 3min of room temperature；

(E) P3 of 10mL pre-cooling should be added in every pipe in time after above-mentioned bacterium solution becomes basket, and existing side by side engraves lower gentle inversion 10 times Mix bacterium solution, it is seen that blue becomes clear, White Flocculus occurs, then be incubated for 20min on ice；

(F) after being incubated for, 4 DEG C, 12000g is centrifuged 30min, draws supernatant, discards precipitating；

(G) it is centrifuged again with 4 DEG C, 12000g is centrifuged 15min, equally absorption supernatant.

(H) pillar is balanced with QBT equilibrium liquid, takes a QIAGEN-tip 500, QBT 10mL is added, is made by gravity With making QBT liquid flow sky naturally；

(I) pillar is added in the supernatant containing plasmid, flows down it naturally through filter membrane, wash 3 times with cleaning solution QC, often Secondary 30mL, the empty mode of stream cleans pillar naturally, then uses 15mL plasmid eluent QF eluted dna；

(J) DNA is precipitated, isopropanol 9.1mL (according to 0.7 times of volume of eluent) is added into eluent, at once up and down It is mixed by inversion, then 4 DEG C, 12000g is centrifuged 30min, discards supernatant；

(K) 75% alcohol washes of 8mL are used, 12000g is centrifuged 15min, abandons supernatant；

(L) precipitating 15min is spontaneously dried, 100 μ LTE, PH8.0 dissolution precipitatings, as recombinant plasmid solution are added.

(4) preparation of Agrobacterium competent cell, method are as follows：

Picking Agrobacterium single colonie is inoculated in the YEB fluid nutrient medium of 5mL 100 μ g/mL containing streptomysin, and 28 DEG C, 250rpm cultivates 12h；It draws 2mL culture and is transferred to 50mL YEB fluid nutrient medium, continue culture to OD₆₀₀Value is 0.5~1.0, Bacterium solution is gone in sterile centrifugation tube, ice bath 30min, 5000rpm are centrifuged 5min；With the sterile CaCl of the 20mmoL/L of 1.7mL₂Weight Outstanding thallus, adds 300 microlitres of sterile glycerols, after mixing, is sub-packed in sterile 0.5mL microcentrifugal tube by every 200 μ L of pipe ,- 70 DEG C deposit it is spare.

(6) Agrobacterium LBA4404 mediates sorghum cDNA conversion improvement rice " in spend 11 "：

(g) callus by the yellow grown densification breaks up, and prepares differential medium and places 5 days, then, will be to The callus of differentiation is inoculated on culture medium, is grown 18 days under 28 DEG C of light, and seedling is long to 3cm, is moved it to 1/2MS and is taken root training It supports and takes root on base；

(i) plantation and Phenotypic Observation of the Transgenic Rice system that transgenosis obtains by T0 generation, T1 generation and T2 generation, every part of material 30~50 plants of material plantation, 10 plants of every row, conventional rice Cultivate administration screens excellent rice strain.

(7) positive transgenic system PCR is identified：

It first takes the T2 of 5cm long for rice leaf first, is added in 2mL centrifuge tube, and be cut into 0.5 centimetre greatly with scissors It is small, 100 μ L of 2xCTAB is added, rice leaf is smashed on proof press, adds 2 × CTAB of 500 μ L in 65 DEG C of water-baths Middle water-bath 1h.It is then cooled to room temperature the chloroform for adding 800 μ L:Isoamyl alcohol (24:1) room temperature is carried out after, turning upside down 10 times 12000rpm is centrifuged 15min.500 μ L of supernatant is drawn after centrifugation, is added 500 μ L isopropanols, is put into -20 DEG C of refrigerators after mixing 30min is precipitated, after precipitating, 12000rpm is centrifuged 15min under the conditions of 4 DEG C.It discards supernatant at this time, then with 75% alcohol washes It precipitates, 12000rpm, is centrifuged 15min under the conditions of 4 DEG C.Alcohol is discarded, is dried up on sterile platform, the sterile ddH20 dissolution of 100 μ L is added Precipitate DNA.

According to the kanamycin gene sequence fragment design primer (table 1) on transgene carrier pGBI121S2B, to turning base Because material carries out PCR positive identification, condition is as follows：

PCR system：ddH₂O 6.5 μ L, 10 × buffer 1.0 μ L, TaqMIX 1.5 μ L, template 0.5 μ L, 0.5 μ of primer L；

PCR reaction condition：95 DEG C of 10min, 95 DEG C of 45s, 62.5 DEG C of 45s, 72 DEG C of 1min, 35 circulations, 72 DEG C of 10min.

1 kanamycins of table verifies primer sequence

Primer	Upstream	Downstream
			STR	GATCACTGCCTTGGCTC CTA	GTACTCAGCCTTGGCAATCC

Experimental result is as follows：

Sorghum cDNA library storage capacity is 6.1 × 10⁶CFU/mL, transformation efficiency are 96%, and according to library construction reagent The method that Insert Fragment size is identified in box CloneMinerTM II cDNA Library Construction Kit, passes through The mode of BsrGI digestion identifies the size of the segment in insertion carrier between 1.1kb~3.2kb.

The part yield that the screening of table 2 obtains promotes the phenotype of transgenosis system

As shown in Table 2, according to phenotype Integrated Selection come out have volume increase potential quality portion gene system in, single plant yield and Tiller number dramatically increases, and provides the foundation for the volume increase of kind, breeding time is obviously shortened, and can increase the soil in the unit time Ground planting benefit, plant height are substantially reduced, and provide possibility for the breeding of kind resistant to lodging, resistance starch content has aobvious compared with wild type It writes and improves, resistant starch can reduce the blood glucose value after meal of diabetic, control weight, prevention intestines problem and the work of reducing blood lipid With, and sorghum is high-resistance starch plant, this character change of rice can be attributed to being transferred to for sorghum resistant starch gene And expression.

The plantation for passing through T0, T1, T2 generation as shown in Figure 1, it is still big absolutely for stablizing the positive transgenic system of heredity foreign gene It is most, it is seen that the present invention also has both genetic stability, be that the excellent genes of sorghum are whole while efficiently improvement rice varieties It closes into rice and provides reliable method, the positive colony filtered out can also be used in gene functional research and positioning, be into one The gene function that step understands sorghum provides may.

In conclusion the present invention has, the time is short, high-efficient, rice mutant character is abundant.The rice for occurring changing is planted Strain progress transgenosis verifying analysis, genetic background is clear, screens available excellent genes for subsequent rice and targets improvement, also The function of single or multiple genes in sorghum cDNA library is reversely studied using the mutant character of transgenic paddy rice, it is high for screening Fine strain of millet kind provides convenience.

The above examples only illustrate the technical idea of the present invention, and this does not limit the scope of protection of the present invention, all According to the technical idea provided by the invention, any changes made on the basis of the technical scheme each falls within the scope of the present invention Within；The technology that the present invention is not directed to can be realized by the prior art.

Claims

1. a kind of method of conversion sorghum cDNA library improvement rice varieties, which is characterized in that include following operating procedure：

(1) building of sorghum cDNA library；

(2) sorghum cDNA library sequence is analyzed：By 50 random monoclonal sequencing analysis in the library E.coil sorghum cDNA, will be sequenced Sequence uploads to ncbi database and carries out sorghum gene BLAST analysis, and for example matched gene of information for recording relevant matches logs in Number, percentage, CDS (coding sequence), gene annotation etc., carry out cDNA integrity analysis and ORF prediction；

(3) E.coli sorghum cDNA library plasmid in large scale extracts；

(4) preparation of Agrobacterium competent cell, method are as follows：

Picking Agrobacterium single colonie is inoculated in the YEB fluid nutrient medium of 5mL 100 μ g/mL containing streptomysin, and 28 DEG C, 250rpm training Support 12h；It draws 2mL culture and is transferred to 50mL YEB fluid nutrient medium, continue culture to OD₆₀₀Value is 0.5~1.0, and bacterium solution is turned Into sterile centrifugation tube, ice bath 30min, 5000rpm are centrifuged 5min；With the sterile CaCl of the 20mmoL/L of 1.7mL₂Thallus is resuspended, 300 microlitres of sterile glycerols are added, after mixing, are sub-packed in sterile 0.5mL microcentrifugal tube by every 200 μ L of pipe, -70 DEG C of preservations It deposits spare.

(B) 2mg recombinant plasmid dna is added in the LBA4404 competent cell of 200 μ L, then ice bath 5min is gone in liquid nitrogen 8min is freezed, after incubating 5min in 37 DEG C of ice baths rapidly, 800 μ L antibiotic-free YEB fluid nutrient mediums of addition, 28 DEG C, 250rpm expresses culture 4h~5h in advance, then applies and spreads YEB plate containing kanamycin, streptomysin, 28 DEG C of culture 36h；

(C) clump count grown on plate is counted, picking single bacterium is fallen within containing 50 μ g/mL kanamycins, 100 μ g/mL streptomysins YEB fluid nutrient medium in shake bacterium, 28 DEG C, 250rpm cultivates 12h, 5000rpm, is centrifuged 10min, collects thallus, sterile washing It washs and is resuspended afterwards with 20% glycerine water solution three times, -20 DEG C save backup；

(a) glume clean and bright, current year seed is selected, glume is peelled off, 100mL sterilizing is put on aseptic operating platform Conical flask in, cleaned seed 3 times with the distilled water of sterilizing, then with 75% alcohol disinfecting 2 times, each 1min, then with sterilizing Distillation wash 3 removings alcohol after, with 0.15% mercuric chloride disinfection 15min, during which shake with hands conical flask, discard liter Mercury is cleaned seed 3 times with aqua sterilisa, then eliminates extra moisture, and seed is inoculated into B5 by 10 seeds of every plate and is consolidated On body culture medium, sealed membrane is sealed, and under 28 DEG C of dark conditions, is cultivated 30 days；

(b) yellow embryo callus is inoculated on new subculture medium, 28 DEG C are protected from light culture 25d, select glassy yellow, do Dry compact embryogenic callus is inoculated on precultivation medium, this culture medium is added with 50 μ g/mL acetosyringone of final concentration, and 28 DEG C It is cultivated 4 days under dark condition；

(c) Agrobacterium containing sorghum cDNA the YEB containing 50 μ g/mL kanamycins, 100 μ g/mL streptomysins is coated on to consolidate On body culture medium, 28 DEG C of dark culturings for 24 hours, on aseptic operating platform, are drawn Agrobacterium suspension medium with pipette tips and are gently blown and beaten Then Agrobacterium containing sorghum cDNA draws these solution again and is added in 50mL Agrobacterium suspension medium, is added simultaneously The acetosyringone of 50 μ L, 50mg/mL demarcates OD₆₀₀It is 0.5, is then added and grows 5 days callus on AS, 42 DEG C of items Heat shock 30min under part；

(d) it eliminates bacterium solution as far as possible on aseptic operating platform, callus is spread out and is placed in sterilized have on filter paper plate The 1h that dries then, is transferred into co-culture medium, 24 DEG C until callus surface moisture is dried, the lower training of dark Support 5d；

(e) on aseptic operating platform, it is in 250mL triangular flask, with 2L sterilizing that the callus after co-cultivation, which is put into size, ddH₂O is washed 5 times, is washed 2 times with the aseptic double-distilled water containing 100 μ g/mL streptomysins, and each duration 15min shakes with hands, Then callus is spread out and carries out dry tack free on the plate with aseptic filter paper；

(f) callus of above-mentioned dry tack free is inoculated into the screening containing 50 μ g/mL kanamycins, 100 μ g/mL streptomysins It is screened on culture medium, every plate places callus 15, cultivates 24 days under 28 DEG C of dark conditions, then callus is connect Kind to new containing carrying out programmed screening, 28 DEG C of dark on 50 μ g/mL kanamycins, 100 μ g/mL streptomysin screening and culturing mediums Under the conditions of cultivate 24 days；

(g) callus by the yellow grown densification breaks up, and prepares differential medium and places 4~6 days, then, will be to The callus of differentiation is inoculated on culture medium, is grown 15~20 days under 28 DEG C of light, and seedling is long to 3~5cm, moves it to 1/ It takes root on 2MS root media；

(h) hardening can be carried out to it when transgenic seedling root system is flourishing enough, can adapt to soil-grown environment, put Then plus sterile ddH it is placed in planting environment and grows 3 days,₂Transgenic seedling is directly taken out and is planted from culture medium by O hardening 4d It trains in soil；

(i) excellent water screens by plantation and the Phenotypic Observation in T0 generation, T1 generation and T2 generation in the Transgenic Rice system that transgenosis obtains Rice strain.

2. a kind of method of conversion sorghum cDNA library improvement rice varieties according to claim 1, which is characterized in that the height The building of fine strain of millet cDNA library includes following operating procedure：

(1) sorghum Total RNAs extraction, liquid feeding nitrogen grind the young stem of sorghum in mortar, extract a variety of materials respectively with TRIzoL Total serum IgE, and take a small amount of RNA for agarose gel electrophoresis and measure its OD₂₆₀/OD₂₈₀, OD₂₆₀/OD₂₃₀Value；

(2) one or two chains are synthesized using LD PCR method referring to Creator SMART cDNA Construction Kit specification, And the cDNA product of synthesis is then carried out homogenization processing with DSN double-stranded specific nuclease by electrophoresis detection result, homogenization Sample afterwards carries out PCR amplification, and electrophoresis detection result；

(3) end adds A after the PCR product purification and recovery after uniforming, with PCR clean up Kit recycling plus A product, connection Onto pGBI121S2B carrier, be transformed into E.coli, be coated on the LB plate containing 50 μ g/mL kanamycins carry out culture make PCR amplification rear electrophoresis identification is carried out with 60 single colonies of the M13 universal primer to random picking, estimates to be inserted into according to electrophoresis result The size and small fragment rate of segment, and calculate storage capacity.

3. a kind of method of conversion sorghum cDNA library improvement rice varieties according to claim 1, it is characterised in that：The agriculture Bacillus strain is LBA4404, and E.coli bacterial strain is DH-5 α, and the rice varieties spend 11 in.

4. a kind of method of conversion sorghum cDNA library improvement rice varieties according to claim 1, it is characterised in that：Transgenosis It is T0 generation plantation and greenhouse, bagging selfing, T1~T2 is for group's plantation in outdoor crop field.

5. a kind of method of conversion sorghum cDNA library improvement rice varieties, feature exist in -5 any one according to claim 1 In the E.coli sorghum cDNA library plasmid in large scale method for extracting is as follows：

(A) the E.coli sorghum purpose library bacterium solution of 400 μ L is taken to be connected in the 1L conical flask containing 200mL YEB fluid nutrient medium, Add 200 μ L, 50mg/mL kanamycins, 37 DEG C, 300rpm cultivates 16h；

(C) each centrifuge tube is separately added into 10mLP1, and P1 will ensure that RNase A and LyseBLue is added before using, then will precipitating It mixes, not there is lumpy precipitate；

(D) each centrifuge tube is respectively added the P2 of 10mL37 DEG C of preheating and buckles lid immediately, and movement is soft, turn upside down 10 times it is thorough Bottom mixes bacterium solution, until bacterial suspension becomes indigo plant, 25 DEG C of incubation time 3min of room temperature；

(E) P3 of 10mL pre-cooling should be added in every pipe in time after above-mentioned bacterium solution becomes basket, exist side by side and engrave lower gentle inversion 10 times mixings Bacterium solution, it is seen that blue becomes clear, White Flocculus occurs, then be incubated for 20min on ice；

(G) it is centrifuged again with 4 DEG C, 12000g is centrifuged 15min, equally absorption supernatant；

(H) pillar is balanced with QBT equilibrium liquid, takes a QIAGEN-tip 500, QBT 10mL is added to be made by gravity QBT liquid flows sky naturally；

(I) pillar is added in the supernatant containing plasmid, flows down it naturally through filter membrane, wash 3 times with cleaning solution QC, every time 30mL, the empty mode of stream cleans pillar naturally, then uses 15mL plasmid eluent QF eluted dna；

(J) DNA is precipitated, the isopropanol of 0.7 times of volume of eluent is added into eluent, mixing of turning upside down at once, then 4 DEG C, 12000g is centrifuged 30min, discards supernatant；

(L) precipitating 15min is spontaneously dried, adds 100 μ LTE, PH8.0 dissolution precipitatings, with the concentration of Nanodroping measurement plasmid.

6. one of the according to claim 1 method of conversion sorghum cDNA library improvement rice varieties, which is characterized in that described Sorghum variety is three all sorghums.