CN108795808A - One plant of Batavia bacillus and its application - Google Patents
One plant of Batavia bacillus and its application Download PDFInfo
- Publication number
- CN108795808A CN108795808A CN201810616570.1A CN201810616570A CN108795808A CN 108795808 A CN108795808 A CN 108795808A CN 201810616570 A CN201810616570 A CN 201810616570A CN 108795808 A CN108795808 A CN 108795808A
- Authority
- CN
- China
- Prior art keywords
- lead
- cadmium
- soil
- bacillus
- arsenic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/07—Bacillus
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B09—DISPOSAL OF SOLID WASTE; RECLAMATION OF CONTAMINATED SOIL
- B09C—RECLAMATION OF CONTAMINATED SOIL
- B09C1/00—Reclamation of contaminated soil
- B09C1/10—Reclamation of contaminated soil microbiologically, biologically or by using enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P3/00—Preparation of elements or inorganic compounds except carbon dioxide
Abstract
The invention discloses one plant of Batavia bacillus and its applications.The bacterial strain Batavia bacillus HJ-1 newly screened is the extensive and powerful bacterial strain of one plant of function.It relies on the groups such as hydroxyl, carbonyl, amide groups, the phosphate on cell wall to carry out surface and fixes heavy metal cadmium, lead and arsenic.It can utilize sulphur source to produce hydrogen sulfide, and free sulphion be combined with cadmium and/or lead and/or arsenic, the cadmium sulfide and/or vulcanized lead and/or arsenones of indissoluble be generated, thus available Cd, lead and arsenic content effectively in reduction soil.Therefore, which can be used for preparing the preparation for reducing effective cadmium, lead, arsenic content in soil.It is also electron donor using organic matter, while oxidation of organic compounds, using Fe (III) as only electron acceptor, Fe (III) is set to be reduced to Fe (II), and support growth by obtaining energy in metabolic process, and the bacterial strain shows various heavy certain resistance.Therefore, bacterial strain of the invention has broad application prospects.
Description
Technical field
The invention belongs to the technical fields of microorganism remediation heavy-metal contaminated soil, and in particular to one plant reduces in soil
The microbial strains and its application process of cadmium, lead, arsenic effective content.
Background technology
Soil is the natural resources of preciousness, is the necessary condition of human survival.With Industrial " three Waste ", urban waste,
The use of discharge, the sewage irrigation and chemical fertilizer inferior of motor-vehicle tail-gas, heavy metal pollution of soil are on the rise.
Heavy metal pollution of soil not only makes soil fertility decline, crop yield, quality decline, also results in water pollution,
Most importantly heavy metal pollution of soil can cause accumulation of the heavy metal finally in human body by the effect of food chain, seriously
Influence the health of the mankind.Heavy metal has carcinogenic, teratogenesis, mutagenesis to the mankind.Such as heavy metal cadmium, Long Term Contact
It can lead to hypertension, cause kidney damage, destroy bone calcium, and then lead to osteoporosis and softening.
Remediation of heavy metal-contaminated soil mainly has phytoremediation, Electroremediation method, leaching method, pyrolysis at present
Suction method, Vitrification and fixing-stable method etc., in the above heavy-metal contaminated soil administering method, phytoremediation needs
For quite a long time (decades even centuries) and there are the process problems of plant；Electromotion repairing technique is only applicable to facet
Contamination contaminates, and scene is not easy to operate；Leaching method needs to add surfactant, and there are the danger of polluted underground water；Thermal desorption
Method is the method using heating recovery gas, and this method is not suitable for execute-in-place, and there are costly, and narrow application range etc. is asked
Topic；Vitrification changes the property of soil, is only applicable to seriously polluted and small area situation；Add the stabilisation of lime
Method improves the pH value of soil, can cause soil hardening, and bad to basic soil effect.Therefore be unsuitable for for
Administer the rice field heavy metal pollution of large area.
The microorganism remediation of heavy metal pollution of soil be using the bioactivity of microorganism to the affine absorption of heavy metal or
It is converted into less toxic product, to reduce the pollution level of heavy metal.Heavy metal pollution, state is mitigated or eliminated using microorganism
It is inside and outside there are many report, microorganism cannot degrade and destroy heavy metal, but can be by changing their chemically or physically characteristic
And the migration and conversion of metal in the environment are influenced, and microculture is simple, and corresponding preparation is at low cost, repairs a huge sum of money
It is good to belong to pollution effects, it is rapid-action, timeliness is long, secondary pollution will not be caused.Therefore, microorganism remediation be can yet be regarded as heavy metal soil
The ideal method of improvement.But at this stage, it is also necessary to more, functionally more powerful microbe species are further screened, with
Phase plays effect more outstanding in practical applications.
Invention content
The primary and foremost purpose of the present invention is to provide one plant of Batavia bacillus (Bacillus bataviensis) HJ-
1, deposit number is CGMCC NO.13239.The bacterial strain has prominent significant in terms of reducing soil available lead, cadmium and arsenic
Effect.
The screening of Batavia bacterial strain of bacillus of the present invention and Molecular Identification：
It ploughs in heavy metal pollution and acquires soil sample sample, take back laboratory with sterile paper bag, carry out separation and the sieve of bacterial strain
Choosing.Using gradient dilution method isolated strains, soil sample 10g is weighed, is put into the triangular flask equipped with 90ml sterile waters, is shaken on shaking table
It is 10 to swing 30min to get dilution–1Soil supension.6, the test tube equipped with 4.5ml sterile waters separately is taken, respectively label dilution
Degree is 10–2, 10–3, 10–4, 10–5, 10–6, 10–7.It is 10 from dilution–10.5ml is drawn in soil supension is added to label dilution
Degree is 10–2Teat glass (15 × 150mm), fully shaking mixing to get dilution be 10–2Soil dilution liquid.It presses successively
10 times of method gradient dilutions, it is respectively 10 that can obtain dilution–3, 10–4, 10–5, 10–6, 10–7Soil dilution liquid.10 are drawn respectively–4、
10–5、10–6、10–7Soil dilution liquid 0.1mL, be added in prepared respectively contain 2mmol/L Cd (II), Pb (II), As
(III) on LB solid mediums.Dilution is coated with repeatedly with spreading rod, mixes well, is inverted in incubator after paving
Culture.The picking bacterium single bacterium colony after growing bacterium colony is crossed to obtain pure culture.Microscopy goes to the preservation of 4 DEG C of inclined-plane.
The selection result such as the following table 1.
The preliminary gradient the selection result of 1 bacterium of table
Note：It is too many that " △ " refers to LB plated growth bacterium colonies, joins together, can not count.
The bacterial strain that screening obtains is taken to the bacterium solution for growing to logarithmic phase, thalline were collected by centrifugation, and genome is extracted with kit
DNA.It is 27-F and 1492-R according to the conserved regions design in bacterial 16 S rDNA and synthetic primer,
27-F:GAGAGTTTGATCCTGGCTCAG；
1492-R:AAGGAGGTGATCCARCCGCA。
With this to primer using the genomic DNA extracted as template amplification, obtain PCR product.After running glue detection, by Shanghai
Sheng Gong biotechnologies limited liability company completes sequencing.
By the splicing sequence of acquisition, by existing 16S rDNA sequences in Blast programs and GenBank databases into
Row compares, and has 99% high homology, the bacterial strain with Batavia bacillus (Bacillus bataviensis)
HJ-1 is initially identified as Batavia bacillus (Bacillus bataviensis).
The secondary purpose of the present invention is to provide Batavia bacillus (Bacillus bataviensis) HJ-1 to answer
With.Specifically include the following aspects：
Batavia bacillus HJ-1 of the present invention with heavy metal for being combined.
Further, it is for being combined with cadmium and/or lead and/or arsenic
Further, be for in soil heavy metal cadmium and/or lead and/or arsenic combined.
Batavia bacillus HJ-1 of the present invention be by include on cell wall hydroxyl, carbonyl, amide groups,
Group including phosphate carries out surface and fixes heavy metal.
(extracellular polymeric is such as more for the metabolite that Batavia bacillus HJ-1 of the present invention is generated by it
Sugar, glycoprotein etc.) it carries out fixing soil including extracellular complexing, extracellular precipitation, the mode in extracellular absorption including one or more
Heavy metal in earth.
Batavia bacillus HJ-1 of the present invention produces hydrogen sulfide using sulphur source.Free sulphion and cadmium
And/or lead and/or arsenic combine, and generate the cadmium sulfide and/or vulcanized lead and/or arsenones of indissoluble.
Batavia bacillus HJ-1 of the present invention is used for reduced iron.
Batavia bacillus HJ-1 of the present invention is used to prepare in reduction soil a kind of in effectively cadmium, lead, arsenic
Or the preparation of several contents.
Batavia bacillus HJ-1 of the present invention is used to prepare a kind of or several in cadmium, lead, arsenic in reduction rice
The preparation of kind content.
The present invention bacterial strain can also be prepared into together with other soil passivator with it is stronger drop cadmium, lead, arsenic effect system
Agent.Specific formula is as follows：
The weight percent of each component is：Decomposed agricultural by-products 10wt%~20wt%, calcium magnesium phosphate 10%~
20wt%, mercapto-functionalized 10%~20wt% of attapulgite, mercapto-functionalized montmorillonite 15wt%~20wt%, charcoal
5%~15wt%, heap fermentation filter mud of sugarcane 10wt%~20wt%, turf 5wt%~15wt%, microbial fermentation solution
1.5%~2.5%, the microorganism in the microbial fermentation solution is the Badawi that deposit number is CGMCC NO.13239
Sub- bacillus (Bacillus bataviensis) HJ-1.
Preparing for mentioned microorganism zymotic fluid is as follows：
A, actication of culture
Batavia bacillus is inoculated on solid seed culture medium inclined-plane, training is activated under the conditions of 28~35 DEG C
Support 24~36h；
Solid seed culture medium：Tryptone 10g/L；Yeast extract 5g/L；Sodium chloride 10g/L；Agar 2%；PH is certainly
So；
B, prepared by seed liquor
Batavia bacillus is inoculated in from solid seed culture medium inclined-plane in liquid seed culture medium, 28
24~36h of shake culture under the conditions of~35 DEG C prepares seed liquor；
Liquid seed culture medium：Tryptone 10g/L；Yeast extract 5g/L；Sodium chloride 10g/L；PH is natural；
C, seeding tank ferments
The seed liquor that step b is obtained is inoculated into seed with the inoculum concentration of culture volume percentage 5%-8% to be seeded
Tank；It is passed through filtrated air and stirring, 24~36h is cultivated under the conditions of 28~35 DEG C, 1~2 Vols/volmin of ventilatory capacity is stirred
Mix rotating speed 180-250rpm obtains first class seed pot zymocyte liquid；First class seed pot zymotic fluid is pressed into percent by volume 5%~8%
Inoculum concentration accesses secondary seed tank, is passed through filtrated air and stirring, 24~36h of culture under the conditions of 28~35 DEG C, and ventilatory capacity 1~
2Vols/volmin, speed of agitator 180-250rpm obtain secondary seed tank zymocyte liquid；
1L level-ones or secondary seed tank culture medium prescription：Beef extract 0.3~0.8%, peptone 0.7~1.2%, grape
Sugar 0.1~0.6%, NaCl 0.1~0.6%, MgSO4·7H2O 0.01~0.06%, K2HPO40.01%~0.06%,
MnSO40.001%~0.008%, Yu Weishui, pH value disinfection preceding 7.0~7.8, pH6.8~7.5 after disinfection；The culture medium
The degree of formula components is weight percentage；
D, fermentation tank culture is produced
28 DEG C~35 DEG C, secondary seed tank zymotic fluid is accessed by the inoculum concentration of culture volume percentage 5%~8%
Fermentation tank is passed through filtrated air and stirring, and 24~36h, 1~2Vols/vol of ventilatory capacity are cultivated under the conditions of 28~35 DEG C
Min, speed of agitator 180-250rpm, Batavia bacillus content in microbial fermentation solution after fermentation：1×106~
1×108A viable bacteria/milliliter；
1L fermentation tank culture based formulas：Starch 2%~3%, beancake powder 0.5~1.5%, yeast powder 0.5~1.0%,
KH2PO40.08~0.22%, K2HPO40.10~2.2%, CaCO30.1~2.20%, FeSO4·7H2O 0.001~
0.005%, Yu Weishui, pH value disinfection preceding 8.5~11.0,6.5~9.5 after disinfection；The percentage of the culture medium prescription ingredient
Content is weight percentage.
Decomposed agricultural by-products be will smash it through 2mm sieve agricultural crop straw, cow dung equal proportion mixing be uniformly mixed,
Carbon-nitrogen ratio is adjusted to 20~30, water content is adjusted to 55wt%, ‰ -5wt of 3wt, ‰ organic matter decomposing inoculants is added and (contain high/low temperature
Bacillus and thermophilic fungi etc.), compost is carried out, when heap temperature is more than 50 DEG C, starts turning ventilation, turning is daily 2-3
It is secondary, when temperature is down to 30 DEG C or less, stop turning to get.
The specific preparation process of heap fermentation filter mud of sugarcane is as follows：Filter mud of sugarcane is piled up in fermentation field, spontaneous fermentation
30d-40d, filter mud of sugarcane is degenerated from top to bottom becomes ripe；Decomposed filter mud of sugarcane is spread out, makes its thickness 15cm, in the sun
Shine 1-2d；Broken 80 mesh are carried out using crusher to the filter mud dried to sieve.
It is spare that charcoal, turf cross 3-5mm sieves after crushed；
Mercapto-functionalized attapulgite, the specific preparation process of mercapto-functionalized montmorillonite are as follows：By the half of 0.5mol/L
Cystamine aqueous hydrochloric acid solution and the attapulgite water slurry of mass percent 3% are according to volume ratio 1:5 ratio mixing, and
1.5h is stirred to react in blender；Sample after reaction is centrifuged, and gets rid of upper layer aqueous solution, is retained solid matter, is obtained
For the solid matter arrived after distillation water washing 5 times, it is spare to cross 80-110 mesh sieve for 60 DEG C of drying after grinding.In the same way
To mercapto-functionalized montmorillonite.
Above-mentioned decomposed agricultural by-products (agricultural crop straw, cow dung) component is a kind of good organic fertilizer, organic
Matter content 30wt%~45wt%, the active group having is (such as：Carboxyl, amino and hydroxyl etc.) it is easy to as ligand
With heavy metal element Cd, the complexing such as Pb, As or chelating, the heavy metal being passivated in soil.
Above-mentioned turf component be rich in organic matter (50wt%-80wt%) and humus (20wt%-40wt%), it is nitrogenous,
Phosphorus, potassium total content are in 3wt% or more, and having prodigious inner surface, (porosity is about 95%, and specific surface area is about 200m2/g)
With good colloid surface property, such as adsorption capacity, cohesion and high dispersion, contain a large amount of polar group, including alcohol
Class, aldehydes, carboxylic acid, hydroxyl etc. can be complexed or chelate the heavy metal in soil, meanwhile, Soil ventilation, water penetration can be promoted,
Soil is improved, utilization rate of fertilizer is improved.
Above-mentioned calcium magnesium phosphate main component includes Ca3(PO4)2、CaSiO3、MgSiO3, primary chemical group becomes：MgO
>=12%, SiO2The content of effective calcium, magnesium, silicon in soil can be improved in >=20%, CaO >=25%, improves soil pH value, reduces
Effective cadmium, lead, arsenic content in soil, and then the heavy metal for preventing rice absorbing excessive.
Above-mentioned charcoal is slow through high temperature mainly by residuums such as agriculture and forestry organic waste material, organic wastes in the case of anoxic
Solid matter a kind of indissoluble that pyrolysis generates, stablize, height aromatization, rich in carbon, charcoal has loose more
Structure, the specific surface area in hole are huge, surface carries a large amount of negative electrical charges and higher charge density, and rich in it is a series of it is oxygen-containing,
Nitrogenous, sulfur-bearing functional group has prodigious cation exchange capacity (CEC), is a kind of good sorbing material.
Above-mentioned mercapto-functionalized attapulgite component is the clay pit of zeopan containing Shuifu County of a kind of layer of chain structure
Object, primary chemical group become：(Mg, Al, Fe) O 23.83%, SiO256.96%, Mg-O, Si-O, OH in structure-、
SH- has very strong chemism, and composition variable-charged surface is combined with heavy metal ion, complex reaction occurs, adsorbs soil
In heavy metal.
The molecular formula of above-mentioned mercapto-functionalized montmorillonite is (Al, Mg)2[Si4O10](OH)2·nH2O, centre are alumina
Octahedron, the silicate clay mineral for the three-layer tablet shape structure being made of up and down oxygen-octahedron, contains in crystal structure interlayer
Water and some exchange cations, there is higher ion exchange capacity.Its primary chemical group becomes：SiO266.72%, Al2O3
28.53%, Mg-O, Si-O, OH in structure-, SH- there is very strong chemism, have to the heavy metal in soil very strong
Adsorption capacity.
Above-mentioned heap fermentation filter mud of sugarcane is rich in organic matter (214.6g/kg), and N P and K full dose and Available N-P-K contain
Amount is quite abundant, and pH value is in alkalescent, can obviously increase organic matter, full nitrogen and the content of tatal phosphorus in soil, significantly improve
Available nutrient situation in soil improves soil pH value, reduces effective cadmium, lead, arsenic content, culture fertility in soil.
Above-mentioned microbial fermentation solution component refers to Batavia fermentation of bacillus liquid, and on the one hand the microorganism can be according to
Hydroxyl (- OH), carbonyl (- CO-), amide groups (- CO-NH-), phosphate (- PO4 on cell wall3-) etc. groups carry out surface
It adsorbs and heavy metal cadmium, lead and the arsenic in the modes fixing soils such as extracellular complexing, extracellular precipitation is carried out by its metabolite；
On the other hand, which can utilize the sulphur source in soil to produce a large amount of hydrogen sulfide in growth course, free sulphion with
Cadmium and/or lead in soil and/or arsenic combine, and generate the cadmium sulfide and/or vulcanized lead and/or arsenones of indissoluble, and then effectively
Effective cadmium, lead in reduction soil, arsenic content.Batavia bacillus of the present invention derives from Changsha Ningxiang County cadmium pollution
Paddy soil, Gram-positive, amphimicrobian is rod-shaped, produces gemma, through 16S rDNA Molecular Identifications and systematic growth point
Analysis is initially identified as Batavia bacillus.In the soil, the bacterial strain colonization ability is strong, can be efficiently in fixing soil
Heavy metal reduces the absorption of plant.Batavia bacillus (Bacillus bataviensis) HJ-1 was in 2016
November 4 was preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center (abbreviation CGMCC, address：Beijing
The institute 3 of city Chaoyang District North Star West Road 1, Institute of Microorganism, Academia Sinica), deposit number is CGMCC NO.13239.
Above-mentioned reduction cadmium, lead, arsenic preparation can be widely applied to light moderate cadmium, lead, arsenic pollution rice field, heavy metal can be made
Soil activation state cadmium, lead, the arsenic in pollution rice field decline 52.2-53.3%, 51.0-58.1% and 45.0-48.8% respectively, essence
Meter Ge, lead, arsenic content decline 54.2-55.5%, 53.3-55.0% and 47.8-50.0% respectively, meanwhile, also make soil pH value
0.7-1.13 is improved, which, which has both, repairs acidified soil, culture fertility and improve the multiple functions such as soil physico-chemical characteristic, has
There is huge application value.
The bacterial strain Batavia bacillus HJ-1 that the present invention newly screens is the extensive and powerful bacterial strain of one plant of function.It
By hydroxyl (- OH), carbonyl (- CO-), amide groups (- CO-NH-), the phosphate (- PO4 on cell wall3-) etc. groups carry out table
Heavy metal cadmium, lead, arsenic are fixed in face.It can utilize sulphur source to produce hydrogen sulfide, free sulphion and cadmium and/or lead and/or arsenic knot
Close, generate the cadmium sulfide and/or vulcanized lead and/or arsenones of indissoluble, to effectively reduce the available Cd in soil, lead and
Arsenic content.Therefore, which can be used for preparing the preparation for reducing effective cadmium, lead, arsenic content in soil.It is also using having
Machine object is electron donor, using Fe (III) as only electron acceptor, makes Fe (III) be reduced to while oxidation of organic compounds
Fe (II), and support growth by obtaining energy in metabolic process, and the bacterial strain shows certain resist to various heavy
Property.Therefore, bacterial strain of the invention has broad application prospects.
Description of the drawings
The discoloration experiment of Fig. 1 bacterial strain HJ-1 hydrogen sulfide；
A left side is the discoloration experiment of HJ-1 Lead acetate papers；The right side is not other bacillus controls.
Culture experiments of Fig. 2 bacterial strains HJ-1 in cadmium solution；
CK：Bacterium control is not connect；12-48h：Respectively HJ-1 connect bacterium 12h, for 24 hours with after 48h,
It is shown in figure, the bacterial strain is in the solution containing cadmium ion, culture 12h, for 24 hours and 48h, the generation of CdS in solution
Situation, CdS are orange to dark-brown crystal.
Fourier infrared (FT-IR) spectrum analysis of Fig. 3 bacterial strains HJ-1；
Wavelength is 3414cm-1Band show that the bacterial strain contains group-NH and-OH, wavelength 1649,1545,1454,
1237 and 1056cm-1Band show that the bacterial strain contains-NH torsion groups or carbonyl group.- NH is contained on the surface of the bacterial strain ,-
The groups such as OH and C-O.
The iron reducing power experimental result of Fig. 4 .HJ-1 bacterial strains；
CK1：Fe (III) does not connect bacterium control；CK：Fe (II) does not connect bacterium control；HJ-1：Connect Fe (III) reduction of bacterium HJ-1
For the experiment of Fe (II).
The heavy metal resistance of Fig. 5 bacterial strains HJ-1 is tested.
Specific implementation mode
Invention is further described in detail with reference to embodiments, without forming limitation of the present invention.
Embodiment 1
Hydrogen sulfide of the present invention generates experiment (Lead acetate paper confirmatory experiment).
1. Batavia bacillus (Bacillus bataviensis) HJ-1 production hydrogen sulfide tentatively judges
Activated strains HJ-1, the case where hydrogen sulfide can be produced by Lead acetate paper preliminary screening in LB culture mediums.
As a result：It using the tight sealing triangular bottle of ground, accesses after bacterial strain, first seals shaking table culture to bacterial strain slightly with sealed membrane
Then micro- growth is aseptically changed to ground sieve, and fixed suspension Lead acetate paper, continues to cultivate.The result shows that
After being incubated overnight, Lead acetate paper blackening, it is shown that the bacterial strain can generate hydrogen sulfide, generate black vulcanized lead.As a result see figure
1。
2. cultivating the generation experiment of CdS after bacterial strain HJ-1 in cadmium solution.
By cultures of the bacterial strain HJ-1 in cadmium solution, CK：Bacterium control is not connect；12-48h：Respectively HJ-1 connect bacterium 12h,
It for 24 hours with after 48h, is shown in figure, the bacterial strain is in the solution containing cadmium ion, culture 12h, for 24 hours and 48h, CdS in solution
Production, CdS are orange to dark-brown crystal.It can be seen that the bacterial strain can generate hydrogen sulfide, CdS is generated.
Embodiment 2
Fourier infrared (FT-IR) spectrum analysis of bacterial strain HJ-1.
After HJ-1 strain culturings, freeze-drying, and carry out Fourier infrared spectrum analysis (FT-IR).See Fig. 3.
The result shows that wavelength 3414cm-1Band show that the bacterial strain contains group-NH and-OH, wavelength 1649,
1545,1454,1237 and 1056cm-1Band show that the bacterial strain contains-NH torsion groups or carbonyl group.The table of the bacterial strain
Contain the groups such as-NH ,-OH and C-O in face.
Embodiment 3
Add cadmium (II), lead (II), arsenic (III) mother liquor respectively in the triangular flask equipped with aseptic culture medium, make cadmium (II),
Lead (II), arsenic (III) final concentration respectively reach 100mg/L, aseptically, be inoculated with and bar reached respectively with 2% inoculum concentration
Dimension sub- bacillus HJ-1, control CK do not connect bacterium.After inoculation in 30 DEG C concussion (180rpm) cultivate 48h, later 6000rpm from
Heart 10min, respectively measure supernatant in cadmium (II), lead (II), arsenic (III) content.It the results are shown in Table 2.
2. bacterial strain HJ-1 of table is in culture solution to the adsorption effect of cadmium (II), lead (II), arsenic (III)
Embodiment 4
The iron reducing power of HJ-1 bacterial strains is tested
Alienation Fe (III) reduction is one of Biochemical processes important in anaerobism and amphimicrobian rice soil, the bacterial strain
, using Fe (III) as only electron acceptor, make Fe while oxidation of organic compounds using organic matter for electron donor
(III) it is reduced to Fe (II), and growth is supported by obtaining energy in metabolic process.As a result see Fig. 4.
CH3COO-+8Fe(III)+4H2O→2HCO3 -+8Fe(II)+9H+
Embodiment 5
The heavy metal resistance of bacterial strain HJ-1 is tested, and as a result sees Fig. 5.
Minimum inhibitory concentrations of the bacterial strain HJ-1 to contents of many kinds of heavy metal ion is shown in figure；Illustrate the bacterial strain to a variety of heavy
Metal shows certain resistance.
Embodiment 6
The passivation cadmium of bacterial strain HJ-1, the effect of lead, arsenic.
Sterile turf and microbial fermentation solution are uniformly mixed with 5: 1 ratio, as microbial bacterial agent product.Before site preparation
The microbial bacterial agent product is uniformly spread fertilizer over the fields by 100kg/ mus of full fields, is ploughed, can be planted after ploughing rake site preparation.Individually
Using the microbial bacterial agent product, the reduced rate of meter Ge, rice lead and rice arsenic are respectively 36%, 33% and 38%.
Embodiment 7
The present invention reduce cadmium, lead, arsenic content microbial inoculum according to：Decomposed agricultural by-products (agricultural crop straw, cow dung)
10wt%~20wt%, calcium magnesium phosphate 10%~20wt%, mercapto-functionalized 10%~20wt% of attapulgite, sulfydryl function
Change montmorillonite 15wt%~20wt%, 5%~15wt% of charcoal, heap fermentation filter mud of sugarcane 10wt%~20wt%, turf
5wt%~15wt%, microbial fermentation solution 1.5%~2.5% are mixed with.
But embodiment is preferred：Include decomposed agricultural by-products (agricultural crop straw, cow dung) 15%, calcium magnesium phosphate
15%, mercapto-functionalized attapulgite 15%, mercapto-functionalized montmorillonite 18%, charcoal 10%, heap fermentation filter mud of sugarcane
15%, turf 10wt%, microbial fermentation solution 2%.
It is spare that drying agricultural by-products (agricultural crop straw, cow dung) cross 2mm sieves after crushed；Charcoal, turf are through crushing
It is spare that 3-5mm sieves are crossed afterwards；Mercapto-functionalized attapulgite, mercapto-functionalized montmorillonite cross 80-110 after Mechanical Crushing, fine grinding
Mesh sieve is spare；Heap fermentation filter mud of sugarcane smashes it through 80 mesh sieve through drying.
Preparation method：
A. it is spare to cross 2mm sieves after crushed for drying agricultural crop straw and cow dung；
B. by the agricultural crop straw after crushing, cow dung by weight 1:1 ratio is uniformly mixed, and adjusts carbon-nitrogen ratio to 20
~30, water content is adjusted to 55wt%, and ‰ -5wt of 3wt ‰ organic matter decomposing inoculant (bacillus containing high/low temperature and high temperature is added
Fungi etc., such as " Xiang Run nations " board organic matter decomposing inoculant), compost is carried out, when heap temperature is more than 50 DEG C, starts turning ventilation, turns over
Heap is daily 2-3 times, when temperature is down to 30 DEG C or less, stops turning, obtains decomposed agricultural by-products (crops straw
Stalk, cow dung) component；
C. it is spare to cross 3-5mm sieve sterilizings after crushed for charcoal, turf；
Mercapto-functionalized attapulgite, the specific preparation process of mercapto-functionalized montmorillonite are as follows：By the half of 0.5mol/L
Cystamine aqueous hydrochloric acid solution and the attapulgite water slurry of mass percent 3% are according to volume ratio 1:5 ratio mixing, and
1.5h is stirred to react in blender；Sample after reaction is centrifuged, and gets rid of upper layer aqueous solution, is retained solid matter, is obtained
For the solid matter arrived after distillation water washing 5 times, it is spare to cross 80-110 mesh sieve for 60 DEG C of drying after grinding.In the same way
To mercapto-functionalized montmorillonite.
D. filter mud of sugarcane heap fermentation process：
A, filter mud of sugarcane is piled up in fermentation field, spontaneous fermentation 30d-40d, filter mud of sugarcane is degenerated from top to bottom becomes ripe；
B, decomposed filter mud of sugarcane is spread out, makes its thickness 15cm or so, shines 1-2d in the sun；
C, the filter mud dried is carried out using crusher being crushed 80 mesh sieve.
E. microbial fermentation inoculum；
A, actication of culture
Batavia bacillus HJ-1 is inoculated on solid seed culture medium inclined-plane, it is living under the conditions of 28~35 DEG C
Change 24~36h of culture；
Solid seed culture medium：Tryptone 10g/L；Yeast extract 5g/L；Sodium chloride 10g/L；Agar 2%；PH is certainly
So；
B, prepared by seed liquor
Batavia bacillus is inoculated in from solid seed culture medium inclined-plane in liquid seed culture medium, 28
24~36h of shake culture under the conditions of~35 DEG C prepares seed liquor；
Liquid seed culture medium：Tryptone 10g/L；Yeast extract 5g/L；Sodium chloride 10g/L；PH is natural；
C, seeding tank ferments
The seed liquor that step b is obtained is inoculated into seed with the inoculum concentration of culture volume percentage 5%-8% to be seeded
Tank；It is passed through filtrated air and stirring, 24~36h is cultivated under the conditions of 28~35 DEG C, 1~2 Vols/volmin of ventilatory capacity is stirred
Mix rotating speed 180-250rpm obtains first class seed pot zymocyte liquid；First class seed pot zymotic fluid is pressed into percent by volume 5%~8%
Inoculum concentration accesses secondary seed tank, is passed through filtrated air and stirring, and 24~36h, ventilatory capacity 1 are cultivated under the conditions of 28~35 DEG C
~2Vols/volmin, speed of agitator 180-250rpm obtain secondary seed tank zymocyte liquid；
1L level-ones or secondary seed tank culture medium prescription：Beef extract 0.3~0.8%, peptone 0.7~1.2%, grape
Sugar 0.1~0.6%, NaCl 0.1~0.6%, MgSO4·7H2O 0.01~0.06%, K2HPO40.01%~0.06%,
MnSO40.001%~0.008%, Yu Weishui, pH value disinfection preceding 7.0~7.8, pH6.8~7.5 after disinfection；The culture medium
The degree of formula components is weight percentage；
D, fermentation tank culture is produced
28 DEG C~35 DEG C, secondary seed tank zymotic fluid is accessed by the inoculum concentration of culture volume percentage 5%~8%
Fermentation tank is passed through filtrated air and stirring, and 24~36h, 1~2Vols/vol of ventilatory capacity are cultivated under the conditions of 28~35 DEG C
Min, speed of agitator 180-250rpm, Batavia bacillus in microbial fermentation solution after fermentation：1×106~1 ×
108A viable bacteria/milliliter；
1L fermentation tank culture based formulas：Starch 2%~3%, beancake powder 0.5~1.5%, yeast powder 0.5~1.0%,
KH2PO40.08~0.22%, K2HPO40.10~2.2%, CaCO30.1~2.20%, FeSO4·7H2O 0.001~
0.005%, Yu Weishui, pH value disinfection preceding 8.5~11.0,6.5~9.5 after disinfection；The percentage of the culture medium prescription ingredient
Content is weight percentage.
Fermentation finishes the function bacterium bacterium solution after putting tank, and sterile turf and function bacterium bacterium solution are with 5:1 ratio is uniformly mixed,
As microbial bacterial agent product.
F. step A, B, C, D, E raw material prepared are mixed in proportion, microbial inoculum product as of the present invention.
Product content of organic matter 30-40% of the embodiment of the present invention reduces heavy metal-polluted soil active ingredient SiO2+MgO+CaO
Content 28.7% can be widely applied to contaminated by heavy metals soil.
Crop field manure trial：
(1) experimental design：
2015 in the towns Ningxiang County Hui Longpu (soil belongs to cadmium pollution type) and (the soil category cadmium dirt of Yiyang City Heshan District
Dye type) two places have carried out field trial.Two places are " the reduction water that present invention applicant-microbe research institute of Hunan Province establishes
Rice Cd uptake comprehensive regulation show-how base ".
1. test process
Experimental plot is divided into 5 processing, and any passivator CK1 is not applied in setting；It is pressed per acre using 100kg organic passivation agent
According to the parts by weight mixing of 15 parts of 15 parts of decomposed agricultural by-products, 10 parts of charcoal, 10 parts of turf and heap fermentation filter mud of sugarcane
(CK2)；100.0kg inorganic passivants are applied per acre to cover according to 15 parts of calcium magnesium phosphate, 15 parts of sulfhydrylation attapulgite and sulfhydrylation
The parts by weight mixing (CK3) of de- 18 parts of stone；Decomposed agricultural by-products+calcium magnesium phosphate+the sulfhydrylation for applying 100.0kg per acre is recessed
Convex stick stone+heap fermentation filter mud of sugarcane+charcoal+sulfhydrylation montmorillonite+turf, wherein 15 parts of decomposed agricultural by-products, calcium and magnesium
15 parts of phosphate fertilizer, 15 parts of sulfhydrylation attapulgite, 18 parts of sulfhydrylation montmorillonite, 10 parts of charcoal, 10 parts of turf, heap fermentation is sweet
The parts by weight (CK4) that 15 parts of sugarcane filter mud；The product of the present invention (SP) for applying 100.0kg per acre each handles 3 repetitions, altogether
The plot area of 15 cells, rice cultivation is 30.0m2(5m × 6m), with the thick plastic film wrapped ridge (buried depth of 0.2m wide
0.4m) separate.Field management, top dressing and the prevention and control of plant diseases, pest control：It is carried out by local farmers plantation usual manner.
2. No. 39 crop varieties of morning Xian in the unified selection in various regions.
3. method of administration
Amount of application is rationally adjusted according to Soil nutritional condition and pollution situation, and uniformly spread fertilizer over the fields (also can be with base in full field before site preparation
Fertilizer is spread fertilizer over the fields after mixing), it can be planted after ploughing rake site preparation.
4. detection project
Cadmium content in soil pH value, effective cadmium content of soil, polished rice；Lead content in the effective lead content of soil, polished rice；
Arsenic content in soil available arsenic content, polished rice.
5. main result
The result shows that (being shown in Table 3-6) can make the soil in heavy metal pollution rice field live after this product to rice maturation
Condition cadmium, lead and arsenic decline 52.2-53.3%, 51.0-58.1% and 45.0-48.8%, polished rice cadmium, lead and arsenic content respectively
Decline 54.2-55.5%, 53.3-55.0% and 47.8-50.0% respectively, meanwhile, so that soil pH value is improved 0.70-1.13.
The drop cadmium effect and contrast test that 3 product of table is applied on rice
The drop lead effect and contrast test that 4 product of table is applied on rice
The drop arsenic effect and contrast test that 5 product of table is applied on rice
6 product of table increases the effect of soil pH value
Sequence table
<110>Microbe research institute of Hunan Province
<120>One plant of Batavia bacillus and its application
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213>Unknown (Unknown)
<400> 1
gagagtttga tcctggctca g 21
<210> 2
<211> 20
<212> DNA
<213>Unknown (Unknown)
<400> 2
aaggaggtga tccarccgca 20
Claims (10)
1. one plant of Batavia bacillus (Bacillus bataviensis) HJ-1, deposit number CGMCC
NO.13239。
2. Batavia bacillus HJ-1 described in claim 1 with heavy metal for being combined.
3. Batavia bacillus HJ-1 described in claim 1 with cadmium and/or lead and/or arsenic for being combined.
4. Batavia bacillus HJ-1 described in claim 1 is used for and the heavy metal cadmium and/or lead and/or arsenic in soil
In conjunction with.
5. it includes hydroxyl, carbonyl, amide groups, phosphorus that Batavia bacillus HJ-1 described in claim 1, which is relied on cell wall,
Group including acidic group carries out surface and fixes heavy metal.
6. Batavia bacillus HJ-1 described in claim 1 carries out including extracellular network by the metabolite of its generation
The heavy metal in mode fixing soil in conjunction, extracellular precipitation, extracellular absorption including one or more.
7. Batavia bacillus HJ-1 described in claim 1 produces hydrogen sulfide using sulphur source.
8. Batavia bacillus HJ-1 described in claim 1 is used for reduced iron.
9. Batavia bacillus HJ-1 described in claim 1 is used to prepare in reduction soil a kind of in effectively cadmium, lead, arsenic
Or the preparation of several contents.
10. Batavia bacillus HJ-1 described in claim 1 be used to prepare reduce it is a kind of in cadmium, lead, arsenic in rice or
The preparation of several contents.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810616570.1A CN108795808B (en) | 2018-06-15 | 2018-06-15 | Bacillus badavirus and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810616570.1A CN108795808B (en) | 2018-06-15 | 2018-06-15 | Bacillus badavirus and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108795808A true CN108795808A (en) | 2018-11-13 |
| CN108795808B CN108795808B (en) | 2020-05-05 |
Family
ID=64086307
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810616570.1A Active CN108795808B (en) | 2018-06-15 | 2018-06-15 | Bacillus badavirus and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108795808B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111235076A (en) * | 2020-03-31 | 2020-06-05 | 山东碧蓝生物科技有限公司 | Bacillus anethoides, microbial inoculum thereof and application thereof in heavy metal remediation field |
| CN111826311A (en) * | 2020-07-10 | 2020-10-27 | 华南农业大学 | Bacillus badensis BY08 and application thereof |
| CN112496020A (en) * | 2020-10-30 | 2021-03-16 | 煜环环境科技有限公司 | Restoration method for reducing effective state of heavy metal in farmland soil |
| CN113186244A (en) * | 2021-04-12 | 2021-07-30 | 河南农业大学 | Hydrogen production method by photosynthetic organisms in acidic environment |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20130097347A (en) * | 2012-02-24 | 2013-09-03 | 부경대학교 산학협력단 | Mixed microorganisms having degradation activity of alginate and laminarin |
| CN104195070A (en) * | 2014-08-06 | 2014-12-10 | 湖南省微生物研究院 | Strain and microbial agent capable of reducing content of cadmium as well as preparation and application methods of strain and microbial agent |
| CN104193546A (en) * | 2014-08-06 | 2014-12-10 | 湖南省微生物研究院 | Composite soil passivator for reducing contents of cadmium and lead as well as preparation method and application method of composite soil passivator |
-
2018
- 2018-06-15 CN CN201810616570.1A patent/CN108795808B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20130097347A (en) * | 2012-02-24 | 2013-09-03 | 부경대학교 산학협력단 | Mixed microorganisms having degradation activity of alginate and laminarin |
| CN104195070A (en) * | 2014-08-06 | 2014-12-10 | 湖南省微生物研究院 | Strain and microbial agent capable of reducing content of cadmium as well as preparation and application methods of strain and microbial agent |
| CN104193546A (en) * | 2014-08-06 | 2014-12-10 | 湖南省微生物研究院 | Composite soil passivator for reducing contents of cadmium and lead as well as preparation method and application method of composite soil passivator |
Non-Patent Citations (1)
| Title |
|---|
| SAIRA ABBAS等: "A heavy metal tolerant novel bacterium, Bacillus malikii sp. nov., isolated from tannery effluent wastewater", 《ANTONIE VAN LEEUWENHOEK》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111235076A (en) * | 2020-03-31 | 2020-06-05 | 山东碧蓝生物科技有限公司 | Bacillus anethoides, microbial inoculum thereof and application thereof in heavy metal remediation field |
| CN111826311A (en) * | 2020-07-10 | 2020-10-27 | 华南农业大学 | Bacillus badensis BY08 and application thereof |
| CN112496020A (en) * | 2020-10-30 | 2021-03-16 | 煜环环境科技有限公司 | Restoration method for reducing effective state of heavy metal in farmland soil |
| CN113186244A (en) * | 2021-04-12 | 2021-07-30 | 河南农业大学 | Hydrogen production method by photosynthetic organisms in acidic environment |
| CN113186244B (en) * | 2021-04-12 | 2023-05-09 | 河南农业大学 | Hydrogen production method by photosynthetic organisms in acidic environment |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108795808B (en) | 2020-05-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104193546B (en) | A kind ofly reduce cadmium, the composite soil passivator of lead content and preparation and application thereof | |
| CN105838644B (en) | Complex micro organism fungicide and bacterial manure and preparation method thereof and the application in reparation salt affected soil | |
| CN106905980B (en) | Heavy metal soil remediation agent, preparation method and application thereof in sludge digestion | |
| CN103964946B (en) | A kind of paddy rice Special compound microbial fertilizer and preparation method thereof | |
| WO2021196735A1 (en) | Bacillus tianshenli, bacterial agent thereof and use thereof in field of remediation of heavy metal | |
| CN108821908A (en) | A kind of microbial inoculum comprising Batavia bacillus HJ-1 and its application | |
| CN103789223B (en) | Acinetobacter calcoaceticus with free living nitrogen fixation and phosphorus and potassium dissolving capability and application of acinetobacter calcoaceticus | |
| CN106867945A (en) | The microorganism passivator and its preparation, purposes of a kind of repairing heavy metal in soil pollution | |
| CN108795808A (en) | One plant of Batavia bacillus and its application | |
| CN109365495A (en) | The method of charcoal carrier surface activating agent coupling antimicrobial plant remedying oil-polluted soils | |
| CN105255794A (en) | Pseudomonas frederiksbergensis sp. NT-2 and application thereof | |
| CN104450552A (en) | Sulfate reducing bacteria-phosphate solubilizing bacteria and application thereof in combined remediation of cadmium contaminated soil | |
| CN109652329A (en) | A kind of preparation and application of bacillus solid microbial | |
| CN102747002B (en) | Agrobacteriumsp. having free-living nitrogen fixing ability, and applications thereof | |
| CN105695354A (en) | Process and application for treating municipal sewage sludge by means of ultrahigh-temperature aerobic composting fermentation | |
| CN109821889B (en) | Soil diversified remediation method using composite material nano-microspheres | |
| CN111423996A (en) | Complex microbial inoculant, preparation method thereof and application thereof in soil remediation field | |
| CN103789224A (en) | Agrobacterium with free living nitrogen fixation, phosphate dissolution and potassium dissolution capacity and application of agrobacterium | |
| CN106520604B (en) | One plant of nitrogen-fixing bacteria for producing acc deaminase and its application in soil ecology reparation | |
| CN110668876A (en) | Composite mycorrhiza biological fertilizer and preparation method and application thereof | |
| CN106434496A (en) | Brevibacterium halotolerans and application thereof in ecological restoration of soils | |
| CN102634465B (en) | Acinetobacter with authigenic nitrogen fixation capacity and application thereof | |
| CN109336716A (en) | Carbon-based biological compound organic fertilizer of one kind and preparation method thereof | |
| CN108893421B (en) | Bacillus fusiformis and application thereof in reclamation ecological reconstruction of mining area | |
| CN109679870A (en) | A kind of biological organic fertilizer and preparation method thereof with water conservation drought resisting function |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |