CN108753996A - A kind of cell detection of mycoplasma primer, kit and detection method - Google Patents

A kind of cell detection of mycoplasma primer, kit and detection method Download PDF

Info

Publication number
CN108753996A
CN108753996A CN201810431199.1A CN201810431199A CN108753996A CN 108753996 A CN108753996 A CN 108753996A CN 201810431199 A CN201810431199 A CN 201810431199A CN 108753996 A CN108753996 A CN 108753996A
Authority
CN
China
Prior art keywords
pcr
primer
mycoplasma
cell
kit
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201810431199.1A
Other languages
Chinese (zh)
Inventor
王强
任美佳
师忠港
鞠小丽
夏恒传
刘晓勇
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangsu University
Original Assignee
Jiangsu University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangsu University filed Critical Jiangsu University
Priority to CN201810431199.1A priority Critical patent/CN108753996A/en
Publication of CN108753996A publication Critical patent/CN108753996A/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to biotechnologies, and in particular to a kind of cell detection of mycoplasma primer, kit and detection method;Heretofore described kit includes the required two pairs of primers combination of PCR amplification, primer combination can be with the 16S genes in each mycoplasma species of specific amplification and about 250bp sequences between 23S genes, two pairs of primer amplifications ensure that the accuracy of testing result simultaneously, further include the required advance reaction mixture of PCR amplification in kit, mixture includes Taq enzyme, dNTP and buffer solution etc.;It whether there is mycoplasma contamination in the difference cell that kit in the present invention can be rapidly and efficiently, testing result is accurate, while can be detected in batches.

Description

A kind of cell detection of mycoplasma primer, kit and detection method
Technical field
The invention belongs to biotechnologies, and in particular to a kind of cell detection of mycoplasma primer, kit and detection side Method.
Background technology
Mycoplasma is a kind of size between bacterium and virus(0.1 - 0.6μm)There is no the micro- life of prokaryotic cell type of cell wall Object.Since mycoplasma size is very small, about 1% mycoplasma can lead to the filtering mycoderm in the conventional 0.2 μm of aperture in laboratory, together When mycoplasma can easily be bred in synthetic medium culture, mycoplasma contamination has become a kind of main pollution in cell culture Source.Most mycoplasmas it is insensitive to general antibiotic thus be difficult kill mycoplasma, and the cell after slight pollution no matter It visually observes or observation cell state is unchanged under simple microscope.Therefore easily ignore mycoplasma contamination problem. Existing report shows that the ratio of countries in the world cell line mycoplasma contamination is up to 30-60%.It can change after mycoplasma contamination cell All functions of cell:Such as intracellular DNA, RNA and protein expression level so that the authenticity and reliability of experimental result are all Changed.Many magazine submissions require that the cell of culture will carry out detection of mycoplasma at present.
The main method of current detecting cell mycoplasma contamination has:1. DNA fluorescence colours;2. isolated culture;3. core Acid hybridization method;4. scanning electron microscope detection method.But these types of detection method all exists, and detection precision is inaccurate, detection process is multiple The shortcomings of miscellaneous, time-consuming somewhat expensive simultaneously.
With the development of molecular biology technology, efficiently detection method detects the most convenient developed at present for PCR.It should Method is mainly highly conserved between different mycoplasmas according to the rRNA gene orders of mycoplasma, and 16S genes and 23S genes it Between have the difference of sequence and length between different subspecies.By in this block design sleeve type PCR primer amplification, utilizing agar Sugared gel electrophoresis is detected.This method has many advantages, such as that high sensitivity, detection time are short and testing cost is cheap.At present PCR amplification, but these sides are mainly carried out by mycoplasma rRNA sequence preservative synthetic primers through some disclosed PCR detection methods Method requires height to experimental situation, and experimental cost is costly, main to be also easy to phenomena such as false positive occur, and the branch of detection is former Body kind is limited.
Invention content
It is specific next the purpose of the present invention is to provide a kind of primer, kit and the detection method of quick detection cell mycoplasma Say the whole constituents for being included the present invention relates to PCR amplification mycoplasma and detailed step.
The present invention provides the primers of quick detection cell mycoplasma, which is according to different mycoplasma rRNA gene sequences Row conservative design (NCBI databases https://www.ncbi.nlm.nih.gov/refseq/), including external primers and interior Portion's primer.
Wherein, the forward primer sequence of external primers is:ACACCATGGGAGCTGGTAAT (MICO S1, SEQ.ID.NO.1);The reverse primer sequences of external primers are:CTTCWTCGACTTYCAGACCCAAGGCAT (MICO A1, SEQ.ID.NO.2);Wherein W and Y is degenerate primer, and W and Y are any type base in A, T, G or C.
Wherein, the forward primer sequence of internal primer is:GTTCTTTGAAACTGAAT (MICO S2, SEQ.ID.NO.3), the reverse primer sequences of internal primer are:GCATCCACCAWAWACTCT (MICO A2, SEQ.ID.NO.4);Wherein W is degenerate primer, any type base in W A, T, G or C.
The present invention also provides a kind of kit of quick detection cell mycoplasma, the kit includes above-mentioned quick detection The primer of cell mycoplasma, wherein each primer concentration is 200pmol/ μ L.
Specifically process for preparation is:After the MICO S1 of the 1 μ L and TE of 1 μ LMICO A1 and 48 μ L are mixed, it is named as primer One, it is expanded for the PCR first round;After the TE of the MICO S2 of 1 μ L and 1 μ L MICO A2 and 48 μ L are mixed, it is named as primer Two, for the wheel amplifications of PCR second, -20 DEG C of long-term preservations can be placed in after primer packing number.Primer one is used for specific amplified 16S Sequence between gene and 23S genes, amplified production about 100-250bp;Primer two is used to carry out enrichment optimization to amplified production to expand Increasing has detected whether mycoplasma contamination.
Kit of the present invention further includes the pre-reaction liquid needed for PCR amplification, which includes PCR amplification institute The all material needed, such as Taq enzyme(Quick Taq enzyme), dNTP and buffer solution etc., be mixed in a certain ratio packing.The pre-reaction Liquid is to be pre-mixed with packing is postponed, and assembly is put into kit for ease of use.
Heretofore described kit further includes positive control and negative control template, and positive control is to contain mycoplasma The DNA purified fragments of the intervals 16s and 23s conserved sequence;Negative control is the sterile water without any pollution.
Heretofore described kit also includes the required lysate of lytic cell, and the cell of culture is collected after centrifugation Sample is can be obtained for PCR amplification except this lysate is added in supernatant.
The present invention also provides a kind of cell detection of mycoplasma method, the method is completed based on the detection kit, tool Physical examination survey side
Method includes the following steps:
(1)The collection of cell DNA:
The cell of culture draws the cell conditioned medium of culture when cell density reaches 70-90% density, and the cell of culture is used The PBS of 5-10 mL precoolings is washed 2-3 times.In the PBS that cell piping and druming is suspended in 1mL after washing, 12000 rpm/ points Supernatant is abandoned after Zhongli's heart 1min;Cell conditioned medium after centrifugation is suspended in the cell pyrolysis liquid of 100 μ L in 1.5mL centrifuge tubes, The suspension after washing is heated 10 minutes at 98 DEG C then, and is collected after being centrifuged 1 minute at 12000 rpm/ minutes Clearly.
(2)PCR detects mycoplasma:
Primer is prepared first:After the TE of MICO S1 of 1 μ L, the MICO A1 of 1 μ L and 48 μ L are mixed, it is named as and draws
Object one is expanded for the PCR first round;After the TE of MICO S2 of 1 μ L, 1 μ L MICO A2 and 48 μ L are mixed, it is named as Primer two can be placed in -20 DEG C of long-term preservations for the wheel amplifications of PCR second after primer packing number.
Prepare PCR pre-reaction liquid:PCR pre-reaction liquid prepare in advance after can it is long-term -20 DEG C preservation, each PCR pre-reactions Liquid configuration process is:10 × PCR buffer, 2 μ L, 5 × dNTP mixtures 1 μ L, 0.1 μ L of Taq enzyme, 14.9 μ L of sterile water are closed Count 18 μ L.Prepare above-mentioned PCR pre-reactions liquid according to the required quantity of each reaction, can also prepare 100 secondary amounts in advance at -20 DEG C It preserves, uses preceding dissolving every time.
Prepare first time pcr amplification reaction liquid:Take 18 μ L of above-mentioned ready PCR pre-reactions liquid that the 1 above-mentioned primers of μ L are added One (the final concentration of 4 pmol/ μ L of primer), adds 1 μ L above-mentioned steps(1)The cell pyrolysis liquid of middle preparation is sufficiently mixed above-mentioned 2000rpm/min is centrifuged 1 minute after mixture.
First time PCR reacts:Said mixture is put into PCR and reacts instrument, PCR reaction conditions are set;It takes after reaction Go out sample and is placed in 4 DEG C of preservations.
Prepare second of pcr amplification reaction liquid:Take the 18 μ L of PCR pre-reactions liquid of above-mentioned preparation that the above-mentioned primers of 1 μ L two are added (the final concentration of 4 pmol/ μ L of primer).The reaction solution being eventually adding after the above-mentioned first time PCR reactions of 1 μ L, is sufficiently mixed above-mentioned mixed 2000rpm/min is centrifuged 1 minute after closing object.
Second of PCR reaction:Above-mentioned second of pcr amplification reaction liquid is put into PCR and reacts instrument, PCR reaction conditions are set; Sample is taken out after reaction is placed in 4 DEG C of preservations;The Ago-Gel of preparation 2% is detected product.
Wherein twice PCR amplification condition is 94 DEG C and reacts 10 seconds;It is subsequent 94 DEG C react 30 seconds, 55 DEG C react 30 seconds, 72 ℃
Reaction 30 seconds, reaction cycle are 30 cycles.
Compared with prior art, advantage of the invention is that:
The present invention is pre- in kit with compared with existing open detection detection of mycoplasma method, greatly optimizing detecting step The whole components needed for PCR reactions have first been loaded in mixture, operator's operation is facilitated.Two pairs of primers are used in the present invention to expand The accuracy of amplification can be ensured by increasing, and prevented nonspecific amplification, ensured the accuracy of testing result;It is designing simultaneously The design method of degenerate primer is used when external primers, which can be propped up with the major part polluted in amplifying cells Substance.PCR amplification program is simple, and two-step pcr amplification program is consistent, facilitates amplification procedure, it is ensured that in all experiments Efficient amplification detects in room.Carrying out PCR amplification uses two-wheeled PCR amplification, 50 minutes each reaction time to take twice less than two Hour.
This kit can detect most mycoplasma contamination by using the design of degenerate primer.Simultaneously using examination The form design of agent box, greatly simplifies step and amplification procedure, prevents unnecessary pollution and mistake.
Description of the drawings
Fig. 1 is that kit of the present invention detects the agarose gel electrophoresis of different cell lines, wherein 1-6 be respectively 293T, MGS, HepG2, HT29 cell, positive control and negative control.
Specific implementation mode
To make those skilled in the art be better understood from technical scheme of the present invention, illustrated with reference to specific embodiments and the drawings PCR provided by the invention detects mycoplasma process.
Embodiment 1:
Equipment needed for experiment:PCR amplification instrument(Each company, with hot lid function);Gel-electrophoretic apparatus and power supply;Gel imaging System.
(1)The collection of cell DNA:
The various cells of culture(293T, MGS, HepG2 and HT29, cell are bought in Chinese Academy of Sciences's American Type Culture Collection Committee's cell bank, and preserved in this laboratory)When cell density reaches 70-90%, cell is collected.Detailed process is:Carefully Born of the same parents are cultivated in the Tissue Culture Dish of 6-10cm to after specified 70-90% density, draw the cell conditioned medium of culture.By the thin of culture Born of the same parents are washed 2-3 times with the 5-10 mL PBS being pre-chilled.In the PBS that cell piping and druming is suspended in 1mL after washing.12000 Supernatant is abandoned after rpm/ minutes centrifugation 1min.By the cell conditioned medium after centrifugation with the cell pyrolysis liquid of 100 μ L be suspended in 1.5mL from In heart pipe, then the suspension after washing is heated 10 minutes at 98 DEG C, and after being centrifuged 1 minute at 12000 rpm/ minutes Collect supernatant.
(2)PCR detects mycoplasma flow:
Kit provides two pairs of required two pairs of primers of the most of mycoplasma of amplification in the present invention, which is according to difference Zhi Yuan
Body rRNA gene orders conservative design (NCBI databases https://www.ncbi.nlm.nih.gov/refseq/), Including external primers and internal primer.
Wherein, the forward primer sequence of external primers is:ACACCATGGGAGCTGGTAAT(MICO S1);External primers
Reverse primer sequences be:CTTCWTCGACTTYCAGACCCAAGGCAT (MICO A1);Wherein W and Y is to annex to draw Object, W and Y are any type base in A, T, G or C.
Wherein, the forward primer sequence of internal primer is:GTTCTTTGAAACTGAAT (MICO S2), internal primer Instead
It is to primer sequence:GCATCCACCAWAWACTCT (MICO A2);Wherein W is degenerate primer, is appointed in W A, T, G or C What a kind of base).
Wherein, each primer concentration is 200pmol/ μ L.
Specifically process for preparation is:After the MICO S1 of the 1 μ L and TE of 1 μ LMICO A1 and 48 μ L are mixed, it is named as and draws
Object one is expanded for the PCR first round;After the TE of the MICO S2 of 1 μ L and 1 μ L MICO A2 and 48 μ L are mixed, it is named as Primer two can be placed in -20 DEG C of long-term preservations for the wheel amplifications of PCR second after primer packing number.
Prepare PCR pre-reaction liquid:PCR pre-reaction liquid can long-term -20 DEG C of preservations after preparing in advance.Each PCR pre-reactions Liquid configuration process is:10 × PCR buffer, 2 μ L, 5 × dNTP mixtures 1 μ L, 0.1 μ L of Taq enzyme, 14.9 μ L of sterile water are closed Count 18 μ L.Prepare above-mentioned PCR pre-reactions liquid according to the required quantity of each reaction, can also prepare 100 secondary amounts in advance at -20 DEG C It preserves, uses preceding dissolving every time.
Prepare first time pcr amplification reaction liquid:By taking a sample as an example:Take above-mentioned ready 18 μ L of PCR pre-reactions liquid The above-mentioned primers one (the final concentration of 4 pmol/ μ L of primer) of 1 μ L are added.It is eventually adding 1 μ L above-mentioned steps(1)The cell of middle preparation DNA, end reaction liquid are 20 μ L, and 2000rpm/min is centrifuged 1 minute after being sufficiently mixed said mixture.
First time PCR reacts:Said mixture is put into PCR and reacts instrument, PCR reaction conditions are set, reaction condition is:94 DEG C reaction 10 seconds;Subsequent 94 DEG C are reacted 30 seconds, and 55 DEG C are reacted 30 seconds, and 72 DEG C are reacted 30 seconds, and reaction cycle is 30 cycles;Reaction After take out sample be placed in 4 DEG C of preservations.
Prepare second of pcr amplification reaction liquid:Take the 18 μ L of PCR pre-reactions liquid of above-mentioned preparation that the above-mentioned primers of 1 μ L two are added (the final concentration of 4 pmol/ μ L of primer).The reaction solution being eventually adding after the above-mentioned first time PCR reactions of 1 μ L, end reaction liquid product For 20 μ L, 2000rpm/min is centrifuged 1 minute after being sufficiently mixed said mixture.
Second of PCR reaction:Above-mentioned second of pcr amplification reaction liquid is put into PCR and reacts instrument, PCR reaction conditions are set, Reaction condition is:94 DEG C are reacted 10 seconds;Subsequent 94 DEG C are reacted 30 seconds, and 55 DEG C are reacted 30 seconds, and 72 DEG C are reacted 30 seconds, and reaction cycle is 30 cycles;Sample is taken out after reaction is placed in 4 DEG C of preservations.
Prepare 2% Ago-Gel:Heating is molten after the TAE. dissolvings fully of 20mL are added in the agarose that process for preparation is 2g Solution boiling is poured into gel slot and is cooled to room temperature after being subsequently cooled to the 0.5 μ L of EB of 60 DEG C or so addition 5mg/mL.
By the PCR reaction solution after reaction be added 2 μ L 10 × DNA sample-loading buffers, gently centrifuged after mixing.By 20 μ L Mixture into row agarose gel electrophoresis, electrophoretic voltage condition is:120V constant pressures, 2 hours.
Gel is carried out to shooting imaging on gel imaging system, testing result shows mycoplasma contamination after electrophoresis Cell in gel electrophoresis it is observed that size 100-250bp band, and the cell of uncontaminated mycoplasma gel electricity It can't detect any band in swimming.As shown in Figure 1, the agarose gel electrophoresis of different cell lines is detected for kit of the present invention, Wherein 1-6 is respectively 293T, MGS, HepG2, HT29 cell, positive control (NCBI accession number:MG996782.1, PCR amplification After be enriched with, primer size is in 250bp or so) and negative control (ultra-pure water).PCR results show that swimming lane 2-4 is detected greatly respectively Small 100-250bp or so segment illustrates that swimming lane 2-4 corresponding cell line MGS, HepG2 and HT29 detect mycoplasma contamination, and Band is not detected in 1 corresponding 293T cells of swimming lane, illustrates that mycoplasma contamination does not occur for the cell.
Sequence table
<110>Jiangsu University
<120>A kind of cell detection of mycoplasma primer, kit and detection method
<160> 4
<170> SIPOSequenceListing 1.0
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
acaccatggg agctggtaat 20
<210> 2
<211> 27
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
cttcwtcgac ttycagaccc aaggcat 27
<210> 3
<211> 17
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
gttctttgaa actgaat 17
<210> 4
<211> 18
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
gcatccacca wawactct 18

Claims (10)

1. a kind of primer of detection cell mycoplasma, which is characterized in that the primer includes external primers and internal primer, In, the forward primer sequence of the external primers is:ACACCATGGGAGCTGGTAAT(MICO S1);The external primers Reverse primer sequences are:CTTCWTCGACTTYCAGACCCAAGGCAT (MICO A1);Wherein M and Y is degenerate primer, W and Y For any type base in A, T, G or C;
Wherein, the forward primer sequence of the internal primer is:GTTCTTTGAAACTGAAT (MICO S2), the inside is drawn The reverse primer sequences of object are:GCATCCACCAWAWACTCT (MICO A2);Wherein W is degenerate primer, in W A, T, G or C Any type base.
2. a kind of kit of detection cell mycoplasma, which is characterized in that the kit includes detection described in claim 1 The primer of cell mycoplasma, wherein the primer concentration is 200pmol/ μ L.
3. a kind of kit of detection cell mycoplasma according to claim 2, which is characterized in that the primer is specifically matched Process processed is:The TE of MICO S1 of 1 μ L, 1 μ L MICO A1 and 48 μ L are mixed, primer one is named as, is used for the PCR first round Amplification;The TE of MICO S2 of 1 μ L, 1 μ L MICO A2 and 48 μ L are mixed, primer two is named as, is expanded for the wheels of PCR second, It can be placed in -20 DEG C of long-term preservations after primer packing number.
4. a kind of kit of detection cell mycoplasma according to claim 2, which is characterized in that the kit is also wrapped Include the pre-reaction liquid needed for PCR amplification, which includes all material needed for PCR amplification, including Taq enzyme, dNTP and Buffer solution is mixed in a certain ratio packing.
5. a kind of kit of detection cell mycoplasma according to claim 2, which is characterized in that the kit is also wrapped Positive control and negative control are included, the positive control is that the DNA containing the intervals mycoplasma 16s and 23s conserved sequence purifies piece Section;The negative control is the sterile water without any pollution.
6. a kind of kit of detection cell mycoplasma according to claim 2, which is characterized in that the kit is also wrapped Containing the required lysate of lytic cell.
7. a kind of cell detection of mycoplasma method, which is characterized in that the method is complete based on the kit described in claim 2 At specific detection method includes the following steps:
(1)Collect cell DNA;
(2)PCR detects mycoplasma:
Prepare PCR pre-reaction liquid:Including 10 × PCR buffer, 5 × dNTP mixtures, Taq enzyme, sterile water;
Prepare first time pcr amplification reaction liquid:It takes PCR pre-reaction liquid that primer one is added, adds step(1)The cell of middle preparation DNA is centrifuged after being sufficiently mixed said mixture;
First time PCR reacts:Said mixture is put into PCR and reacts instrument, PCR reaction conditions are set;Sample is taken out after reaction Product preserve;
Prepare second of pcr amplification reaction liquid:Take PCR pre-reaction liquid that primer two is added, after adding the reaction of first time PCR Reaction solution centrifuges after being sufficiently mixed said mixture;
Second of PCR reaction:Above-mentioned second of pcr amplification reaction liquid is put into PCR and reacts instrument, PCR reaction conditions are set;Reaction After take out sample;
As a result it detects:Ago-Gel is prepared to be detected product.
8. a kind of cell detection of mycoplasma method according to claim 7, which is characterized in that the PCR pre-reactions liquid packet 10 × PCR buffer, 2 μ L, 5 × dNTP mixtures 1 μ L, 0.1 μ L of Taq enzyme, 14.9 μ L of sterile water are included, 18 μ L are added up to.
9. a kind of cell detection of mycoplasma method according to claim 7, which is characterized in that the first time PCR amplification Reaction solution includes 18 μ L PCR pre-reactions liquid, 1 μ L primers one and 1 μ L steps(1)The cell DNA of middle preparation;Second of PCR Amplification reaction solution includes the reaction solution after 18 μ L PCR pre-reactions liquid, 1 μ L primers two and the reaction of 1 μ L first times PCR.
10. a kind of cell detection of mycoplasma method according to claim 7, which is characterized in that the first time PCR reactions Amplification condition with second of PCR reactions is 94 DEG C and reacts 10 seconds;Subsequent 94 DEG C are reacted 30 seconds, and 55 DEG C are reacted 30 seconds, 72 DEG C Reaction 30 seconds, reaction cycle are 30 cycles.
CN201810431199.1A 2018-05-08 2018-05-08 A kind of cell detection of mycoplasma primer, kit and detection method Pending CN108753996A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810431199.1A CN108753996A (en) 2018-05-08 2018-05-08 A kind of cell detection of mycoplasma primer, kit and detection method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810431199.1A CN108753996A (en) 2018-05-08 2018-05-08 A kind of cell detection of mycoplasma primer, kit and detection method

Publications (1)

Publication Number Publication Date
CN108753996A true CN108753996A (en) 2018-11-06

Family

ID=64010390

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810431199.1A Pending CN108753996A (en) 2018-05-08 2018-05-08 A kind of cell detection of mycoplasma primer, kit and detection method

Country Status (1)

Country Link
CN (1) CN108753996A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109251963A (en) * 2018-11-12 2019-01-22 复旦大学 The method and kit of mycoplasma contamination in Constant Temperature Detection cell culture fluid

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101724693A (en) * 2009-12-24 2010-06-09 上海吉盛制药技术有限公司 Primer pair for detecting nested PCR mycoplasmas, detection kit and use method thereof
CN103627781A (en) * 2012-08-24 2014-03-12 华北制药集团新药研究开发有限责任公司 Kit and method for detecting mycoplasma pollution in CHO cultured cells
CN106244697A (en) * 2016-08-19 2016-12-21 上海逍鹏生物科技有限公司 The detection primer sets of mycoplasma, test kit and the method for detection mycoplasma contamination

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101724693A (en) * 2009-12-24 2010-06-09 上海吉盛制药技术有限公司 Primer pair for detecting nested PCR mycoplasmas, detection kit and use method thereof
CN103627781A (en) * 2012-08-24 2014-03-12 华北制药集团新药研究开发有限责任公司 Kit and method for detecting mycoplasma pollution in CHO cultured cells
CN106244697A (en) * 2016-08-19 2016-12-21 上海逍鹏生物科技有限公司 The detection primer sets of mycoplasma, test kit and the method for detection mycoplasma contamination

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109251963A (en) * 2018-11-12 2019-01-22 复旦大学 The method and kit of mycoplasma contamination in Constant Temperature Detection cell culture fluid
CN109251963B (en) * 2018-11-12 2022-11-18 复旦大学 Method and kit for detecting mycoplasma pollution in cell culture solution at constant temperature

Similar Documents

Publication Publication Date Title
CN105349530B (en) A kind of nucleic acid detection method and detection pipe
Xiao et al. Effects of diverse materials-based methods on DNA extraction for Clostridium difficle from stool samples
CN105420379A (en) Real-time fluorescence quantification PCR detecting kit for cow mycoplasma and special primers and TaqMan probe thereof
CN101712973B (en) Reactive reagent of nucleic acid amplification by chain replacement at room temperature and nucleic acid amplification method at room temperature thereof
CN109680084A (en) A kind of primed probe and method for the compound group of Fluorescence quantitative PCR detection mycobacterium tuberculosis
Gou et al. The colorimetric isothermal multiple-self-matching-initiated amplification using cresol red for rapid and sensitive detection of porcine circovirus 3
CN109337995B (en) PCR detection method and kit for eubacterium terrae and subspecies thereof
Lei et al. LAMP coupled CRISPR-Cas12a module for rapid, sensitive and visual detection of Porcine Circovirus 2
CN113999921B (en) Method and kit for rapidly and visually detecting shigella flexneri
Phetsuksiri et al. The performance of an in-house loop-mediated isothermal amplification for the rapid detection of Mycobacterium tuberculosis in sputum samples in comparison with Xpert MTB/RIF, microscopy and culture
CN108753996A (en) A kind of cell detection of mycoplasma primer, kit and detection method
CN106636474B (en) Six kinds of viral primer sets of Multiple immunizations fluoroscopic examination mouse, kit and method
WO2015180484A1 (en) Nucleotides specific to providencia o31, o41, o42, o43 and o50 and uses thereof
CN113373247A (en) Method for rapidly and simultaneously detecting Escherichia coli O157: H7 and Salmonella typhimurium in food
CN106967826A (en) A kind of people&#39;s umbilical cord, placenta protection liquid detection of mycoplasma primer pair, kit and its detection method
CN102154270B (en) Cronobacter sakazakii O antigen specific nucleotides and use thereof
Yano et al. DNA extraction for short tandem repeat typing from mixed samples using anti-human leukocyte CD45 and ABO blood group antibodies
CN110735003A (en) Universal primer, kit and detection method for detecting fungal contamination in cell product
Kamusoko et al. Purification and Amplification of DNA from cellulolytic Bacteria: Application for Biogas production from crop residues
CN103937666B (en) Concretion mycobacterium nucleic acid quick detection kit and detection method
AU2019100071A4 (en) Pcr detection kit for rapidly identifying salmonella of specific serotypes
CN111621578A (en) RU 61-00441 gene-based Salmonella spelt constant-temperature detection kit and method
CN107287315B (en) Detection kit for Shigella, detection method and application
CN106167836B (en) Multi-fluorescence analysis method and kit a kind of while that detect 4 plants of rat parvovirus
CN104388567A (en) Rapid detection method for Listeria monocytogene virulence gene inlB

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20181106

RJ01 Rejection of invention patent application after publication