CN108753996A - A kind of cell detection of mycoplasma primer, kit and detection method - Google Patents
A kind of cell detection of mycoplasma primer, kit and detection method Download PDFInfo
- Publication number
- CN108753996A CN108753996A CN201810431199.1A CN201810431199A CN108753996A CN 108753996 A CN108753996 A CN 108753996A CN 201810431199 A CN201810431199 A CN 201810431199A CN 108753996 A CN108753996 A CN 108753996A
- Authority
- CN
- China
- Prior art keywords
- pcr
- primer
- mycoplasma
- cell
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to biotechnologies, and in particular to a kind of cell detection of mycoplasma primer, kit and detection method;Heretofore described kit includes the required two pairs of primers combination of PCR amplification, primer combination can be with the 16S genes in each mycoplasma species of specific amplification and about 250bp sequences between 23S genes, two pairs of primer amplifications ensure that the accuracy of testing result simultaneously, further include the required advance reaction mixture of PCR amplification in kit, mixture includes Taq enzyme, dNTP and buffer solution etc.;It whether there is mycoplasma contamination in the difference cell that kit in the present invention can be rapidly and efficiently, testing result is accurate, while can be detected in batches.
Description
Technical field
The invention belongs to biotechnologies, and in particular to a kind of cell detection of mycoplasma primer, kit and detection side
Method.
Background technology
Mycoplasma is a kind of size between bacterium and virus(0.1 - 0.6μm)There is no the micro- life of prokaryotic cell type of cell wall
Object.Since mycoplasma size is very small, about 1% mycoplasma can lead to the filtering mycoderm in the conventional 0.2 μm of aperture in laboratory, together
When mycoplasma can easily be bred in synthetic medium culture, mycoplasma contamination has become a kind of main pollution in cell culture
Source.Most mycoplasmas it is insensitive to general antibiotic thus be difficult kill mycoplasma, and the cell after slight pollution no matter
It visually observes or observation cell state is unchanged under simple microscope.Therefore easily ignore mycoplasma contamination problem.
Existing report shows that the ratio of countries in the world cell line mycoplasma contamination is up to 30-60%.It can change after mycoplasma contamination cell
All functions of cell:Such as intracellular DNA, RNA and protein expression level so that the authenticity and reliability of experimental result are all
Changed.Many magazine submissions require that the cell of culture will carry out detection of mycoplasma at present.
The main method of current detecting cell mycoplasma contamination has:1. DNA fluorescence colours;2. isolated culture;3. core
Acid hybridization method;4. scanning electron microscope detection method.But these types of detection method all exists, and detection precision is inaccurate, detection process is multiple
The shortcomings of miscellaneous, time-consuming somewhat expensive simultaneously.
With the development of molecular biology technology, efficiently detection method detects the most convenient developed at present for PCR.It should
Method is mainly highly conserved between different mycoplasmas according to the rRNA gene orders of mycoplasma, and 16S genes and 23S genes it
Between have the difference of sequence and length between different subspecies.By in this block design sleeve type PCR primer amplification, utilizing agar
Sugared gel electrophoresis is detected.This method has many advantages, such as that high sensitivity, detection time are short and testing cost is cheap.At present
PCR amplification, but these sides are mainly carried out by mycoplasma rRNA sequence preservative synthetic primers through some disclosed PCR detection methods
Method requires height to experimental situation, and experimental cost is costly, main to be also easy to phenomena such as false positive occur, and the branch of detection is former
Body kind is limited.
Invention content
It is specific next the purpose of the present invention is to provide a kind of primer, kit and the detection method of quick detection cell mycoplasma
Say the whole constituents for being included the present invention relates to PCR amplification mycoplasma and detailed step.
The present invention provides the primers of quick detection cell mycoplasma, which is according to different mycoplasma rRNA gene sequences
Row conservative design (NCBI databases https://www.ncbi.nlm.nih.gov/refseq/), including external primers and interior
Portion's primer.
Wherein, the forward primer sequence of external primers is:ACACCATGGGAGCTGGTAAT (MICO S1,
SEQ.ID.NO.1);The reverse primer sequences of external primers are:CTTCWTCGACTTYCAGACCCAAGGCAT (MICO A1,
SEQ.ID.NO.2);Wherein W and Y is degenerate primer, and W and Y are any type base in A, T, G or C.
Wherein, the forward primer sequence of internal primer is:GTTCTTTGAAACTGAAT (MICO S2,
SEQ.ID.NO.3), the reverse primer sequences of internal primer are:GCATCCACCAWAWACTCT (MICO A2,
SEQ.ID.NO.4);Wherein W is degenerate primer, any type base in W A, T, G or C.
The present invention also provides a kind of kit of quick detection cell mycoplasma, the kit includes above-mentioned quick detection
The primer of cell mycoplasma, wherein each primer concentration is 200pmol/ μ L.
Specifically process for preparation is:After the MICO S1 of the 1 μ L and TE of 1 μ LMICO A1 and 48 μ L are mixed, it is named as primer
One, it is expanded for the PCR first round;After the TE of the MICO S2 of 1 μ L and 1 μ L MICO A2 and 48 μ L are mixed, it is named as primer
Two, for the wheel amplifications of PCR second, -20 DEG C of long-term preservations can be placed in after primer packing number.Primer one is used for specific amplified 16S
Sequence between gene and 23S genes, amplified production about 100-250bp;Primer two is used to carry out enrichment optimization to amplified production to expand
Increasing has detected whether mycoplasma contamination.
Kit of the present invention further includes the pre-reaction liquid needed for PCR amplification, which includes PCR amplification institute
The all material needed, such as Taq enzyme(Quick Taq enzyme), dNTP and buffer solution etc., be mixed in a certain ratio packing.The pre-reaction
Liquid is to be pre-mixed with packing is postponed, and assembly is put into kit for ease of use.
Heretofore described kit further includes positive control and negative control template, and positive control is to contain mycoplasma
The DNA purified fragments of the intervals 16s and 23s conserved sequence;Negative control is the sterile water without any pollution.
Heretofore described kit also includes the required lysate of lytic cell, and the cell of culture is collected after centrifugation
Sample is can be obtained for PCR amplification except this lysate is added in supernatant.
The present invention also provides a kind of cell detection of mycoplasma method, the method is completed based on the detection kit, tool
Physical examination survey side
Method includes the following steps:
(1)The collection of cell DNA:
The cell of culture draws the cell conditioned medium of culture when cell density reaches 70-90% density, and the cell of culture is used
The PBS of 5-10 mL precoolings is washed 2-3 times.In the PBS that cell piping and druming is suspended in 1mL after washing, 12000 rpm/ points
Supernatant is abandoned after Zhongli's heart 1min;Cell conditioned medium after centrifugation is suspended in the cell pyrolysis liquid of 100 μ L in 1.5mL centrifuge tubes,
The suspension after washing is heated 10 minutes at 98 DEG C then, and is collected after being centrifuged 1 minute at 12000 rpm/ minutes
Clearly.
(2)PCR detects mycoplasma:
Primer is prepared first:After the TE of MICO S1 of 1 μ L, the MICO A1 of 1 μ L and 48 μ L are mixed, it is named as and draws
Object one is expanded for the PCR first round;After the TE of MICO S2 of 1 μ L, 1 μ L MICO A2 and 48 μ L are mixed, it is named as
Primer two can be placed in -20 DEG C of long-term preservations for the wheel amplifications of PCR second after primer packing number.
Prepare PCR pre-reaction liquid:PCR pre-reaction liquid prepare in advance after can it is long-term -20 DEG C preservation, each PCR pre-reactions
Liquid configuration process is:10 × PCR buffer, 2 μ L, 5 × dNTP mixtures 1 μ L, 0.1 μ L of Taq enzyme, 14.9 μ L of sterile water are closed
Count 18 μ L.Prepare above-mentioned PCR pre-reactions liquid according to the required quantity of each reaction, can also prepare 100 secondary amounts in advance at -20 DEG C
It preserves, uses preceding dissolving every time.
Prepare first time pcr amplification reaction liquid:Take 18 μ L of above-mentioned ready PCR pre-reactions liquid that the 1 above-mentioned primers of μ L are added
One (the final concentration of 4 pmol/ μ L of primer), adds 1 μ L above-mentioned steps(1)The cell pyrolysis liquid of middle preparation is sufficiently mixed above-mentioned
2000rpm/min is centrifuged 1 minute after mixture.
First time PCR reacts:Said mixture is put into PCR and reacts instrument, PCR reaction conditions are set;It takes after reaction
Go out sample and is placed in 4 DEG C of preservations.
Prepare second of pcr amplification reaction liquid:Take the 18 μ L of PCR pre-reactions liquid of above-mentioned preparation that the above-mentioned primers of 1 μ L two are added
(the final concentration of 4 pmol/ μ L of primer).The reaction solution being eventually adding after the above-mentioned first time PCR reactions of 1 μ L, is sufficiently mixed above-mentioned mixed
2000rpm/min is centrifuged 1 minute after closing object.
Second of PCR reaction:Above-mentioned second of pcr amplification reaction liquid is put into PCR and reacts instrument, PCR reaction conditions are set;
Sample is taken out after reaction is placed in 4 DEG C of preservations;The Ago-Gel of preparation 2% is detected product.
Wherein twice PCR amplification condition is 94 DEG C and reacts 10 seconds;It is subsequent 94 DEG C react 30 seconds, 55 DEG C react 30 seconds, 72
℃
Reaction 30 seconds, reaction cycle are 30 cycles.
Compared with prior art, advantage of the invention is that:
The present invention is pre- in kit with compared with existing open detection detection of mycoplasma method, greatly optimizing detecting step
The whole components needed for PCR reactions have first been loaded in mixture, operator's operation is facilitated.Two pairs of primers are used in the present invention to expand
The accuracy of amplification can be ensured by increasing, and prevented nonspecific amplification, ensured the accuracy of testing result;It is designing simultaneously
The design method of degenerate primer is used when external primers, which can be propped up with the major part polluted in amplifying cells
Substance.PCR amplification program is simple, and two-step pcr amplification program is consistent, facilitates amplification procedure, it is ensured that in all experiments
Efficient amplification detects in room.Carrying out PCR amplification uses two-wheeled PCR amplification, 50 minutes each reaction time to take twice less than two
Hour.
This kit can detect most mycoplasma contamination by using the design of degenerate primer.Simultaneously using examination
The form design of agent box, greatly simplifies step and amplification procedure, prevents unnecessary pollution and mistake.
Description of the drawings
Fig. 1 is that kit of the present invention detects the agarose gel electrophoresis of different cell lines, wherein 1-6 be respectively 293T, MGS,
HepG2, HT29 cell, positive control and negative control.
Specific implementation mode
To make those skilled in the art be better understood from technical scheme of the present invention, illustrated with reference to specific embodiments and the drawings
PCR provided by the invention detects mycoplasma process.
Embodiment 1:
Equipment needed for experiment:PCR amplification instrument(Each company, with hot lid function);Gel-electrophoretic apparatus and power supply;Gel imaging
System.
(1)The collection of cell DNA:
The various cells of culture(293T, MGS, HepG2 and HT29, cell are bought in Chinese Academy of Sciences's American Type Culture Collection
Committee's cell bank, and preserved in this laboratory)When cell density reaches 70-90%, cell is collected.Detailed process is:Carefully
Born of the same parents are cultivated in the Tissue Culture Dish of 6-10cm to after specified 70-90% density, draw the cell conditioned medium of culture.By the thin of culture
Born of the same parents are washed 2-3 times with the 5-10 mL PBS being pre-chilled.In the PBS that cell piping and druming is suspended in 1mL after washing.12000
Supernatant is abandoned after rpm/ minutes centrifugation 1min.By the cell conditioned medium after centrifugation with the cell pyrolysis liquid of 100 μ L be suspended in 1.5mL from
In heart pipe, then the suspension after washing is heated 10 minutes at 98 DEG C, and after being centrifuged 1 minute at 12000 rpm/ minutes
Collect supernatant.
(2)PCR detects mycoplasma flow:
Kit provides two pairs of required two pairs of primers of the most of mycoplasma of amplification in the present invention, which is according to difference
Zhi Yuan
Body rRNA gene orders conservative design (NCBI databases https://www.ncbi.nlm.nih.gov/refseq/),
Including external primers and internal primer.
Wherein, the forward primer sequence of external primers is:ACACCATGGGAGCTGGTAAT(MICO S1);External primers
Reverse primer sequences be:CTTCWTCGACTTYCAGACCCAAGGCAT (MICO A1);Wherein W and Y is to annex to draw
Object, W and Y are any type base in A, T, G or C.
Wherein, the forward primer sequence of internal primer is:GTTCTTTGAAACTGAAT (MICO S2), internal primer
Instead
It is to primer sequence:GCATCCACCAWAWACTCT (MICO A2);Wherein W is degenerate primer, is appointed in W A, T, G or C
What a kind of base).
Wherein, each primer concentration is 200pmol/ μ L.
Specifically process for preparation is:After the MICO S1 of the 1 μ L and TE of 1 μ LMICO A1 and 48 μ L are mixed, it is named as and draws
Object one is expanded for the PCR first round;After the TE of the MICO S2 of 1 μ L and 1 μ L MICO A2 and 48 μ L are mixed, it is named as
Primer two can be placed in -20 DEG C of long-term preservations for the wheel amplifications of PCR second after primer packing number.
Prepare PCR pre-reaction liquid:PCR pre-reaction liquid can long-term -20 DEG C of preservations after preparing in advance.Each PCR pre-reactions
Liquid configuration process is:10 × PCR buffer, 2 μ L, 5 × dNTP mixtures 1 μ L, 0.1 μ L of Taq enzyme, 14.9 μ L of sterile water are closed
Count 18 μ L.Prepare above-mentioned PCR pre-reactions liquid according to the required quantity of each reaction, can also prepare 100 secondary amounts in advance at -20 DEG C
It preserves, uses preceding dissolving every time.
Prepare first time pcr amplification reaction liquid:By taking a sample as an example:Take above-mentioned ready 18 μ L of PCR pre-reactions liquid
The above-mentioned primers one (the final concentration of 4 pmol/ μ L of primer) of 1 μ L are added.It is eventually adding 1 μ L above-mentioned steps(1)The cell of middle preparation
DNA, end reaction liquid are 20 μ L, and 2000rpm/min is centrifuged 1 minute after being sufficiently mixed said mixture.
First time PCR reacts:Said mixture is put into PCR and reacts instrument, PCR reaction conditions are set, reaction condition is:94
DEG C reaction 10 seconds;Subsequent 94 DEG C are reacted 30 seconds, and 55 DEG C are reacted 30 seconds, and 72 DEG C are reacted 30 seconds, and reaction cycle is 30 cycles;Reaction
After take out sample be placed in 4 DEG C of preservations.
Prepare second of pcr amplification reaction liquid:Take the 18 μ L of PCR pre-reactions liquid of above-mentioned preparation that the above-mentioned primers of 1 μ L two are added
(the final concentration of 4 pmol/ μ L of primer).The reaction solution being eventually adding after the above-mentioned first time PCR reactions of 1 μ L, end reaction liquid product
For 20 μ L, 2000rpm/min is centrifuged 1 minute after being sufficiently mixed said mixture.
Second of PCR reaction:Above-mentioned second of pcr amplification reaction liquid is put into PCR and reacts instrument, PCR reaction conditions are set,
Reaction condition is:94 DEG C are reacted 10 seconds;Subsequent 94 DEG C are reacted 30 seconds, and 55 DEG C are reacted 30 seconds, and 72 DEG C are reacted 30 seconds, and reaction cycle is
30 cycles;Sample is taken out after reaction is placed in 4 DEG C of preservations.
Prepare 2% Ago-Gel:Heating is molten after the TAE. dissolvings fully of 20mL are added in the agarose that process for preparation is 2g
Solution boiling is poured into gel slot and is cooled to room temperature after being subsequently cooled to the 0.5 μ L of EB of 60 DEG C or so addition 5mg/mL.
By the PCR reaction solution after reaction be added 2 μ L 10 × DNA sample-loading buffers, gently centrifuged after mixing.By 20 μ L
Mixture into row agarose gel electrophoresis, electrophoretic voltage condition is:120V constant pressures, 2 hours.
Gel is carried out to shooting imaging on gel imaging system, testing result shows mycoplasma contamination after electrophoresis
Cell in gel electrophoresis it is observed that size 100-250bp band, and the cell of uncontaminated mycoplasma gel electricity
It can't detect any band in swimming.As shown in Figure 1, the agarose gel electrophoresis of different cell lines is detected for kit of the present invention,
Wherein 1-6 is respectively 293T, MGS, HepG2, HT29 cell, positive control (NCBI accession number:MG996782.1, PCR amplification
After be enriched with, primer size is in 250bp or so) and negative control (ultra-pure water).PCR results show that swimming lane 2-4 is detected greatly respectively
Small 100-250bp or so segment illustrates that swimming lane 2-4 corresponding cell line MGS, HepG2 and HT29 detect mycoplasma contamination, and
Band is not detected in 1 corresponding 293T cells of swimming lane, illustrates that mycoplasma contamination does not occur for the cell.
Sequence table
<110>Jiangsu University
<120>A kind of cell detection of mycoplasma primer, kit and detection method
<160> 4
<170> SIPOSequenceListing 1.0
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
acaccatggg agctggtaat 20
<210> 2
<211> 27
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
cttcwtcgac ttycagaccc aaggcat 27
<210> 3
<211> 17
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
gttctttgaa actgaat 17
<210> 4
<211> 18
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
gcatccacca wawactct 18
Claims (10)
1. a kind of primer of detection cell mycoplasma, which is characterized in that the primer includes external primers and internal primer,
In, the forward primer sequence of the external primers is:ACACCATGGGAGCTGGTAAT(MICO S1);The external primers
Reverse primer sequences are:CTTCWTCGACTTYCAGACCCAAGGCAT (MICO A1);Wherein M and Y is degenerate primer, W and Y
For any type base in A, T, G or C;
Wherein, the forward primer sequence of the internal primer is:GTTCTTTGAAACTGAAT (MICO S2), the inside is drawn
The reverse primer sequences of object are:GCATCCACCAWAWACTCT (MICO A2);Wherein W is degenerate primer, in W A, T, G or C
Any type base.
2. a kind of kit of detection cell mycoplasma, which is characterized in that the kit includes detection described in claim 1
The primer of cell mycoplasma, wherein the primer concentration is 200pmol/ μ L.
3. a kind of kit of detection cell mycoplasma according to claim 2, which is characterized in that the primer is specifically matched
Process processed is:The TE of MICO S1 of 1 μ L, 1 μ L MICO A1 and 48 μ L are mixed, primer one is named as, is used for the PCR first round
Amplification;The TE of MICO S2 of 1 μ L, 1 μ L MICO A2 and 48 μ L are mixed, primer two is named as, is expanded for the wheels of PCR second,
It can be placed in -20 DEG C of long-term preservations after primer packing number.
4. a kind of kit of detection cell mycoplasma according to claim 2, which is characterized in that the kit is also wrapped
Include the pre-reaction liquid needed for PCR amplification, which includes all material needed for PCR amplification, including Taq enzyme, dNTP and
Buffer solution is mixed in a certain ratio packing.
5. a kind of kit of detection cell mycoplasma according to claim 2, which is characterized in that the kit is also wrapped
Positive control and negative control are included, the positive control is that the DNA containing the intervals mycoplasma 16s and 23s conserved sequence purifies piece
Section;The negative control is the sterile water without any pollution.
6. a kind of kit of detection cell mycoplasma according to claim 2, which is characterized in that the kit is also wrapped
Containing the required lysate of lytic cell.
7. a kind of cell detection of mycoplasma method, which is characterized in that the method is complete based on the kit described in claim 2
At specific detection method includes the following steps:
(1)Collect cell DNA;
(2)PCR detects mycoplasma:
Prepare PCR pre-reaction liquid:Including 10 × PCR buffer, 5 × dNTP mixtures, Taq enzyme, sterile water;
Prepare first time pcr amplification reaction liquid:It takes PCR pre-reaction liquid that primer one is added, adds step(1)The cell of middle preparation
DNA is centrifuged after being sufficiently mixed said mixture;
First time PCR reacts:Said mixture is put into PCR and reacts instrument, PCR reaction conditions are set;Sample is taken out after reaction
Product preserve;
Prepare second of pcr amplification reaction liquid:Take PCR pre-reaction liquid that primer two is added, after adding the reaction of first time PCR
Reaction solution centrifuges after being sufficiently mixed said mixture;
Second of PCR reaction:Above-mentioned second of pcr amplification reaction liquid is put into PCR and reacts instrument, PCR reaction conditions are set;Reaction
After take out sample;
As a result it detects:Ago-Gel is prepared to be detected product.
8. a kind of cell detection of mycoplasma method according to claim 7, which is characterized in that the PCR pre-reactions liquid packet
10 × PCR buffer, 2 μ L, 5 × dNTP mixtures 1 μ L, 0.1 μ L of Taq enzyme, 14.9 μ L of sterile water are included, 18 μ L are added up to.
9. a kind of cell detection of mycoplasma method according to claim 7, which is characterized in that the first time PCR amplification
Reaction solution includes 18 μ L PCR pre-reactions liquid, 1 μ L primers one and 1 μ L steps(1)The cell DNA of middle preparation;Second of PCR
Amplification reaction solution includes the reaction solution after 18 μ L PCR pre-reactions liquid, 1 μ L primers two and the reaction of 1 μ L first times PCR.
10. a kind of cell detection of mycoplasma method according to claim 7, which is characterized in that the first time PCR reactions
Amplification condition with second of PCR reactions is 94 DEG C and reacts 10 seconds;Subsequent 94 DEG C are reacted 30 seconds, and 55 DEG C are reacted 30 seconds, 72 DEG C
Reaction 30 seconds, reaction cycle are 30 cycles.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810431199.1A CN108753996A (en) | 2018-05-08 | 2018-05-08 | A kind of cell detection of mycoplasma primer, kit and detection method |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810431199.1A CN108753996A (en) | 2018-05-08 | 2018-05-08 | A kind of cell detection of mycoplasma primer, kit and detection method |
Publications (1)
Publication Number | Publication Date |
---|---|
CN108753996A true CN108753996A (en) | 2018-11-06 |
Family
ID=64010390
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201810431199.1A Pending CN108753996A (en) | 2018-05-08 | 2018-05-08 | A kind of cell detection of mycoplasma primer, kit and detection method |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN108753996A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109251963A (en) * | 2018-11-12 | 2019-01-22 | 复旦大学 | The method and kit of mycoplasma contamination in Constant Temperature Detection cell culture fluid |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101724693A (en) * | 2009-12-24 | 2010-06-09 | 上海吉盛制药技术有限公司 | Primer pair for detecting nested PCR mycoplasmas, detection kit and use method thereof |
CN103627781A (en) * | 2012-08-24 | 2014-03-12 | 华北制药集团新药研究开发有限责任公司 | Kit and method for detecting mycoplasma pollution in CHO cultured cells |
CN106244697A (en) * | 2016-08-19 | 2016-12-21 | 上海逍鹏生物科技有限公司 | The detection primer sets of mycoplasma, test kit and the method for detection mycoplasma contamination |
-
2018
- 2018-05-08 CN CN201810431199.1A patent/CN108753996A/en active Pending
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101724693A (en) * | 2009-12-24 | 2010-06-09 | 上海吉盛制药技术有限公司 | Primer pair for detecting nested PCR mycoplasmas, detection kit and use method thereof |
CN103627781A (en) * | 2012-08-24 | 2014-03-12 | 华北制药集团新药研究开发有限责任公司 | Kit and method for detecting mycoplasma pollution in CHO cultured cells |
CN106244697A (en) * | 2016-08-19 | 2016-12-21 | 上海逍鹏生物科技有限公司 | The detection primer sets of mycoplasma, test kit and the method for detection mycoplasma contamination |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109251963A (en) * | 2018-11-12 | 2019-01-22 | 复旦大学 | The method and kit of mycoplasma contamination in Constant Temperature Detection cell culture fluid |
CN109251963B (en) * | 2018-11-12 | 2022-11-18 | 复旦大学 | Method and kit for detecting mycoplasma pollution in cell culture solution at constant temperature |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN105349530B (en) | A kind of nucleic acid detection method and detection pipe | |
Xiao et al. | Effects of diverse materials-based methods on DNA extraction for Clostridium difficle from stool samples | |
CN105420379A (en) | Real-time fluorescence quantification PCR detecting kit for cow mycoplasma and special primers and TaqMan probe thereof | |
CN101712973B (en) | Reactive reagent of nucleic acid amplification by chain replacement at room temperature and nucleic acid amplification method at room temperature thereof | |
CN109680084A (en) | A kind of primed probe and method for the compound group of Fluorescence quantitative PCR detection mycobacterium tuberculosis | |
Gou et al. | The colorimetric isothermal multiple-self-matching-initiated amplification using cresol red for rapid and sensitive detection of porcine circovirus 3 | |
CN109337995B (en) | PCR detection method and kit for eubacterium terrae and subspecies thereof | |
Lei et al. | LAMP coupled CRISPR-Cas12a module for rapid, sensitive and visual detection of Porcine Circovirus 2 | |
CN113999921B (en) | Method and kit for rapidly and visually detecting shigella flexneri | |
Phetsuksiri et al. | The performance of an in-house loop-mediated isothermal amplification for the rapid detection of Mycobacterium tuberculosis in sputum samples in comparison with Xpert MTB/RIF, microscopy and culture | |
CN108753996A (en) | A kind of cell detection of mycoplasma primer, kit and detection method | |
CN106636474B (en) | Six kinds of viral primer sets of Multiple immunizations fluoroscopic examination mouse, kit and method | |
WO2015180484A1 (en) | Nucleotides specific to providencia o31, o41, o42, o43 and o50 and uses thereof | |
CN113373247A (en) | Method for rapidly and simultaneously detecting Escherichia coli O157: H7 and Salmonella typhimurium in food | |
CN106967826A (en) | A kind of people's umbilical cord, placenta protection liquid detection of mycoplasma primer pair, kit and its detection method | |
CN102154270B (en) | Cronobacter sakazakii O antigen specific nucleotides and use thereof | |
Yano et al. | DNA extraction for short tandem repeat typing from mixed samples using anti-human leukocyte CD45 and ABO blood group antibodies | |
CN110735003A (en) | Universal primer, kit and detection method for detecting fungal contamination in cell product | |
Kamusoko et al. | Purification and Amplification of DNA from cellulolytic Bacteria: Application for Biogas production from crop residues | |
CN103937666B (en) | Concretion mycobacterium nucleic acid quick detection kit and detection method | |
AU2019100071A4 (en) | Pcr detection kit for rapidly identifying salmonella of specific serotypes | |
CN111621578A (en) | RU 61-00441 gene-based Salmonella spelt constant-temperature detection kit and method | |
CN107287315B (en) | Detection kit for Shigella, detection method and application | |
CN106167836B (en) | Multi-fluorescence analysis method and kit a kind of while that detect 4 plants of rat parvovirus | |
CN104388567A (en) | Rapid detection method for Listeria monocytogene virulence gene inlB |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181106 |
|
RJ01 | Rejection of invention patent application after publication |