CN108690130B - TCR for recognizing LMP1 antigen-derived short peptide - Google Patents

TCR for recognizing LMP1 antigen-derived short peptide Download PDF

Info

Publication number
CN108690130B
CN108690130B CN201710236979.6A CN201710236979A CN108690130B CN 108690130 B CN108690130 B CN 108690130B CN 201710236979 A CN201710236979 A CN 201710236979A CN 108690130 B CN108690130 B CN 108690130B
Authority
CN
China
Prior art keywords
tcr
chain
amino acid
seq
exon
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201710236979.6A
Other languages
Chinese (zh)
Other versions
CN108690130A (en
Inventor
李懿
相瑞瑞
胡静
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Xiangxue Life Science Technology (Guangdong) Co.,Ltd.
Original Assignee
Xiangxue Life Science Technology Guangdong Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Xiangxue Life Science Technology Guangdong Co ltd filed Critical Xiangxue Life Science Technology Guangdong Co ltd
Priority to CN201710236979.6A priority Critical patent/CN108690130B/en
Publication of CN108690130A publication Critical patent/CN108690130A/en
Application granted granted Critical
Publication of CN108690130B publication Critical patent/CN108690130B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/7051T-cell receptor (TcR)-CD3 complex
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14Blood; Artificial blood
    • A61K35/17Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/15011Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Abstract

The present invention provides a T Cell Receptor (TCR) capable of specifically binding short peptide MLWRLGATI derived from LMP1 antigen, which antigen short peptide MLWRLGATI can form a complex with HLA a0201 and be presented together on the cell surface. The invention also provides nucleic acid molecules encoding the TCRs and vectors comprising the nucleic acid molecules. In addition, the invention provides cells that transduce a TCR of the invention.

Description

TCR for recognizing LMP1 antigen-derived short peptide
Technical Field
The invention relates to a TCR capable of recognizing LMP1 antigen-derived short peptide, LMP1 specific T cells obtained by transducing the TCR, and application of the T cells in preventing and treating LMP1 related diseases.
Background
EBV is a human herpes virus that is ubiquitous worldwide. Studies have shown that over 95% of adult humans contain antibodies to this virus, which means that they are infected by this virus at some stage. EBV is present in most infected individuals throughout life, and is generally less problematic. However, in some cases, EBV is associated with the development of several cancers, including Burkitt's lymphoma, Hodgkin's lymphoma, EBV-positive post-transplant lymphoproliferative disorder (PTLD), nasopharyngeal cancer, or the like. For example, LMP1 belongs to the latent membrane protein of EBV, which is expressed by most nasopharyngeal carcinoma cells (Raab-Trub N. Epstein-Barr virus in the pathogenesis of NPC [ J ]. Semin Cancer Biol,2002,12(6): 431-441.). LMP1 is degraded into small molecule polypeptides after intracellular production and is presented to the cell surface as a complex with MHC (major histocompatibility complex) molecules. MLWRLGATI is a short peptide derived from LMP1 antigen, which is a target for the treatment of LMP1 related diseases. For the treatment of the above diseases, chemotherapy, radiotherapy and the like can be used, but both of them cause damages to normal cells themselves.
T cell adoptive immunotherapy is the transfer of reactive T cells specific for a target cell antigen into a patient to act on the target cell. The T Cell Receptor (TCR) is a membrane protein on the surface of T cells that recognizes a corresponding short peptide antigen on the surface of a target cell. In the immune system, the direct physical contact between T cells and Antigen Presenting Cells (APC) is initiated by the binding of antigen short peptide specific TCR and short peptide-major histocompatibility complex (pMHC complex), and then other cell membrane surface molecules of the T cells and APC interact to cause a series of subsequent cell signaling and other physiological reactions, so that T cells with different antigen specificities exert immune effects on their target cells. Therefore, those skilled in the art have focused on isolating TCRs specific for LMP1 antigen short peptides and transducing the TCRs into T cells to obtain T cells specific for LMP1 antigen short peptides, thereby making them useful in cellular immunotherapy.
Disclosure of Invention
The invention aims to provide a T cell receptor for recognizing LMP1 antigen short peptide.
In a first aspect of the invention, there is provided a T Cell Receptor (TCR) capable of binding to the MLWRLGATI-HLA A0201 complex.
In another preferred embodiment, the TCR comprises a TCR alpha chain variable domain and a TCR beta chain variable domain, the amino acid sequence of CDR3 of the TCR alpha chain variable domain is ALAGDSNYQLI (SEQ ID NO: 12); and/or the amino acid sequence of CDR3 of the variable domain of the TCR beta chain is ASSSLFIEMDPVNEKLF (SEQ ID NO: 15).
In another preferred embodiment, the 3 Complementarity Determining Regions (CDRs) of the TCR α chain variable domain are:
αCDR1-ATGYPS(SEQ ID NO:10)
αCDR2-ATKADDK(SEQ ID NO:11)
alpha CDR3-ALAGDSNYQLI (SEQ ID NO: 12); and/or
The 3 complementarity determining regions of the TCR β chain variable domain are:
βCDR1-MDHEN(SEQ ID NO:13)
βCDR2-SYDVKM(SEQ ID NO:14)
βCDR3-ASSSLFIEMDPVNEKLF(SEQ ID NO:15)。
in another preferred embodiment, the TCR comprises a TCR alpha chain variable domain which is an amino acid sequence having at least 90% sequence identity to SEQ ID No. 1, and a TCR beta chain variable domain; and/or the TCR β chain variable domain is identical to SEQ ID NO:5 an amino acid sequence having at least 90% sequence identity.
In another preferred embodiment, the TCR comprises the alpha chain variable domain amino acid sequence SEQ ID NO 1.
In another preferred embodiment, the TCR comprises the beta chain variable domain amino acid sequence SEQ ID NO 5.
In another preferred embodiment, the TCR is an α β heterodimer comprising a TCR α chain constant region TRAC 01 and a TCR β chain constant region TRBC1 01 or TRBC2 01.
In another preferred embodiment, the α chain amino acid sequence of the TCR is SEQ ID NO:3 and/or the beta chain amino acid sequence of the TCR is SEQ ID NO 7.
In another preferred embodiment, the TCR is soluble.
In another preferred embodiment, the TCR is single chain.
In another preferred embodiment, the TCR is formed by linking an α chain variable domain to a β chain variable domain via a peptide linker.
In another preferred embodiment, the TCR has one or more mutations in amino acid 11, 13, 19, 21, 53, 76, 89, 91, or 94 of the α chain variable region, and/or in the penultimate 3-, 5-, or 7-position of the short peptide amino acid of the α chain J gene; and/or the TCR has one or more mutations in beta chain variable region amino acid 11, 13, 19, 21, 53, 76, 89, 91, or 94 th, and/or beta chain J gene short peptide amino acid penultimate 2,4 or 6 th, wherein the amino acid position numbering is according to the position numbering listed in IMGT (international immunogenetic information system).
In another preferred embodiment, the TCR comprises (a) all or part of a TCR α chain, excluding the transmembrane domain; and (b) all or part of a TCR β chain, excluding the transmembrane domain;
and (a) and (b) each comprise a functional variable domain, or comprise a functional variable domain and at least a portion of the TCR chain constant domain.
In another preferred embodiment, the cysteine residues form an artificial disulfide bond between the alpha and beta chain constant domains of the TCR.
In another preferred embodiment, the cysteine residues forming the artificial disulfide bond in the TCR are substituted at one or more groups of sites selected from the group consisting of:
thr48 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser57 of TRBC2 × 01 exon 1;
thr45 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser77 of TRBC2 × 01 exon 1;
tyr10 and TRBC1 x 01 of exon 1 of TRAC x 01 or Ser17 of exon 1 of TRBC 2x 01;
thr45 and TRBC1 × 01 of TRAC × 01 exon 1 or Asp59 of TRBC2 × 01 exon 1;
ser15 and TRBC1 × 01 of TRAC × 01 exon 1 or Glu15 of TRBC2 × 01 exon 1;
arg53 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser54 of TRBC2 × 01 exon 1;
pro89 and TRBC1 and 01 of exon 1 of TRAC 01 or Ala19 of exon 1 of TRBC2 and 01; and
tyr10 and TRBC1 × 01 of exon 1 of TRAC × 01 or Glu20 of exon 1 of TRBC2 × 01.
In another preferred embodiment, the α chain amino acid sequence of the TCR is SEQ ID NO 26 and/or the β chain amino acid sequence of the TCR is SEQ ID NO 28.
In another preferred embodiment, the TCR comprises an artificial interchain disulfide bond between the α chain variable region and the β chain constant region.
In another preferred embodiment, the cysteine residues that form the artificial interchain disulfide bond in the TCR replace one or more groups of sites selected from the group consisting of:
amino acid 46 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC 2x 01;
amino acid 47 of TRAV and amino acid 61 of exon 1 of TRBC1 x 01 or TRBC 2x 01;
amino acid 46 of TRAV and amino acid 61 of TRBC1 x 01 or TRBC 2x 01 exon 1; or
Amino acid 47 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC 2x 01.
In another preferred embodiment, the TCR comprises an alpha chain variable domain and a beta chain variable domain and all or part of the beta chain constant domain, excluding the transmembrane domain, but which does not comprise an alpha chain constant domain, the alpha chain variable domain of the TCR forming a heterodimer with the beta chain.
In another preferred embodiment, the TCR has a conjugate attached to the C-or N-terminus of the alpha and/or beta chain.
In another preferred embodiment, the conjugate that binds to the T cell receptor is a detectable label, a therapeutic agent, a PK modifying moiety or a combination of any of these. Preferably, the therapeutic agent is an anti-CD 3 antibody.
In a second aspect of the invention, there is provided a multivalent TCR complex comprising at least two TCR molecules, and wherein at least one of the TCR molecules is a TCR according to the first aspect of the invention.
In a third aspect of the invention, there is provided a nucleic acid molecule comprising a nucleic acid sequence encoding a TCR molecule according to the first aspect of the invention, or the complement thereof.
In another preferred embodiment, the nucleic acid molecule comprises the nucleotide sequence encoding the variable domain of the TCR α chain SEQ ID NO: 2.
in another preferred embodiment, the nucleic acid molecule comprises the nucleotide sequence of SEQ ID NO: 6.
in another preferred embodiment, the nucleic acid molecule comprises the nucleotide sequence encoding the TCR α chain SEQ ID NO:4 and/or comprises the nucleotide sequence encoding the TCR β chain SEQ ID NO: 8.
in a fourth aspect of the invention, there is provided a vector comprising a nucleic acid molecule according to the third aspect of the invention; preferably, the vector is a viral vector; more preferably, the vector is a lentiviral vector.
In a fifth aspect of the invention, there is provided an isolated host cell comprising a vector according to the fourth aspect of the invention or a genome into which has been integrated an exogenous nucleic acid molecule according to the third aspect of the invention.
In a sixth aspect of the invention, there is provided a cell which transduces a nucleic acid molecule according to the third aspect of the invention or a vector according to the fourth aspect of the invention; preferably, the cell is a T cell or a stem cell.
In a seventh aspect of the invention, there is provided a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a TCR according to the first aspect of the invention, a TCR complex according to the second aspect of the invention, a nucleic acid molecule according to the third aspect of the invention, a vector according to the fourth aspect of the invention, or a cell according to the sixth aspect of the invention.
In an eighth aspect, the invention provides the use of a T cell receptor according to the first aspect of the invention, or a TCR complex according to the second aspect of the invention, a nucleic acid molecule according to the third aspect of the invention, a vector according to the fourth aspect of the invention, or a cell according to the sixth aspect of the invention, for the manufacture of a medicament for the treatment of a tumour or an autoimmune disease.
In a ninth aspect of the invention, there is provided a method of treating a disease comprising administering to a subject in need thereof an amount of a T cell receptor according to the first aspect of the invention, or a TCR complex according to the second aspect of the invention, a nucleic acid molecule according to the third aspect of the invention, a vector according to the fourth aspect of the invention, or a cell according to the sixth aspect of the invention, or a pharmaceutical composition according to the seventh aspect of the invention;
preferably, the disease is an EBV infection or a tumour, preferably the tumour is an EBV-associated tumour, more preferably the tumour comprises Burkitt's lymphoma, Hodgkin lymphoma, EBV positive post-transplant lymphoproliferative disorder (PTLD) or nasopharyngeal carcinoma and the like.
It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.
Drawings
FIG. 1a, FIG. 1b, FIG. 1c, FIG. 1d, FIG. 1e and FIG. 1f are the amino acid sequence of the TCR α chain variable domain, the nucleotide sequence of the TCR α chain variable domain, the amino acid sequence of the TCR α chain, the nucleotide sequence of the TCR α chain, the amino acid sequence of the TCR α chain with leader sequence and the nucleotide sequence of the TCR α chain with leader sequence, respectively.
Fig. 2a, fig. 2b, fig. 2c, fig. 2d, fig. 2e and fig. 2f are a TCR β chain variable domain amino acid sequence, a TCR β chain variable domain nucleotide sequence, a TCR β chain amino acid sequence, a TCR β chain nucleotide sequence, a TCR β chain amino acid sequence with a leader sequence and a TCR β chain nucleotide sequence with a leader sequence, respectively.
FIG. 3 is CD8 of monoclonal cells+And tetramer-PE double positive staining results.
Fig. 4a and 4b are the amino acid and nucleotide sequences, respectively, of a soluble TCR α chain.
Fig. 5a and 5b are the amino acid and nucleotide sequences, respectively, of a soluble TCR β chain.
Figure 6 is a gel diagram of the soluble TCR obtained after purification. The leftmost lane is reducing gel, the middle lane is molecular weight marker (marker), and the rightmost lane is non-reducing gel.
FIG. 7 is a BIAcore kinetic profile of binding of soluble TCRs of the invention to the MLWRLGATI-HLA A0201 complex.
FIG. 8 shows the results of an ELISPOT function assay of effector cells transduced with a TCR of the invention.
FIG. 9 shows the results of a killing experiment of effector cells transduced with a TCR of the invention.
Detailed Description
The present inventors have made extensive and intensive studies to find a TCR capable of specifically binding to LMP1 antigen short peptide MLWRLGATI (SEQ ID NO:9), which antigen short peptide MLWRLGATI can form a complex with HLA A0201 and be presented together on the cell surface. The invention also provides nucleic acid molecules encoding the TCRs and vectors comprising the nucleic acid molecules. In addition, the invention provides cells that transduce a TCR of the invention.
Term(s) for
MHC molecules are proteins of the immunoglobulin superfamily, which may be MHC class I or class II molecules. Therefore, it is specific for antigen presentation, different individuals have different MHC, and different short peptides in one protein antigen can be presented on the cell surface of respective APC. Human MHC is commonly referred to as an HLA gene or HLA complex.
The T Cell Receptor (TCR), is the only receptor for a specific antigenic peptide presented on the Major Histocompatibility Complex (MHC). In the immune system, direct physical contact between T cells and Antigen Presenting Cells (APCs) is initiated by the binding of antigen-specific TCRs to pMHC complexes, and then other cell membrane surface molecules of both T cells and APCs interact, which causes a series of subsequent cell signaling and other physiological reactions, thereby allowing T cells of different antigen specificities to exert immune effects on their target cells.
TCRs are cell membrane surface glycoproteins that exist as heterodimers from either the α chain/β chain or the γ chain/δ chain. In 95% of T cells the TCR heterodimer consists of α and β chains, while 5% of T cells have TCRs consisting of γ and δ chains. Native α β heterodimeric TCRs have an α chain and a β chain, which constitute subunits of an α β heterodimeric TCR. Broadly, each of the α and β chains comprises a variable region, a linker region and a constant region, and the β chain also typically contains a short diversity region between the variable region and the linker region, but the diversity region is often considered to be part of the linker region. Each variable region comprises 3 CDRs (complementarity determining regions) CDR1, CDR2 and CDR3, which are chimeric in framework structures (framework regions). The CDR regions determine the binding of the TCR to the pMHC complex, where CDR3 is recombined from variable and connecting regions, referred to as hypervariable regions. The α and β chains of a TCR are generally regarded as having two "domains" each, namely a variable domain and a constant domain, the variable domain being made up of linked variable regions and linking regions. The sequences of TCR constant domains can be found in public databases of the international immunogenetic information system (IMGT), such as the constant domain sequence of the α chain of the TCR molecule is "TRAC 01", the constant domain sequence of the β chain of the TCR molecule is "TRBC 1 01" or "TRBC 2 01". In addition, the α and β chains of the TCR also comprise a transmembrane region and a cytoplasmic region, the cytoplasmic region being very short.
In the present invention, the terms "polypeptide of the invention", "TCR of the invention", "T cell receptor of the invention" are used interchangeably.
Natural interchain disulfide bond and artificial interchain disulfide bond
A set of disulfide bonds, referred to herein as "native interchain disulfide bonds," exist between the C α and C β chains of the membrane proximal region of native TCRs. In the present invention, the artificially introduced interchain covalent disulfide bond whose position is different from that of the natural interchain disulfide bond is referred to as an "artificial interchain disulfide bond".
For convenience of description of the positions of disulfide bonds, the positions of the amino acid sequences of TRAC 01 and TRBC1 × 01 or TRBC2 × 01 are numbered in the order from the N-terminus to the C-terminus, such as in TRBC1 × 01 or TRBC2 × 01, and the 60 th amino acid in the order from the N-terminus to the C-terminus is P (proline), and thus in the present invention it can be described as Pro60 of TRBC1 × 01 or TRBC2 × 01 exon 1, and also as the 60 th amino acid of TRBC1 × 01 or TRBC2 × 01 exon 1, and as in 737bc 3 × 01 or TRBC2 × 01, and the 61 th amino acid in the order from the N-terminus to the C-terminus is Q (glutamine), and thus in the present invention it can be described as TRBC1 × 01 or TRBC 6301 × 01, or TRBC 8501, and similarly as TRBC 8261 or glbc 891. In the present invention, the position numbering of the amino acid sequences of the variable regions TRAV and TRBV follows the position numbering listed in IMGT. If an amino acid in TRAV, the position listed in IMGT is numbered 46, it is described herein as the 46 th amino acid of TRAV, and so on. In the present invention, the sequence position numbers of other amino acids are specifically described.
Detailed Description
TCR molecules
During antigen processing, antigens are degraded within cells and then carried to the cell surface by MHC molecules. T cell receptors are capable of recognizing peptide-MHC complexes on the surface of antigen presenting cells. Accordingly, a first aspect of the invention provides a TCR molecule capable of binding MLWRLGATI-HLA a0201 complex. Preferably, the TCR molecule is isolated or purified. The α and β chains of the TCR each have 3 Complementarity Determining Regions (CDRs).
In a preferred embodiment of the invention, the α chain of the TCR comprises CDRs having the amino acid sequence:
αCDR1-ATGYPS(SEQ ID NO:10)
αCDR2-ATKADDK(SEQ ID NO:11)
alpha CDR3-ALAGDSNYQLI (SEQ ID NO: 12); and/or
The 3 complementarity determining regions of the TCR β chain variable domain are:
βCDR1-MDHEN(SEQ ID NO:13)
βCDR2-SYDVKM(SEQ ID NO:14)
βCDR3-ASSSLFIEMDPVNEKLF(SEQ ID NO:15)。
chimeric TCRs can be prepared by embedding the above-described amino acid sequences of the CDR regions of the invention into any suitable framework. One skilled in the art can design or synthesize a TCR molecule with the corresponding function based on the CDR regions disclosed herein, so long as the framework structure is compatible with the CDR regions of the TCR of the invention. Thus, the TCR molecules of the invention are those which comprise the above-described α and/or β chain CDR region sequences and any suitable framework structure. The TCR α chain variable domain of the invention is an amino acid sequence having at least 90%, preferably 95%, more preferably 98% sequence identity to SEQ ID No. 1; and/or the TCR β chain variable domain of the invention is a variant of SEQ ID NO:5, having at least 90%, preferably 95%, more preferably 98% sequence identity.
In a preferred embodiment of the invention, the TCR molecules of the invention are heterodimers consisting of α and β chains. In particular, in one aspect the α chain of the heterodimeric TCR molecules comprises a variable domain and a constant domain, the α chain variable domain amino acid sequence comprising CDR1(SEQ ID NO: 10), CDR2(SEQ ID NO: 11) and CDR3(SEQ ID NO:12) of the above-described α chain. Preferably, the TCR molecule comprises the alpha chain variable domain amino acid sequence SEQ ID NO 1. More preferably, the amino acid sequence of the α chain variable domain of the TCR molecule is SEQ ID NO 1. In another aspect, the β chain of the heterodimeric TCR molecule comprises a variable domain and a constant domain, and the β chain variable domain amino acid sequence comprises CDR1(SEQ ID NO:13), CDR2(SEQ ID NO: 14), and CDR3(SEQ ID NO:15) of the above-described β chain. Preferably, the TCR molecule comprises the beta chain variable domain amino acid sequence SEQ ID NO 5. More preferably, the amino acid sequence of the β chain variable domain of the TCR molecule is SEQ ID NO 5.
In a preferred embodiment of the invention, the TCR molecules of the invention are single chain TCR molecules consisting of part or all of the α chain and/or part or all of the β chain. Single chain TCR molecules are described in Chung et al (1994) Proc. Natl. Acad. Sci. USA 91, 12654-. From the literature, those skilled in the art are readily able to construct single chain TCR molecules comprising the CDRs regions of the invention. In particular, the single chain TCR molecule comprises V α, V β and C β, preferably linked in order from N-terminus to C-terminus.
The alpha chain variable domain amino acid sequence of the single chain TCR molecule comprises the CDR1(SEQ ID NO: 10), CDR2(SEQ ID NO: 11) and CDR3(SEQ ID NO:12) of the alpha chain described above. Preferably, the single chain TCR molecule comprises the alpha chain variable domain amino acid sequence SEQ ID NO 1. More preferably, the α chain variable domain amino acid sequence of the single chain TCR molecule is SEQ ID NO 1. The amino acid sequence of the beta chain variable domain of the single chain TCR molecule comprises the CDR1(SEQ ID NO:13), CDR2(SEQ ID NO: 14) and CDR3(SEQ ID NO:15) of the above-described beta chain. Preferably, the single chain TCR molecule comprises the beta chain variable domain amino acid sequence SEQ ID NO 5. More preferably, the amino acid sequence of the β chain variable domain of the single chain TCR molecule is SEQ ID NO 5.
In a preferred embodiment of the invention, the constant domain of the TCR molecules of the invention is a human constant domain. The human constant domain amino acid sequences are known to those skilled in the art or can be obtained by consulting published databases of relevant books or IMGT (international immunogenetic information system). For example, the constant domain sequence of the α chain of the TCR molecules of the invention can be "TRAC 01", and the constant domain sequence of the β chain of the TCR molecules can be "TRBC 1 01" or "TRBC 2 01". Arg at position 53 of the amino acid sequence given in TRAC 01 of IMGT, here denoted: TRAC × 01 Arg53 of exon 1, and so on. Preferably, the amino acid sequence of the α chain of the TCR molecule of the invention is SEQ ID NO 3 and/or the amino acid sequence of the β chain is SEQ ID NO 7.
Naturally occurring TCRs are membrane proteins that are stabilized by their transmembrane regions. Like immunoglobulins (antibodies) as antigen recognition molecules, TCRs can also be developed for diagnostic and therapeutic applications, where soluble TCR molecules are required. Soluble TCR molecules do not include their transmembrane regions. Soluble TCRs have a wide range of uses, not only for studying the interaction of TCRs with pmhcs, but also as diagnostic tools for detecting infections or as markers for autoimmune diseases. Similarly, soluble TCRs can be used to deliver therapeutic agents (e.g., cytotoxic or immunostimulatory compounds) to cells presenting a specific antigen, and in addition, soluble TCRs can be conjugated to other molecules (e.g., anti-CD 3 antibodies) to redirect T cells to target them to cells presenting a particular antigen. The present invention also obtains soluble TCRs specific for LMP1 antigen short peptides.
To obtain a soluble TCR, in one aspect, the inventive TCR may be one in which an artificial disulfide bond is introduced between residues of the constant domains of its alpha and beta chains. Cysteine residues form an artificial interchain disulfide bond between the alpha and beta chain constant domains of the TCR. Cysteine residues may be substituted for other amino acid residues at appropriate positions in native TCRs to form artificial interchain disulfide bonds. For example, a disulfide bond is formed by substituting Thr48 of exon 1 of TRAC × 01 and a cysteine residue of Ser57 of exon 1 of TRBC1 × 01 or TRBC2 × 01. Other sites for introducing cysteine residues to form disulfide bonds may also be: thr45 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser77 of TRBC2 × 01 exon 1; tyr10 and TRBC1 x 01 of exon 1 of TRAC x 01 or Ser17 of exon 1 of TRBC 2x 01; thr45 and TRBC1 × 01 of TRAC × 01 exon 1 or Asp59 of TRBC2 × 01 exon 1; ser15 and TRBC1 × 01 of TRAC × 01 exon 1 or Glu15 of TRBC2 × 01 exon 1; arg53 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser54 of TRBC2 × 01 exon 1; pro89 and TRBC1 and 01 of exon 1 of TRAC 01 or Ala19 of exon 1 of TRBC2 and 01; or Tyr10 and TRBC1 and 01 of TRAC 01 exon 1 or Glu20 of TRBC2 and 01 exon 1. I.e., a cysteine residue, in place of any of the above-described alpha and beta chain constant domains. The TCR constant domains of the invention may be truncated at one or more of their C-termini by up to 50, or up to 30, or up to 15, or up to 10, or up to 8 or fewer amino acids, so as not to include a cysteine residue for the purpose of deleting the native disulphide bond, or by mutating the cysteine residue forming the native disulphide bond to another amino acid.
As described above, the TCRs of the invention may comprise artificial disulfide bonds introduced between residues of the constant domains of their alpha and beta chains. It should be noted that the TCRs of the invention may each contain both TRAC constant domain sequences and TRBC1 or TRBC2 constant domain sequences, with or without the artificial disulfide bonds introduced as described above between the constant domains. The TRAC constant domain sequence and TRBC1 or TRBC2 constant domain sequences of the TCR may be linked by the native disulfide bond present in the TCR.
To obtain a soluble TCR, on the other hand, the inventive TCR also comprises a TCR having a mutation in its hydrophobic core region, preferably a mutation that enables an improved stability of the inventive soluble TCR, as described in the patent publication WO 2014/206304. Such TCRs may be mutated at the following variable domain hydrophobic core positions: (alpha and/or beta chain) variable region amino acid positions 11, 13, 19, 21, 53, 76, 89, 91, 94, and/or positions 3,5,7 of the reciprocal amino acid position of the short peptide of the alpha chain J gene (TRAJ), and/or positions 2,4,6 of the reciprocal amino acid position of the short peptide of the beta chain J gene (TRBJ), wherein the position numbering of the amino acid sequence is according to the position numbering listed in the International immunogenetic information System (IMGT). The above-mentioned international system of immunogenetics information is known to the skilled person and the position numbering of the amino acid residues of the different TCRs in IMGT can be derived from this database.
The TCR with the mutated hydrophobic core region of the invention can be a stable soluble single chain TCR formed by connecting the variable domains of the alpha and beta chains of the TCR by a flexible peptide chain. It should be noted that the flexible peptide chain of the present invention can be any peptide chain suitable for linking the TCR α and β chain variable domains.
In addition, for stability, patent document PCT/CN2016/077680 also discloses that the introduction of an artificial interchain disulfide bond between the α chain variable region and the β chain constant region of the TCR can significantly improve the stability of the TCR. Thus, the high affinity TCRs of the invention may also contain an artificial interchain disulfide bond between the α chain variable region and the β chain constant region. Specifically, the cysteine residues that form the artificial interchain disulfide bond between the α chain variable region and the β chain constant region of the TCR are substituted for: amino acid 46 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC 2x 01; amino acid 47 of TRAV and amino acid 61 of exon 1 of TRBC1 x 01 or TRBC 2x 01; amino acid 46 of TRAV and amino acid 61 of TRBC1 x 01 or TRBC 2x 01 exon 1; or amino acid 47 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC 2x 01. Preferably, such a TCR may comprise (i) all or part of a TCR α chain, excluding its transmembrane domain, and (ii) all or part of a TCR β chain, excluding its transmembrane domain, wherein (i) and (ii) both comprise the variable domain and at least part of the constant domain of the TCR chain, the α chain forming a heterodimer with the β chain. More preferably, such a TCR may comprise the a chain variable domain and the β chain variable domain and all or part of the β chain constant domain, excluding the transmembrane domain, but which does not comprise the a chain constant domain, the a chain variable domain of the TCR forming a heterodimer with the β chain.
The TCRs of the invention may also be provided in the form of multivalent complexes. Multivalent TCR complexes of the invention comprise polymers formed by association of two, three, four or more TCRs of the invention, such as might be produced as a tetramer using the tetrameric domain of p53, or a complex formed by association of a plurality of TCRs of the invention with another molecule. The TCR complexes of the invention can be used to track or target cells presenting a particular antigen in vitro or in vivo, and can also be used to generate intermediates for other multivalent TCR complexes having such applications.
The TCRs of the invention may be used alone or in covalent or other association, preferably covalently, with a conjugate. The conjugates include a detectable label (for diagnostic purposes, wherein the TCR is used to detect the presence of cells presenting the MLWRLGATI-HLA a0201 complex), a therapeutic agent, a PK (protein kinase) modifying moiety, or a combination of any of the above.
Detectable labels for diagnostic purposes include, but are not limited to: a fluorescent or luminescent label, a radioactive label, an MRI (magnetic resonance imaging) or CT (computed tomography) contrast agent, or an enzyme capable of producing a detectable product.
Therapeutic agents that may be associated or conjugated with the TCRs of the invention include, but are not limited to: 1. radionuclides (Koppe et al, 2005, Cancer metastasis reviews (Cancer metastasis) 24, 539); 2. biotoxicity (Chaudhary et al, 1989, Nature 339, 394; Epel et al, 2002, Cancer Immunology and Immunotherapy 51, 565); 3. cytokines such as IL-2 and the like (Gillies et al, 1992, Proc. Natl. Acad. Sci. USA (PNAS)89, 1428; Card et al, 2004, Cancer Immunology and Immunotherapy)53, 345; Halin et al, 2003, Cancer Research 63, 3202); 4. antibody Fc fragment (Mosquera et al, 2005, Journal Of Immunology 174, 4381); 5. antibody scFv fragments (Zhu et al, 1995, International Journal of Cancer 62,319); 6. gold nanoparticles/nanorods (Lapotko et al, 2005, Cancer letters 239, 36; Huang et al, 2006, Journal of the American Chemical Society 128, 2115); 7. viral particles (Peng et al, 2004, Gene therapy 11, 1234); 8. liposomes (Mamot et al, 2005, Cancer research 65, 11631); 9. nano magnetic particles; 10. prodrug activating enzymes (e.g., DT-diaphorase (DTD) or biphenyl hydrolase-like protein (BPHL)); 11. chemotherapeutic agents (e.g., cisplatin) or nanoparticles in any form, and the like.
In addition, the TCRs of the invention may also be hybrid TCRs comprising sequences derived from more than one species. For example, studies have shown that murine TCRs are more efficiently expressed in human T cells than human TCRs. Thus, the inventive TCR may comprise a human variable domain and a murine constant domain. The drawback of this approach is the possibility of eliciting an immune response. Thus, there should be a regulatory regimen to immunosuppresse when it is used for adoptive T cell therapy to allow for the engraftment of murine expressing T cells.
It should be understood that the amino acid names herein are expressed in terms of international single-letter or three-letter english letters, and the single-letter english letter and three-letter english letters of the amino acid names correspond to the following relationships: ala (A), Arg (R), Asn (N), Asp (D), Cys (C), Gln (Q), Glu (E), Gly (G), His (H), Ile (I), Leu (L), Lys (K), Met (M), Phe (F), Pro (P), Ser (S), Thr (T), Trp (W), Tyr (Y) and Val (V).
Nucleic acid molecules
A second aspect of the invention provides a nucleic acid molecule encoding a TCR molecule of the first aspect of the invention or a portion thereof, which may be one or more CDRs, variable domains of the alpha and/or beta chains, and the alpha and/or beta chains.
The nucleotide sequence encoding the α chain CDR regions of the TCR molecules of the first aspect of the invention is as follows:
αCDR1-gccacaggatacccttcc(SEQ ID NO:16)
αCDR2-gccacgaaggctgatgacaag(SEQ ID NO:17)
αCDR3-gctctggcgggggatagcaactatcagttaatc(SEQ ID NO:18)
the nucleotide sequence encoding the β chain CDR regions of the TCR molecules of the first aspect of the invention is as follows:
βCDR1-atggaccatgaaaat(SEQ ID NO:19)
βCDR2-tcatatgatgttaaaatg(SEQ ID NO:20)
βCDR3-gccagcagttccctttttatagaaatggaccccgttaatgaaaaactgttt(SEQ ID NO:21)
thus, the nucleotide sequence of the nucleic acid molecule of the invention encoding the TCR alpha chain of the invention comprises SEQ ID NO 16, 17 and 18 and/or the nucleotide sequence of the nucleic acid molecule of the invention encoding the TCR beta chain of the invention comprises SEQ ID NO 19, 20 and 21.
The nucleotide sequence of the nucleic acid molecule of the invention may be single-stranded or double-stranded, the nucleic acid molecule may be RNA or DNA, and may or may not comprise an intron. Preferably, the nucleotide sequence of the nucleic acid molecule of the invention does not comprise an intron but is capable of encoding a polypeptide of the invention, e.g. the nucleotide sequence of the nucleic acid molecule of the invention encoding a TCR alpha chain variable domain of the invention comprises SEQ ID NO 2 and/or the nucleotide sequence of the nucleic acid molecule of the invention encoding a TCR beta chain variable domain of the invention comprises SEQ ID NO 6. More preferably, the nucleotide sequence of the nucleic acid molecule of the invention comprises SEQ ID NO. 4 and/or SEQ ID NO. 8.
It will be appreciated that, due to the degeneracy of the genetic code, different nucleotide sequences may encode the same polypeptide. Thus, the nucleic acid sequence encoding the TCR of the present invention may be identical to or a degenerate variant of the nucleic acid sequences shown in the figures of the present invention. As illustrated by one of the examples herein, a "degenerate variant" refers to a nucleic acid sequence that encodes a protein sequence having SEQ ID NO. 1, but differs from the sequence of SEQ ID NO. 2.
The nucleotide sequence may be codon optimized. Different cells differ in the utilization of specific codons, and the expression level can be increased by changing the codons in the sequence according to the type of the cell. Codon usage tables for mammalian cells as well as for various other organisms are well known to those skilled in the art.
The full-length sequence of the nucleic acid molecule of the present invention or a fragment thereof can be obtained by, but not limited to, PCR amplification, recombination, or artificial synthesis. At present, DNA sequences encoding the TCRs of the invention (or fragments or derivatives thereof) have been obtained entirely by chemical synthesis. The DNA sequence may then be introduced into various existing DNA molecules (or vectors, for example) and cells known in the art. The DNA may be the coding strand or the non-coding strand.
Carrier
The invention also relates to vectors comprising the nucleic acid molecules of the invention, including expression vectors, i.e. constructs capable of expression in vivo or in vitro. Commonly used vectors include bacterial plasmids, bacteriophages and animal and plant viruses.
Viral delivery systems include, but are not limited to, adenoviral vectors, adeno-associated virus (AAV) vectors, herpes viral vectors, retroviral vectors, lentiviral vectors, baculoviral vectors.
Preferably, the vector can transfer the nucleotide of the invention into a cell, e.g., a T cell, such that the cell expresses a TCR specific for the LMP1 antigen. Ideally, the vector should be capable of sustained high level expression in T cells.
Cells
The invention also relates to genetically engineered host cells that have been engineered with the vectors or coding sequences of the invention. The host cell comprises a vector of the invention or has integrated into its chromosome a nucleic acid molecule of the invention. The host cell is selected from: prokaryotic and eukaryotic cells, such as E.coli, yeast cells, CHO cells, and the like.
In addition, the invention also includes isolated cells, particularly T cells, that express the TCRs of the invention. The T cell may be derived from a T cell isolated from a subject, or may be part of a mixed population of cells isolated from a subject, such as a population of Peripheral Blood Lymphocytes (PBLs). For example, the cells may be isolated from Peripheral Blood Mononuclear Cells (PBMC), which may be CD4+Helper T cell or CD8+Cytotoxic T cells. The cell may be in CD4+Helper T cell/CD 8+A mixed population of cytotoxic T cells. Generally, the cells can be activated with an antibody (e.g., an anti-CD 3 or anti-CD 28 antibody) to render them more amenable to transfection, e.g., transfection with a vector comprising a nucleotide sequence encoding a TCR molecule of the invention.
Alternatively, the cell of the invention may also be or be derived from a stem cell, such as a Hematopoietic Stem Cell (HSC). Gene transfer to HSCs does not result in TCR expression on the cell surface, since the CD3 molecule is not expressed on the stem cell surface. However, when stem cells differentiate into lymphoid precursors (lymphoid precursors) that migrate to the thymus, expression of the CD3 molecule will initiate expression of the introduced TCR molecule on the surface of the thymocytes.
There are many methods suitable for T cell transfection using DNA or RNA encoding the TCR of the invention (e.g., Robbins et al, (2008) J.Immunol.180: 6116-. T cells expressing the TCRs of the invention may be used for adoptive immunotherapy. Those skilled in the art will be able to recognize many suitable methods for adoptive therapy (e.g., Rosenberg et al, (2008) Nat Rev Cancer8 (4): 299-308).
LMP1 antigen-related diseases
The present invention also relates to a method of treating and/or preventing a disease associated with LMP1 in a subject comprising the step of adoptively transferring LMP1 specific T cells to the subject. The LMP 1-specific T cells recognized MLWRLGATI-HLA A0201 complex.
The LMP1 specific T cells of the invention can be used for treating any LMP1 related diseases presenting LMP1 antigen short peptide MLWRLGATI-HLA A0201 complex. Including but not limited to EBV infection or a tumor, preferably the tumor is an EBV-associated tumor, more preferably the tumor comprises Burkitt's lymphoma, Hodgkin lymphoma, EBV positive post-transplant lymphoproliferative disorder (PTLD), nasopharyngeal carcinoma, or the like.
Method of treatment
Treatment may be effected by isolating T cells from patients or volunteers suffering from a disease associated with the LMP1 antigen and introducing the TCR of the invention into such T cells, followed by reinfusion of these genetically engineered cells into the patient. Accordingly, the present invention provides a method of treating a LMP 1-related disease comprising infusing into a patient an isolated T cell expressing a TCR of the invention, preferably the T cell is derived from the patient himself. Generally, this involves (1) isolating T cells from the patient, (2) transducing T cells in vitro with a nucleic acid molecule of the invention or a nucleic acid molecule capable of encoding a TCR molecule of the invention, and (3) infusing the genetically modified T cells into the patient. The number of cells isolated, transfected and transfused can be determined by a physician.
The main advantages of the invention are:
(1) the TCR disclosed by the invention can be combined with LMP1 antigen short peptide complex MLWRLGATI-HLA A0201, and cells transduced with the TCR disclosed by the invention can be specifically activated and have a strong killing effect on target cells.
The following specific examples further illustrate the invention. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, for which specific conditions are not indicated in the following examples, are generally carried out according to conventional conditions, for example as described in Sambrook and Russel et al, Molecular Cloning: A Laboratory Manual (third edition) (2001) CSHL Press, or according to the conditions as recommended by the manufacturer. Unless otherwise indicated, percentages and parts are by weight. Unless otherwise indicated, percentages and parts are by weight. The test materials and reagents used in the following examples are commercially available without specific reference.
Example 1 cloning of LMP1 antigen short peptide specific T cells
Peripheral Blood Lymphocytes (PBLs) from healthy volunteers of genotype HLA-A0201 were stimulated with synthetic short peptide MLWRLGATI (SEQ ID NO. 9; Peking Saibance Gene technology, Inc.). MLWRLGATI short peptide and HLA-A0201 with biotin label are renatured to prepare pHLA haploid. These haploids were combined with streptavidin labeled with PE (BD Co.) to form PE-labeled tetramers, which were sorted for double positive anti-CD 8-APC cells. The sorted cells were expanded and subjected to secondary sorting as described above, followed by single cloning by limiting dilution. Monoclonal cells were stained with tetramer and double positive clones were selected as shown in FIG. 3.
Example 2 construction of TCR Gene and vector for obtaining LMP1 antigen short peptide specific T cell clone
Using Quick-RNATMMiniPrep (ZYMO research) extracted the total RNA of the T cell clone specific to the antigen short peptide MLWRLGATI and restricted by HLA-A0201 selected in example 1. cDNA was synthesized using the SMART RACE cDNA amplification kit from clontech, using primers designed to preserve the C-terminal region of the human TCR gene. The sequences were cloned into the T vector (TAKARA) and sequenced. It should be noted that the sequence is a complementary sequence, not including introns. The alpha chain and beta chain sequence structures of the TCR expressed by the double positive clone are respectively shown in figure 1 and figure 2 by sequencing, and figure 1a, figure 1b, figure 1c, figure 1d, figure 1e and figure 1f are respectively a TCR alpha chain variable domain amino acid sequence, a TCR alpha chain variable domain nucleotide sequence, a TCR alpha chain amino acid sequence, a TCR alpha chain nucleotide sequence, a TCR alpha chain amino acid sequence with a leader sequence and a TCR alpha chain nucleotide sequence with the leader sequence; fig. 2a, fig. 2b, fig. 2c, fig. 2d, fig. 2e and fig. 2f are a TCR β 0 chain variable domain amino acid sequence, a TCR β 1 chain variable domain nucleotide sequence, a TCR β 2 chain amino acid sequence, a TCR β 3 chain nucleotide sequence, a TCR β chain amino acid sequence with a leader sequence and a TCR β chain nucleotide sequence with a leader sequence, respectively.
The alpha chain was identified to comprise CDRs with the following amino acid sequences:
αCDR1-ATGYPS(SEQ ID NO:10)
αCDR2-ATKADDK(SEQ ID NO:11)
αCDR3-ALAGDSNYQLI(SEQ ID NO:12)
the beta chain comprises CDRs having the following amino acid sequences:
βCDR1-MDHEN(SEQ ID NO:13)
βCDR2-SYDVKM(SEQ ID NO:14)
βCDR3-ASSSLFIEMDPVNEKLF(SEQ ID NO:15)
the full length genes for the TCR α and β chains were cloned into the lentiviral expression vector pllenti (addendum) by overlap (overlap) PCR, respectively. The method specifically comprises the following steps: the TCR alpha chain and the TCR beta chain are connected by overlap PCR to obtain the TCR alpha-2A-TCR beta segment. And (3) carrying out enzyme digestion and connection on the lentivirus expression vector and the TCR alpha-2A-TCR beta to obtain pLenti-TRA-2A-TRB-IRES-NGFR plasmid. As a control, a lentiviral vector pLenti-eGFP expressing eGFP was also constructed. The pseudovirus was then packaged again at 293T/17.
Example 3 expression, refolding and purification of LMP1 antigen short peptide specific soluble TCR
To obtain soluble TCR molecules, the α and β chains of the TCR molecules of the invention may comprise only the variable and part of the constant domains thereof, respectively, and a cysteine residue has been introduced into the constant domains of the α and β chains, respectively, to form artificial interchain disulfide bonds, at the positions Thr48 of exon 1 TRAC × 01 and Ser57 of exon 1 TRBC2 × 01, respectively; the amino acid sequence and nucleotide sequence of the alpha chain are shown in FIGS. 4a and 4b, respectively, and the amino acid sequence and nucleotide sequence of the beta chain are shown in FIGS. 5a and 5b, respectively, and the introduced cysteine residues are shown in bold and underlined letters. The above-mentioned gene sequences of interest for the TCR alpha and beta chains were synthesized and inserted into the expression vector pET28a + (Novagene) by standard methods described in Molecular Cloning A Laboratory Manual (third edition, Sambrook and Russell), and the upstream and downstream Cloning sites were NcoI and NotI, respectively. The insert was confirmed by sequencing without error.
Expression vectors for TCR alpha and beta chains are communicated respectivelyTransformation into expression bacterium BL21(DE3) by chemical transformation, and growth of the bacterium in LB medium at OD600Inclusion bodies formed after expression of the α and β chains of the TCR were extracted by BugBuster Mix (Novagene) and washed repeatedly with BugBuster solution several times at 0.6 final induction with final concentration of 0.5mM IPTG, and finally dissolved in 6M guanidine hydrochloride, 10mM Dithiothreitol (DTT),10mM ethylenediaminetetraacetic acid (EDTA),20mM Tris (pH 8.1).
The TCR α and β chains after lysis were separated by 1:1 was rapidly mixed in 5M urea, 0.4M arginine, 20mM Tris (pH 8.1),3.7mM cystamine,6.6mM β -mercaptamine (4 ℃) to a final concentration of 60 mg/mL. After mixing, the solution was dialyzed against 10 volumes of deionized water (4 ℃ C.) and after 12 hours, the deionized water was changed to a buffer (20mM Tris, pH 8.0) and dialysis was continued at 4 ℃ for 12 hours. The solution after completion of dialysis was filtered through a 0.45. mu.M filter and then purified by an anion exchange column (HiTrap Q HP,5ml, GE Healthcare). The TCR eluted with peaks containing successfully renatured α and β dimers was confirmed by SDS-PAGE gel. The TCR was subsequently further purified by gel filtration chromatography (HiPrep 16/60, Sephacryl S-100HR, GE Healthcare). The purity of the purified TCR was greater than 90% as determined by SDS-PAGE and the concentration was determined by BCA. The SDS-PAGE gel of the soluble TCR of the invention is shown in FIG. 6.
Example 4 binding characterisation
BIAcore analysis
This example demonstrates that soluble TCR molecules of the invention are capable of specifically binding to the MLWRLGATI-HLA a0201 complex.
The binding activity of the TCR molecules obtained in example 3 to the MLWRLGATI-HLA A0201 complex was tested using a BIAcore T200 real-time assay system. Anti-streptavidin antibody (GenScript) was added to coupling buffer (10mM sodium acetate buffer, pH 4.77), and then the antibody was passed through CM5 chip previously activated with EDC and NHS to immobilize the antibody on the chip surface, and finally the unreacted activated surface was blocked with ethanolamine hydrochloric acid solution to complete the coupling process at a coupling level of about 15,000 RU.
The low concentration of streptavidin was flowed over the antibody coated chip surface, then MLWRLGATI-HLA A0201 complex was flowed over the detection channel, the other channel served as the reference channel, and 0.05mM biotin was flowed over the chip at a flow rate of 10. mu.L/min for 2min to block the remaining binding sites of streptavidin.
The MLWRLGATI-HLA A0201 complex is prepared as follows:
a. purification of
Collecting 100ml E.coli liquid for inducing expression of heavy chain or light chain, centrifuging at 4 ℃ for 10min at 8000g, washing the thalli once with 10ml PBS, then resuspending the thalli with 5ml BugBuster Master Mix Extraction Reagents (Merck) by vigorous shaking, rotatably incubating at room temperature for 20min, centrifuging at 4 ℃ for 15min at 6000g, discarding supernatant, and collecting inclusion body.
Resuspending the inclusion bodies in 5ml of BugBuster Master Mix, and rotary incubating at room temperature for 5 min; adding 30ml of 10-fold diluted BugBuster, uniformly mixing, and centrifuging at 4 ℃ at 6000g for 15 min; discarding the supernatant, adding 30ml of 10-fold diluted BugBuster to resuspend the inclusion bodies, mixing uniformly, centrifuging at 4 ℃ for 15min at 6000g, repeating twice, adding 30ml of 20mM Tris-HCl pH 8.0 to resuspend the inclusion bodies, mixing uniformly, centrifuging at 4 ℃ for 15min at 6000g, finally dissolving the inclusion bodies by using 20mM Tris-HCl 8M urea, detecting the purity of the inclusion bodies by SDS-PAGE, and detecting the concentration by using a BCA kit.
b. Renaturation
The synthesized short peptide MLWRLGATI (Beijing Baisheng Gene technology Co., Ltd.) was dissolved in DMSO to a concentration of 20 mg/ml. Inclusion of light and heavy chains was solubilized with 8M Urea, 20mM Tris pH 8.0, 10mM DTT and further denatured by addition of 3M guanidine hydrochloride, 10mM sodium acetate, 10mM EDTA prior to renaturation. MLWRLGATI peptide was added to a renaturation buffer (0.4M L-arginine, 100mM Tris pH 8.3, 2mM EDTA, 0.5mM oxidative glutathione, 5mM reduced glutathione, 0.2mM PMSF, cooled to 4 ℃) at 25mg/L (final concentration), followed by the addition of 20mg/L of light chain and 90mg/L of heavy chain in sequence (final concentration, heavy chain was added in three portions, 8 h/time), and renaturation was carried out at 4 ℃ for at least 3 days until completion, and SDS-PAGE checked for success or failure of the renaturation.
c. Purification after renaturation
The renaturation buffer was replaced by dialysis against 10 volumes of 20mM Tris pH 8.0, at least twice to reduce the ionic strength of the solution sufficiently. After dialysis, the protein solution was filtered through a 0.45 μm cellulose acetate filter and then loaded onto a HiTrap Q HP (GE general electric) anion exchange column (5ml bed volume). The protein was eluted using an Akta purifier (GE general electric) with a 0-400mM NaCl linear gradient prepared in 20mM Tris pH 8.0, pMHC was eluted at about 250mM NaCl, the peak fractions were collected, and the purity was checked by SDS-PAGE.
d. Biotinylation of the compound
The purified pMHC molecules were concentrated using Millipore ultrafiltration tubes while displacing the buffer to 20mM Tris pH 8.0, followed by addition of biotinylation reagent 0.05M Bicine pH 8.3, 10mM ATP, 10mM MgOAc, 50. mu. M D-Biotin, 100. mu.g/ml BirA enzyme (GST-BirA), incubation of the mixture overnight at room temperature, and SDS-PAGE to determine the completion of biotinylation.
e. Purification of biotinylated complexes
The biotinylated pMHC molecules were concentrated to 1ml using Millipore ultrafiltration tubes, the biotinylated pMHC was purified by gel filtration chromatography, and HiPrep was pre-equilibrated with filtered PBS using Akta purifier (GE general electric Co., Ltd.)TM16/60S200HR column (GE general electric) was loaded with 1ml of concentrated biotinylated pMHC molecules and then eluted with PBS at a flow rate of 1 ml/min. Biotinylated pMHC molecules appeared as a unimodal elution at approximately 55 ml. The fractions containing the protein were pooled, concentrated using Millipore ultrafiltration tubes, protein concentration was determined by BCA (Thermo), and biotinylated pMHC molecules were stored in aliquots at-80 ℃ by addition of the protease inhibitor cocktail (Roche).
Kinetic parameters were calculated by BIAcore Evaluation software, and the kinetic profiles of the soluble TCR molecule MLWRLGATI-HLA A0201 complex binding obtained are shown in FIG. 7. The map shows that the soluble TCR molecule obtained by the invention can be combined with MLWRLGATI-HLA A0201 complex. Meanwhile, the method is used for detecting the binding activity of the soluble TCR molecule and the short peptides of other unrelated antigens and the HLA complex, and the result shows that the TCR molecule is not bound with other unrelated antigens.
Example 5LMP1 antigen short peptide specific TCR Lentiviral packaging and Primary T cell transfection
(a) Production of lentiviruses by Rapid-mediated transient transfection of 293T cells
A third generation lentiviral packaging system was used to package lentiviruses containing the gene encoding the desired TCR. 293T cells were transfected with 4 plasmids (one lentiviral vector containing pLenti-TRA-2A-TRB-IRES-NGFR as described In example 2, and 3 plasmids containing other components necessary for the construction of infectious but non-replicating lentiviral particles) using rapid-mediated transient transfection (Express-In-mediated transfection) (Open Biosystems).
(b) Transduction of primary T cells with lentiviruses containing the T cell receptor gene specific for the LMP1 antigen short peptide
CD8+ T cells were isolated from the blood of healthy volunteers and transduced with packaged lentiviruses. These cells were counted and incubated overnight in 48-well plates with 1 × 106 cells/ml (0.5 ml/well) in 1640 (gibbeco, cat # C11875500bt) medium containing 10% FBS (gibbeco, cat # C10010500BT) containing 50IU/ml IL-2 and 10ng/ml IL-7 with pre-washed anti-CD 3/CD28 antibody-coated beads (T-cell amplicons, life technologies, cat # 11452D) stimulated cells: bead 3: 1.
after overnight stimulation, according to the virus titer measured by the p24ELISA kit, the concentrated lentivirus of PRAME antigen oligopeptide specific T cell receptor gene was added at an MOI of 10 and centrifuged at 32 ℃ and 900g for 1 hour. After infection, the lentivirus infection solution was removed and the cells were resuspended in 1640 medium containing 10% FBS containing 50IU/ml IL-2 and 10ng/ml IL-7 and cultured at 37 ℃/5% CO2 for 3 days. The next day a second round of infection was performed in the same way. Cells were counted 3 days after the second transduction and diluted to 0.5X 106Individual cells/ml. Cells were counted every two days, replaced or supplemented with fresh medium containing 50IU/ml IL-2 and 10ng/ml IL-7, maintaining the cells at 0.5X 106-1×106Individual cells/ml. Cells were analyzed by flow cytometry starting on day 3 and starting on day 5 for functional assays (e.g., ELISPOT for IFN- γ release and non-radioactive cytotoxicity assays). From the firstFreezing storage of aliquots of cells, at least 4X 10, starting at 10 days or at a time when cells slow down division and diminish in size6Individual cell/tube (1X 10)7Individual cells/ml, 90% FBS/10% DMSO).
Example 6 activation of T cells transducing TCRs of the invention
ELISPOT scheme
The following assay was performed to demonstrate the specific activation response of TCR-transduced T cells to target cells. IFN-. gamma.production as measured by the ELISPOT assay was used as a readout for T cell activation.
Reagent
Test medium: 10% FBS (Gibbo, catalog number 16000-
Wash buffer (PBST): 0.01M PBS/0.05% Tween 20
PBS (Gibbo Co., catalog number C10010500BT)
PVDF ELISPOT 96-well plate (Merck Millipore, Cat. No. MSIPS4510)
Human IFN-. gamma.ELISPOT PVDF-enzyme kit (BD) contains all other reagents required (capture and detection antibody, streptavidin-alkaline phosphatase and BCIP/NBT solution)
Method
Target cell preparation
The target cells used in this experiment were T2 cells. Target cells were prepared in experimental media: the concentration of the target cells is adjusted to 2.0X 105One/ml, 100. mu.l/well to obtain 2.0X 104Individual cells/well.
Effector cell preparation
The effector cells (T cells) of this experiment were CD8+ T cells expressing the TCR specific for the LMP1 antigen short peptide of the present invention analyzed by flow cytometry in example 5, and CD8+ T cells of the same volunteer that was not transfected with the TCR of the present invention were used as a control, while T2 cells loaded with other nonspecific short peptides were also used as a control. T cells were stimulated with anti-CD 3/CD28 coated beads (T cell amplicons, life technologies), transduced with lentiviruses carrying the LMP1 antigen short peptide specific TCR gene (according to example 5), expanded in 1640 medium containing 10% FBS with 50IU/ml IL-2 and 10ng/ml IL-7 until 9-12 days after transduction, then placed in test medium and washed by centrifugation at 300g for 10min at RT. The cells were then resuspended in the test medium at 2 × the desired final concentration. Negative control effector cells were treated as well.
Preparation of short peptide solution
The corresponding short peptide was added to the corresponding target cell (T2) experiment group to give a final concentration of 1. mu.g/ml of short peptide in ELISPOT well plates.
ELISPOT
The well plate was prepared as follows according to the manufacturer's instructions: 10ml of sterile PBS per plate 1: anti-human IFN-. gamma.capture antibody was diluted at 200, and 100. mu.l of the diluted capture antibody was aliquoted into each well. The plates were incubated overnight at 4 ℃. After incubation, the well plates were washed to remove excess capture antibody. 100 μ l/well of RPMI1640 medium containing 10% FBS was added and the well plates were incubated at room temperature for 2 hours to close the well plates. The media was then washed from the well plate, and any residual wash buffer was removed by flicking and tapping the ELISPOT well plate on paper.
The components of the assay were then added to ELISPOT well plates in the following order:
100 microliter of target cells 2x105Cells/ml (total of about 2x10 was obtained)4Individual target cells/well).
100 microliter of effector cells (1 x 10)4Individual control effector cells/well and LMP1TCR positive T cells/well).
All wells were prepared in duplicate for addition.
The well plates were then incubated overnight (37 ℃/5% CO)2) The next day, the medium was discarded, the well plate was washed 2 times with double distilled water and 3 times with wash buffer, and tapped on a paper towel to remove residual wash buffer. Then, the mixture was mixed with PBS containing 10% FBS at a ratio of 1: the detection antibody was diluted at 200 and added to each well at 100. mu.l/well. The well plate was incubated at room temperature for 2 hours, washed 3 times with wash buffer and the well plate was tapped on a paper towel to remove excess wash buffer.
PBS containing 10% FBS was used at 1: streptavidin-alkaline phosphatase was diluted 100, 100 microliters of diluted streptavidin-alkaline phosphatase was added to each well and the wells were incubated for 1 hour at room temperature. The plates were then washed 2 times with 4 washes of PBS and tapped on a paper towel to remove excess wash buffer and PBS. After washing, 100 microliter of BCIP/NBT solution provided by the kit is added for development. And covering the well plate with tinfoil paper in the developing period, keeping the well plate in the dark, and standing for 5-15 minutes. Spots on the developing plate were routinely detected during this period to determine the optimum time for terminating the reaction. The BCIP/NBT solution was removed and the well plate was rinsed with double-distilled water to stop the development reaction, spun-dried, then the bottom of the well plate was removed, the well plate was dried at room temperature until each well was completely dried, and then the spots formed in the bottom film of the well plate were counted using an immune spot plate counter (CTL, cell Technology Limited).
Results
The TCR transduced T cells of the invention were tested for IFN- γ release in response to target cells loaded with LMP1 antigen short peptide MLWRLGATI by ELISPOT assay (as described above). The number of ELSPOT spots observed in each well was plotted using a graphipad prism 6.
As shown in FIG. 8, T cells transduced with the TCR of the invention were shown to be very active against target cells loaded with their specific short peptides, whereas T cells not transduced with the TCR of the invention were shown to be essentially non-active.
Example 7 killing of cells transduced with a TCR of the invention
This example demonstrates the killing function of cells transduced with the TCR of the invention by measuring LDH release by non-radioactive cytotoxicity assays. This test is a colorimetric substitution test for the 51Cr release cytotoxicity test, and quantitatively determines Lactate Dehydrogenase (LDH) released after cell lysis. LDH released in the medium was detected using a 30 min coupled enzymatic reaction in which LDH converted a tetrazolium salt (INT) to red formazan (formazan). The amount of red product produced is proportional to the number of cells lysed. 490nm visible absorbance data can be collected using a standard 96-well plate reader.
Methods for detecting cell function using LDH release assays are well known to those skilled in the art. The effector cells (T cells) of this example were CD8+ T cells expressing the short peptide-specific TCR of the LMP1 antigen of the invention analyzed by flow cytometry in example 5, and the target cell lines were IM9, MEL526 and MDA-MB-231. According to nanostring results, wherein IM9 expresses LMP1 antigen, MEL526 and MDA-MB-231 do not substantially express LMP1 antigen, and the control is performed. Meanwhile, GFP-transduced CD8+ T cells were also used as controls. The ratio of effector cells to target cells (effector-target ratio) in this experiment was 1:1, 3:1 and 5:1, respectively.
LDH plates were first prepared. On day 1 of the experiment, the components of the experiment were added to the plate in the following order: medium regulates Effector cells to 2X106Individual cells/ml, media adjusted each target cell line to 5X105Individual cells/ml. Mixing well, and collecting 100 μ L of target cell line 5X105One cell/ml (i.e., 50,000 cells/well), 100 μ L effector cell 2X106One cell/ml (i.e., 200,000 cells/well) was added to the corresponding well and three replicate wells were set. Meanwhile, an effector cell spontaneous hole, a target cell maximum hole, a volume correction control hole and a culture medium background control hole are arranged. Incubation overnight (37 ℃, 5% CO)2). On day 2 of the experiment, color development was detected, and after termination of the reaction, the absorbance was recorded at 490nm using a microplate reader (Bioteck). The results of the experiments are shown in FIG. 9, in which the curve IM9-GFP is the response of GFP-transduced effector cells to the IM9 cell line; curve MEL526-GFP is the response of GFP-transduced effector cells to MEL526 cell line; curve MDA-MB-231-GFP is the response of GFP-transduced effector cells to the MDA-MB-231 cell line; similarly, the IM9-TCR is the response of effector cells transducing the TCR of the invention to the IM9 cell line; curve MEL526-TCR response of effector cells transducing the TCR of the invention to MEL526 cell line; the curve MDA-MB-231-TCR is the response of effector cells transducing the TCR of the invention to the MDA-MB-231 cell line; as can be seen from the results, effector cells transduced with the TCRs of the invention have a killing effect on target cells expressing the relevant antigen, while there is essentially no killing effect on target cells not expressing the relevant antigen.
All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.
Sequence listing
<110> Guangzhou Xiangxue pharmaceutical products Co., Ltd
<120> a TCR recognizing short peptide originated from LMP1 antigen
<130> P2017-0372
<160> 29
<170> PatentIn version 3.5
<210> 1
<211> 113
<212> PRT
<213> Artificial sequence e
<220>
<223> TCR alpha chain variable Domain
<400> 1
Gly Asn Ser Val Thr Gln Met Glu Gly Pro Val Thr Leu Ser Glu Glu
1 5 10 15
Ala Phe Leu Thr Ile Asn Cys Thr Tyr Thr Ala Thr Gly Tyr Pro Ser
20 25 30
Leu Phe Trp Tyr Val Gln Tyr Pro Gly Glu Gly Leu Gln Leu Leu Leu
35 40 45
Lys Ala Thr Lys Ala Asp Asp Lys Gly Ser Asn Lys Gly Phe Glu Ala
50 55 60
Thr Tyr Arg Lys Glu Thr Thr Ser Phe His Leu Glu Lys Gly Ser Val
65 70 75 80
Gln Val Ser Asp Ser Ala Val Tyr Phe Cys Ala Leu Ala Gly Asp Ser
85 90 95
Asn Tyr Gln Leu Ile Trp Gly Ala Gly Thr Lys Leu Ile Ile Lys Pro
100 105 110
Asp
<210> 2
<211> 339
<212> DNA
<213> Artificial sequence e
<220>
<223> TCR alpha chain variable Domain
<400> 2
ggaaattcag tgacccagat ggaagggcca gtgactctct cagaagaggc cttcctgact 60
ataaactgca cgtacacagc cacaggatac ccttcccttt tctggtatgt ccaatatcct 120
ggagaaggtc tacagctcct cctgaaagcc acgaaggctg atgacaaggg aagcaacaaa 180
ggttttgaag ccacataccg taaagaaacc acttctttcc acttggagaa aggctcagtt 240
caagtgtcag actcagcggt gtacttctgt gctctggcgg gggatagcaa ctatcagtta 300
atctggggcg ctgggaccaa gctaattata aagccagat 339
<210> 3
<211> 253
<212> PRT
<213> Artificial sequence e
<220>
<223> TCR alpha chain
<400> 3
Gly Asn Ser Val Thr Gln Met Glu Gly Pro Val Thr Leu Ser Glu Glu
1 5 10 15
Ala Phe Leu Thr Ile Asn Cys Thr Tyr Thr Ala Thr Gly Tyr Pro Ser
20 25 30
Leu Phe Trp Tyr Val Gln Tyr Pro Gly Glu Gly Leu Gln Leu Leu Leu
35 40 45
Lys Ala Thr Lys Ala Asp Asp Lys Gly Ser Asn Lys Gly Phe Glu Ala
50 55 60
Thr Tyr Arg Lys Glu Thr Thr Ser Phe His Leu Glu Lys Gly Ser Val
65 70 75 80
Gln Val Ser Asp Ser Ala Val Tyr Phe Cys Ala Leu Ala Gly Asp Ser
85 90 95
Asn Tyr Gln Leu Ile Trp Gly Ala Gly Thr Lys Leu Ile Ile Lys Pro
100 105 110
Asp Ile Gln Asn Pro Asp Pro Ala Val Tyr Gln Leu Arg Asp Ser Lys
115 120 125
Ser Ser Asp Lys Ser Val Cys Leu Phe Thr Asp Phe Asp Ser Gln Thr
130 135 140
Asn Val Ser Gln Ser Lys Asp Ser Asp Val Tyr Ile Thr Asp Lys Thr
145 150 155 160
Val Leu Asp Met Arg Ser Met Asp Phe Lys Ser Asn Ser Ala Val Ala
165 170 175
Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala Phe Asn Asn Ser
180 185 190
Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu Ser Ser Cys Asp
195 200 205
Val Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr Asn Leu Asn Phe
210 215 220
Gln Asn Leu Ser Val Ile Gly Phe Arg Ile Leu Leu Leu Lys Val Ala
225 230 235 240
Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser Ser
245 250
<210> 4
<211> 759
<212> DNA
<213> Artificial sequence e
<220>
<223> TCR alpha chain
<400> 4
ggaaattcag tgacccagat ggaagggcca gtgactctct cagaagaggc cttcctgact 60
ataaactgca cgtacacagc cacaggatac ccttcccttt tctggtatgt ccaatatcct 120
ggagaaggtc tacagctcct cctgaaagcc acgaaggctg atgacaaggg aagcaacaaa 180
ggttttgaag ccacataccg taaagaaacc acttctttcc acttggagaa aggctcagtt 240
caagtgtcag actcagcggt gtacttctgt gctctggcgg gggatagcaa ctatcagtta 300
atctggggcg ctgggaccaa gctaattata aagccagata tccagaaccc tgaccctgcc 360
gtgtaccagc tgagagactc taaatccagt gacaagtctg tctgcctatt caccgatttt 420
gattctcaaa caaatgtgtc acaaagtaag gattctgatg tgtatatcac agacaaaact 480
gtgctagaca tgaggtctat ggacttcaag agcaacagtg ctgtggcctg gagcaacaaa 540
tctgactttg catgtgcaaa cgccttcaac aacagcatta ttccagaaga caccttcttc 600
cccagcccag aaagttcctg tgatgtcaag ctggtcgaga aaagctttga aacagatacg 660
aacctaaact ttcaaaacct gtcagtgatt gggttccgaa tcctcctcct gaaagtggcc 720
gggtttaatc tgctcatgac gctgcggctg tggtccagc 759
<210> 5
<211> 118
<212> PRT
<213> Artificial sequence e
<220>
<223> TCR beta chain variable domain
<400> 5
Asp Val Lys Val Thr Gln Ser Ser Arg Tyr Leu Val Lys Arg Thr Gly
1 5 10 15
Glu Lys Val Phe Leu Glu Cys Val Gln Asp Met Asp His Glu Asn Met
20 25 30
Phe Trp Tyr Arg Gln Asp Pro Gly Leu Gly Leu Arg Leu Ile Tyr Phe
35 40 45
Ser Tyr Asp Val Lys Met Lys Glu Lys Gly Asp Ile Pro Glu Gly Tyr
50 55 60
Ser Val Ser Arg Glu Lys Lys Glu Arg Phe Ser Leu Ile Leu Glu Ser
65 70 75 80
Ala Ser Thr Asn Gln Thr Ser Met Tyr Leu Cys Ala Ser Ser Ser Leu
85 90 95
Phe Ile Glu Met Asp Pro Val Asn Glu Lys Leu Phe Phe Gly Ser Gly
100 105 110
Thr Gln Leu Ser Val Leu
115
<210> 6
<211> 354
<212> DNA
<213> Artificial sequence e
<220>
<223> TCR beta chain variable domain
<400> 6
gatgtgaaag taacccagag ctcgagatat ctagtcaaaa ggacgggaga gaaagttttt 60
ctggaatgtg tccaggatat ggaccatgaa aatatgttct ggtatcgaca agacccaggt 120
ctggggctac ggctgatcta tttctcatat gatgttaaaa tgaaagaaaa aggagatatt 180
cctgaggggt acagtgtctc tagagagaag aaggagcgct tctccctgat tctggagtcc 240
gccagcacca accagacatc tatgtacctc tgtgccagca gttccctttt tatagaaatg 300
gaccccgtta atgaaaaact gttttttggc agtggaaccc agctctctgt cttg 354
<210> 7
<211> 295
<212> PRT
<213> Artificial sequence e
<220>
<223> TCR beta chain
<400> 7
Asp Val Lys Val Thr Gln Ser Ser Arg Tyr Leu Val Lys Arg Thr Gly
1 5 10 15
Glu Lys Val Phe Leu Glu Cys Val Gln Asp Met Asp His Glu Asn Met
20 25 30
Phe Trp Tyr Arg Gln Asp Pro Gly Leu Gly Leu Arg Leu Ile Tyr Phe
35 40 45
Ser Tyr Asp Val Lys Met Lys Glu Lys Gly Asp Ile Pro Glu Gly Tyr
50 55 60
Ser Val Ser Arg Glu Lys Lys Glu Arg Phe Ser Leu Ile Leu Glu Ser
65 70 75 80
Ala Ser Thr Asn Gln Thr Ser Met Tyr Leu Cys Ala Ser Ser Ser Leu
85 90 95
Phe Ile Glu Met Asp Pro Val Asn Glu Lys Leu Phe Phe Gly Ser Gly
100 105 110
Thr Gln Leu Ser Val Leu Glu Asp Leu Asn Lys Val Phe Pro Pro Glu
115 120 125
Val Ala Val Phe Glu Pro Ser Glu Ala Glu Ile Ser His Thr Gln Lys
130 135 140
Ala Thr Leu Val Cys Leu Ala Thr Gly Phe Phe Pro Asp His Val Glu
145 150 155 160
Leu Ser Trp Trp Val Asn Gly Lys Glu Val His Ser Gly Val Ser Thr
165 170 175
Asp Pro Gln Pro Leu Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr
180 185 190
Cys Leu Ser Ser Arg Leu Arg Val Ser Ala Thr Phe Trp Gln Asn Pro
195 200 205
Arg Asn His Phe Arg Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn
210 215 220
Asp Glu Trp Thr Gln Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser
225 230 235 240
Ala Glu Ala Trp Gly Arg Ala Asp Cys Gly Phe Thr Ser Val Ser Tyr
245 250 255
Gln Gln Gly Val Leu Ser Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly
260 265 270
Lys Ala Thr Leu Tyr Ala Val Leu Val Ser Ala Leu Val Leu Met Ala
275 280 285
Met Val Lys Arg Lys Asp Phe
290 295
<210> 8
<211> 885
<212> DNA
<213> Artificial sequence e
<220>
<223> TCR beta chain
<400> 8
gatgtgaaag taacccagag ctcgagatat ctagtcaaaa ggacgggaga gaaagttttt 60
ctggaatgtg tccaggatat ggaccatgaa aatatgttct ggtatcgaca agacccaggt 120
ctggggctac ggctgatcta tttctcatat gatgttaaaa tgaaagaaaa aggagatatt 180
cctgaggggt acagtgtctc tagagagaag aaggagcgct tctccctgat tctggagtcc 240
gccagcacca accagacatc tatgtacctc tgtgccagca gttccctttt tatagaaatg 300
gaccccgtta atgaaaaact gttttttggc agtggaaccc agctctctgt cttggaggac 360
ctgaacaagg tgttcccacc cgaggtcgct gtgtttgagc catcagaagc agagatctcc 420
cacacccaaa aggccacact ggtgtgcctg gccacaggct tcttccccga ccacgtggag 480
ctgagctggt gggtgaatgg gaaggaggtg cacagtgggg tcagcacgga cccgcagccc 540
ctcaaggagc agcccgccct caatgactcc agatactgcc tgagcagccg cctgagggtc 600
tcggccacct tctggcagaa cccccgcaac cacttccgct gtcaagtcca gttctacggg 660
ctctcggaga atgacgagtg gacccaggat agggccaaac ccgtcaccca gatcgtcagc 720
gccgaggcct ggggtagagc agactgtggc tttacctcgg tgtcctacca gcaaggggtc 780
ctgtctgcca ccatcctcta tgagatcctg ctagggaagg ccaccctgta tgctgtgctg 840
gtcagcgccc ttgtgttgat ggccatggtc aagagaaagg atttc 885
<210> 9
<211> 9
<212> PRT
<213> Artificial sequence e
<220>
<223> antigen short peptide
<400> 9
Met Leu Trp Arg Leu Gly Ala Thr Ile
1 5
<210> 10
<211> 6
<212> PRT
<213> Artificial sequence e
<220>
<223> α CDR1
<400> 10
Ala Thr Gly Tyr Pro Ser
1 5
<210> 11
<211> 7
<212> PRT
<213> Artificial sequence e
<220>
<223> α CDR2
<400> 11
Ala Thr Lys Ala Asp Asp Lys
1 5
<210> 12
<211> 11
<212> PRT
<213> Artificial sequence e
<220>
<223> α CDR3
<400> 12
Ala Leu Ala Gly Asp Ser Asn Tyr Gln Leu Ile
1 5 10
<210> 13
<211> 5
<212> PRT
<213> Artificial sequence e
<220>
<223> β CDR1
<400> 13
Met Asp His Glu Asn
1 5
<210> 14
<211> 6
<212> PRT
<213> Artificial sequence e
<220>
<223> β CDR2
<400> 14
Ser Tyr Asp Val Lys Met
1 5
<210> 15
<211> 17
<212> PRT
<213> Artificial sequence e
<220>
<223> β CDR3
<400> 15
Ala Ser Ser Ser Leu Phe Ile Glu Met Asp Pro Val Asn Glu Lys Leu
1 5 10 15
Phe
<210> 16
<211> 18
<212> DNA
<213> Artificial sequence e
<220>
<223> α CDR1
<400> 16
gccacaggat acccttcc 18
<210> 17
<211> 21
<212> DNA
<213> Artificial sequence e
<220>
<223> α CDR2
<400> 17
gccacgaagg ctgatgacaa g 21
<210> 18
<211> 33
<212> DNA
<213> Artificial sequence e
<220>
<223> α CDR3
<400> 18
gctctggcgg gggatagcaa ctatcagtta atc 33
<210> 19
<211> 15
<212> DNA
<213> Artificial sequence e
<220>
<223> β CDR1
<400> 19
atggaccatg aaaat 15
<210> 20
<211> 18
<212> DNA
<213> Artificial sequence e
<220>
<223> β CDR2
<400> 20
tcatatgatg ttaaaatg 18
<210> 21
<211> 51
<212> DNA
<213> Artificial sequence e
<220>
<223> β CDR3
<400> 21
gccagcagtt ccctttttat agaaatggac cccgttaatg aaaaactgtt t 51
<210> 22
<211> 272
<212> PRT
<213> Artificial sequence e
<220>
<223> TCR alpha chain having leader sequence
<400> 22
Met Asn Tyr Ser Pro Gly Leu Val Ser Leu Ile Leu Leu Leu Leu Gly
1 5 10 15
Arg Thr Arg Gly Asn Ser Val Thr Gln Met Glu Gly Pro Val Thr Leu
20 25 30
Ser Glu Glu Ala Phe Leu Thr Ile Asn Cys Thr Tyr Thr Ala Thr Gly
35 40 45
Tyr Pro Ser Leu Phe Trp Tyr Val Gln Tyr Pro Gly Glu Gly Leu Gln
50 55 60
Leu Leu Leu Lys Ala Thr Lys Ala Asp Asp Lys Gly Ser Asn Lys Gly
65 70 75 80
Phe Glu Ala Thr Tyr Arg Lys Glu Thr Thr Ser Phe His Leu Glu Lys
85 90 95
Gly Ser Val Gln Val Ser Asp Ser Ala Val Tyr Phe Cys Ala Leu Ala
100 105 110
Gly Asp Ser Asn Tyr Gln Leu Ile Trp Gly Ala Gly Thr Lys Leu Ile
115 120 125
Ile Lys Pro Asp Ile Gln Asn Pro Asp Pro Ala Val Tyr Gln Leu Arg
130 135 140
Asp Ser Lys Ser Ser Asp Lys Ser Val Cys Leu Phe Thr Asp Phe Asp
145 150 155 160
Ser Gln Thr Asn Val Ser Gln Ser Lys Asp Ser Asp Val Tyr Ile Thr
165 170 175
Asp Lys Thr Val Leu Asp Met Arg Ser Met Asp Phe Lys Ser Asn Ser
180 185 190
Ala Val Ala Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala Phe
195 200 205
Asn Asn Ser Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu Ser
210 215 220
Ser Cys Asp Val Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr Asn
225 230 235 240
Leu Asn Phe Gln Asn Leu Ser Val Ile Gly Phe Arg Ile Leu Leu Leu
245 250 255
Lys Val Ala Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser Ser
260 265 270
<210> 23
<211> 816
<212> DNA
<213> Artificial sequence e
<220>
<223> TCR alpha chain having leader sequence
<400> 23
atgaactatt ctccaggctt agtatctctg atactcttac tgcttggaag aacccgtgga 60
aattcagtga cccagatgga agggccagtg actctctcag aagaggcctt cctgactata 120
aactgcacgt acacagccac aggataccct tcccttttct ggtatgtcca atatcctgga 180
gaaggtctac agctcctcct gaaagccacg aaggctgatg acaagggaag caacaaaggt 240
tttgaagcca cataccgtaa agaaaccact tctttccact tggagaaagg ctcagttcaa 300
gtgtcagact cagcggtgta cttctgtgct ctggcggggg atagcaacta tcagttaatc 360
tggggcgctg ggaccaagct aattataaag ccagatatcc agaaccctga ccctgccgtg 420
taccagctga gagactctaa atccagtgac aagtctgtct gcctattcac cgattttgat 480
tctcaaacaa atgtgtcaca aagtaaggat tctgatgtgt atatcacaga caaaactgtg 540
ctagacatga ggtctatgga cttcaagagc aacagtgctg tggcctggag caacaaatct 600
gactttgcat gtgcaaacgc cttcaacaac agcattattc cagaagacac cttcttcccc 660
agcccagaaa gttcctgtga tgtcaagctg gtcgagaaaa gctttgaaac agatacgaac 720
ctaaactttc aaaacctgtc agtgattggg ttccgaatcc tcctcctgaa agtggccggg 780
tttaatctgc tcatgacgct gcggctgtgg tccagc 816
<210> 24
<211> 314
<212> PRT
<213> Artificial sequence e
<220>
<223> TCR beta chain having leader sequence
<400> 24
Met Gly Ile Arg Leu Leu Cys Arg Val Ala Phe Cys Phe Leu Ala Val
1 5 10 15
Gly Leu Val Asp Val Lys Val Thr Gln Ser Ser Arg Tyr Leu Val Lys
20 25 30
Arg Thr Gly Glu Lys Val Phe Leu Glu Cys Val Gln Asp Met Asp His
35 40 45
Glu Asn Met Phe Trp Tyr Arg Gln Asp Pro Gly Leu Gly Leu Arg Leu
50 55 60
Ile Tyr Phe Ser Tyr Asp Val Lys Met Lys Glu Lys Gly Asp Ile Pro
65 70 75 80
Glu Gly Tyr Ser Val Ser Arg Glu Lys Lys Glu Arg Phe Ser Leu Ile
85 90 95
Leu Glu Ser Ala Ser Thr Asn Gln Thr Ser Met Tyr Leu Cys Ala Ser
100 105 110
Ser Ser Leu Phe Ile Glu Met Asp Pro Val Asn Glu Lys Leu Phe Phe
115 120 125
Gly Ser Gly Thr Gln Leu Ser Val Leu Glu Asp Leu Asn Lys Val Phe
130 135 140
Pro Pro Glu Val Ala Val Phe Glu Pro Ser Glu Ala Glu Ile Ser His
145 150 155 160
Thr Gln Lys Ala Thr Leu Val Cys Leu Ala Thr Gly Phe Phe Pro Asp
165 170 175
His Val Glu Leu Ser Trp Trp Val Asn Gly Lys Glu Val His Ser Gly
180 185 190
Val Ser Thr Asp Pro Gln Pro Leu Lys Glu Gln Pro Ala Leu Asn Asp
195 200 205
Ser Arg Tyr Cys Leu Ser Ser Arg Leu Arg Val Ser Ala Thr Phe Trp
210 215 220
Gln Asn Pro Arg Asn His Phe Arg Cys Gln Val Gln Phe Tyr Gly Leu
225 230 235 240
Ser Glu Asn Asp Glu Trp Thr Gln Asp Arg Ala Lys Pro Val Thr Gln
245 250 255
Ile Val Ser Ala Glu Ala Trp Gly Arg Ala Asp Cys Gly Phe Thr Ser
260 265 270
Val Ser Tyr Gln Gln Gly Val Leu Ser Ala Thr Ile Leu Tyr Glu Ile
275 280 285
Leu Leu Gly Lys Ala Thr Leu Tyr Ala Val Leu Val Ser Ala Leu Val
290 295 300
Leu Met Ala Met Val Lys Arg Lys Asp Phe
305 310
<210> 25
<211> 942
<212> DNA
<213> Artificial sequence e
<220>
<223> TCR beta chain having leader sequence
<400> 25
atgggaatca ggctcctctg tcgtgtggcc ttttgtttcc tggctgtagg cctcgtagat 60
gtgaaagtaa cccagagctc gagatatcta gtcaaaagga cgggagagaa agtttttctg 120
gaatgtgtcc aggatatgga ccatgaaaat atgttctggt atcgacaaga cccaggtctg 180
gggctacggc tgatctattt ctcatatgat gttaaaatga aagaaaaagg agatattcct 240
gaggggtaca gtgtctctag agagaagaag gagcgcttct ccctgattct ggagtccgcc 300
agcaccaacc agacatctat gtacctctgt gccagcagtt ccctttttat agaaatggac 360
cccgttaatg aaaaactgtt ttttggcagt ggaacccagc tctctgtctt ggaggacctg 420
aacaaggtgt tcccacccga ggtcgctgtg tttgagccat cagaagcaga gatctcccac 480
acccaaaagg ccacactggt gtgcctggcc acaggcttct tccccgacca cgtggagctg 540
agctggtggg tgaatgggaa ggaggtgcac agtggggtca gcacggaccc gcagcccctc 600
aaggagcagc ccgccctcaa tgactccaga tactgcctga gcagccgcct gagggtctcg 660
gccaccttct ggcagaaccc ccgcaaccac ttccgctgtc aagtccagtt ctacgggctc 720
tcggagaatg acgagtggac ccaggatagg gccaaacccg tcacccagat cgtcagcgcc 780
gaggcctggg gtagagcaga ctgtggcttt acctcggtgt cctaccagca aggggtcctg 840
tctgccacca tcctctatga gatcctgcta gggaaggcca ccctgtatgc tgtgctggtc 900
agcgcccttg tgttgatggc catggtcaag agaaaggatt tc 942
<210> 26
<211> 206
<212> PRT
<213> Artificial sequence e
<220>
<223> soluble TCR alpha chain
<400> 26
Gly Asn Ser Val Thr Gln Met Glu Gly Pro Val Thr Leu Ser Glu Glu
1 5 10 15
Ala Phe Leu Thr Ile Asn Cys Thr Tyr Thr Ala Thr Gly Tyr Pro Ser
20 25 30
Leu Phe Trp Tyr Val Gln Tyr Pro Gly Glu Gly Leu Gln Leu Leu Leu
35 40 45
Lys Ala Thr Lys Ala Asp Asp Lys Gly Ser Asn Lys Gly Phe Glu Ala
50 55 60
Thr Tyr Arg Lys Glu Thr Thr Ser Phe His Leu Glu Lys Gly Ser Val
65 70 75 80
Gln Val Ser Asp Ser Ala Val Tyr Phe Cys Ala Leu Ala Gly Asp Ser
85 90 95
Asn Tyr Gln Leu Ile Trp Gly Ala Gly Thr Lys Leu Ile Ile Lys Pro
100 105 110
Asp Ile Gln Asn Pro Asp Pro Ala Val Tyr Gln Leu Arg Asp Ser Lys
115 120 125
Ser Ser Asp Lys Ser Val Cys Leu Phe Thr Asp Phe Asp Ser Gln Thr
130 135 140
Asn Val Ser Gln Ser Lys Asp Ser Asp Val Tyr Ile Thr Asp Lys Cys
145 150 155 160
Val Leu Asp Met Arg Ser Met Asp Phe Lys Ser Asn Ser Ala Val Ala
165 170 175
Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala Phe Asn Asn Ser
180 185 190
Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu Ser Ser
195 200 205
<210> 27
<211> 618
<212> DNA
<213> Artificial sequence e
<220>
<223> soluble TCR alpha chain
<400> 27
ggcaacagcg tgacccagat ggaagggcca gtgactctct cagaagaggc cttcctgact 60
ataaactgca cgtacacagc cacaggatac ccttcccttt tctggtatgt ccaatatcct 120
ggagaaggtc tacagctcct cctgaaagcc acgaaggctg atgacaaggg aagcaacaaa 180
ggttttgaag ccacataccg taaagaaacc acttctttcc acttggagaa aggctcagtt 240
caagtgtcag actcagcggt gtacttctgt gctctggcgg gggatagcaa ctatcagtta 300
atctggggcg ctgggaccaa gctaattata aagccagata tccagaaccc tgaccctgcc 360
gtgtaccagc tgagagactc taagtcgagt gacaagtctg tctgcctatt caccgatttt 420
gattctcaaa caaatgtgtc acaaagtaag gattctgatg tgtatatcac agacaaatgt 480
gtgctagaca tgaggtctat ggacttcaag agcaacagtg ctgtggcctg gagcaacaaa 540
tctgactttg catgtgcaaa cgccttcaac aacagcatta ttccagaaga caccttcttc 600
cccagcccag aaagttcc 618
<210> 28
<211> 248
<212> PRT
<213> Artificial sequence e
<220>
<223> soluble TCR beta chain
<400> 28
Asp Val Lys Val Thr Gln Ser Ser Arg Tyr Leu Val Lys Arg Thr Gly
1 5 10 15
Glu Lys Val Phe Leu Glu Cys Val Gln Asp Met Asp His Glu Asn Met
20 25 30
Phe Trp Tyr Arg Gln Asp Pro Gly Leu Gly Leu Arg Leu Ile Tyr Phe
35 40 45
Ser Tyr Asp Val Lys Met Lys Glu Lys Gly Asp Ile Pro Glu Gly Tyr
50 55 60
Ser Val Ser Arg Glu Lys Lys Glu Arg Phe Ser Leu Ile Leu Glu Ser
65 70 75 80
Ala Ser Thr Asn Gln Thr Ser Met Tyr Leu Cys Ala Ser Ser Ser Leu
85 90 95
Phe Ile Glu Met Asp Pro Val Asn Glu Lys Leu Phe Phe Gly Ser Gly
100 105 110
Thr Gln Leu Ser Val Leu Glu Asp Leu Lys Asn Val Phe Pro Pro Glu
115 120 125
Val Ala Val Phe Glu Pro Ser Glu Ala Glu Ile Ser His Thr Gln Lys
130 135 140
Ala Thr Leu Val Cys Leu Ala Thr Gly Phe Tyr Pro Asp His Val Glu
145 150 155 160
Leu Ser Trp Trp Val Asn Gly Lys Glu Val His Ser Gly Val Cys Thr
165 170 175
Asp Pro Gln Pro Leu Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr
180 185 190
Ala Leu Ser Ser Arg Leu Arg Val Ser Ala Thr Phe Trp Gln Asp Pro
195 200 205
Arg Asn His Phe Arg Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn
210 215 220
Asp Glu Trp Thr Gln Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser
225 230 235 240
Ala Glu Ala Trp Gly Arg Ala Asp
245
<210> 29
<211> 744
<212> DNA
<213> Artificial sequence e
<220>
<223> soluble TCR beta chain
<400> 29
gatgtgaaag taacccagag ctcgagatat ctagtcaaaa ggacgggaga gaaagttttt 60
ctggaatgtg tccaggatat ggaccatgaa aatatgttct ggtatcgaca agacccaggt 120
ctggggctac ggctgatcta tttctcatat gatgttaaaa tgaaagaaaa aggagatatt 180
cctgaggggt acagtgtctc tagagagaag aaggagcgct tctccctgat tctggagtcc 240
gccagcacca accagacatc tatgtacctc tgtgccagca gttccctttt tatagaaatg 300
gaccccgtta atgaaaaact gttttttggc agtggaaccc agctctctgt cttggaggac 360
ctgaaaaacg tgttcccacc cgaggtcgct gtgtttgagc catcagaagc agagatctcc 420
cacacccaaa aggccacact ggtgtgcctg gccaccggtt tctaccccga ccacgtggag 480
ctgagctggt gggtgaatgg gaaggaggtg cacagtgggg tctgcacaga cccgcagccc 540
ctcaaggagc agcccgccct caatgactcc agatacgctc tgagcagccg cctgagggtc 600
tcggccacct tctggcagga cccccgcaac cacttccgct gtcaagtcca gttctacggg 660
ctctcggaga atgacgagtg gacccaggat agggccaaac ccgtcaccca gatcgtcagc 720
gccgaggcct ggggtagagc agac 744

Claims (35)

1. A T Cell Receptor (TCR), said TCR capable of binding to the MLWRLGATI-HLA A0201 complex, said TCR comprising a TCR alpha chain variable domain and a TCR beta chain variable domain and,
the 3 Complementarity Determining Regions (CDRs) of the TCR α chain variable domain are:
α CDR1- ATGYPS (SEQ ID NO: 10)
α CDR2- ATKADDK (SEQ ID NO: 11)
alpha CDR3-ALAGDSNYQLI (SEQ ID NO: 12); and
the 3 complementarity determining regions of the TCR β chain variable domain are:
β CDR1- MDHEN (SEQ ID NO: 13)
β CDR2- SYDVKM (SEQ ID NO: 14)
β CDR3- ASSSLFIEMDPVNEKLF (SEQ ID NO: 15)。
2. a TCR as claimed in claim 1 wherein the TCR α chain variable domain is an amino acid sequence having at least 90% sequence identity to SEQ ID No. 1.
3. A TCR as claimed in claim 1 wherein the TCR β chain variable domain is substantially identical to SEQ ID NO:5 an amino acid sequence having at least 90% sequence identity.
4. A TCR as claimed in claim 1 which comprises the α chain variable domain amino acid sequence SEQ ID NO 1.
5. A TCR as claimed in claim 1 which comprises the β chain variable domain amino acid sequence SEQ ID NO 5.
6. A TCR as claimed in claim 1 which is an α β heterodimer comprising a TCR α chain constant region TRAC 01 and a TCR β chain constant region TRBC1 01 or TRBC2 01.
7. A TCR as claimed in claim 6 wherein the α chain amino acid sequence of the TCR is SEQ ID NO:3 and/or the beta chain amino acid sequence of the TCR is SEQ ID NO 7.
8. A TCR as claimed in any one of claims 1 to 5 which is soluble.
9. A TCR as claimed in claim 8 which is single chain.
10. A TCR as claimed in claim 9 which is formed by the α chain variable domain linked to the β chain variable domain by a peptide linker sequence.
11. A TCR as claimed in claim 10 which has one or more mutations in amino acid 11, 13, 19, 21, 53, 76, 89, 91 or 94 of the α chain variable region and/or in the penultimate 3,5 or 7 position of the short peptide amino acid of the α chain J gene; and/or the TCR has one or more mutations in beta chain variable region amino acid 11, 13, 19, 21, 53, 76, 89, 91, or 94 th, and/or beta chain J gene short peptide amino acid penultimate 2,4 or 6 th, wherein the amino acid position numbering is according to the position numbering listed in IMGT (international immunogenetic information system).
12. A TCR as claimed in claim 8 which comprises (a) all or part of the TCR α chain, excluding the transmembrane domain; and (b) all or part of a TCR β chain, excluding the transmembrane domain;
and (a) and (b) each comprise a functional variable domain.
13. A TCR as claimed in claim 12 wherein (a) and (b) each further comprise at least a portion of the constant domain of the TCR chain.
14. A TCR as claimed in claim 13 wherein the cysteine residues form an artificial disulphide bond between the α and β chain constant domains of the TCR.
15. A TCR as claimed in claim 14 wherein the cysteine residues which form the artificial disulphide bond in the TCR are substituted at one or more groups selected from:
thr48 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser57 of TRBC2 × 01 exon 1;
thr45 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser77 of TRBC2 × 01 exon 1;
tyr10 and TRBC1 x 01 of exon 1 of TRAC x 01 or Ser17 of exon 1 of TRBC 2x 01;
thr45 and TRBC1 × 01 of TRAC × 01 exon 1 or Asp59 of TRBC2 × 01 exon 1;
ser15 and TRBC1 × 01 of TRAC × 01 exon 1 or Glu15 of TRBC2 × 01 exon 1;
arg53 and TRBC1 × 01 of TRAC × 01 exon 1 or Ser54 of TRBC2 × 01 exon 1;
pro89 and TRBC1 and 01 of exon 1 of TRAC 01 or Ala19 of exon 1 of TRBC2 and 01; and
tyr10 and TRBC1 × 01 of exon 1 of TRAC × 01 or Glu20 of exon 1 of TRBC2 × 01.
16. A TCR as claimed in claim 15 wherein the α chain amino acid sequence of the TCR is SEQ ID No. 26 and/or the β chain amino acid sequence of the TCR is SEQ ID No. 28.
17. A TCR as claimed in claim 13 which comprises an artificial interchain disulphide bond between the α chain variable region and the β chain constant region of the TCR.
18. A TCR as claimed in claim 17 in which the cysteine residues which form the artificial interchain disulphide bond in the TCR are substituted at one or more groups selected from:
amino acid 46 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC 2x 01;
amino acid 47 of TRAV and amino acid 61 of exon 1 of TRBC1 x 01 or TRBC 2x 01;
amino acid 46 of TRAV and amino acid 61 of TRBC1 x 01 or TRBC 2x 01 exon 1; or
Amino acid 47 of TRAV and amino acid 60 of exon 1 of TRBC1 x 01 or TRBC 2x 01.
19. A TCR as claimed in claim 17 or claim 18 which comprises the α chain variable domain and the β chain variable domain and all or part of the β chain constant domain, excluding the transmembrane domain, but which does not comprise the α chain constant domain, the α chain variable domain of the TCR forming a heterodimer with the β chain.
20. A TCR as claimed in claim 1 wherein a conjugate is attached to the C-or N-terminus of the α and/or β chains of the TCR.
21. A TCR as claimed in claim 20 wherein the conjugate to which the TCR is bound is a detectable label, a therapeutic agent, a PK modifying moiety or a combination thereof.
22. A TCR as claimed in claim 21 wherein the therapeutic agent is an anti-CD 3 antibody.
23. A multivalent TCR complex comprising at least two TCR molecules, and wherein at least one TCR molecule is a TCR as claimed in any one of claims 1 to 22.
24. A nucleic acid molecule comprising a nucleic acid sequence encoding a TCR according to any one of claims 1 to 22, or the complement thereof.
25. The nucleic acid molecule of claim 24, wherein said nucleic acid molecule comprises the nucleotide sequence of SEQ ID NO: 2.
26. the nucleic acid molecule of claim 24 or 25, wherein said nucleic acid molecule comprises the nucleotide sequence of SEQ ID NO: 6.
27. the nucleic acid molecule of claim 24, comprising the nucleotide sequence encoding a TCR α chain of SEQ ID NO:4 and/or comprises the nucleotide sequence encoding the TCR β chain SEQ ID NO: 8.
28. a vector comprising the nucleic acid molecule of any one of claims 24 to 27.
29. The vector of claim 28, wherein said vector is a viral vector.
30. The vector of claim 29, wherein said vector is a lentiviral vector.
31. An isolated host cell comprising the vector of claim 28 or a nucleic acid molecule of any one of claims 24-27 integrated into the chromosome.
32. A cell transduced with the nucleic acid molecule of any one of claims 24 to 27 or the vector of claim 28.
33. The cell of claim 32, wherein the cell is a T cell.
34. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and a TCR according to any one of claims 1 to 22, a TCR complex according to claim 23 or a cell according to claim 32.
35. Use of a TCR as claimed in any one of claims 1 to 22 or a TCR complex as claimed in claim 23 or a cell as claimed in claim 32 in the manufacture of a medicament for the treatment of a tumour.
CN201710236979.6A 2017-04-12 2017-04-12 TCR for recognizing LMP1 antigen-derived short peptide Active CN108690130B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710236979.6A CN108690130B (en) 2017-04-12 2017-04-12 TCR for recognizing LMP1 antigen-derived short peptide

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710236979.6A CN108690130B (en) 2017-04-12 2017-04-12 TCR for recognizing LMP1 antigen-derived short peptide

Publications (2)

Publication Number Publication Date
CN108690130A CN108690130A (en) 2018-10-23
CN108690130B true CN108690130B (en) 2021-04-23

Family

ID=63843604

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710236979.6A Active CN108690130B (en) 2017-04-12 2017-04-12 TCR for recognizing LMP1 antigen-derived short peptide

Country Status (1)

Country Link
CN (1) CN108690130B (en)

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106188275A (en) * 2015-05-06 2016-12-07 广州市香雪制药股份有限公司 Identify the φt cell receptor of NY-ESO-1 antigen small peptide
CN106188274A (en) * 2015-05-06 2016-12-07 广州市香雪制药股份有限公司 Identify the φt cell receptor of RHAMM antigen small peptide
CN106519019B (en) * 2015-11-06 2018-07-03 广东香雪精准医疗技术有限公司 Identify the TCR of PRAME antigen

Also Published As

Publication number Publication date
CN108690130A (en) 2018-10-23

Similar Documents

Publication Publication Date Title
CN110950949B (en) T cell receptor for recognizing SSX2 antigen
CN107197625B (en) T cell receptor for recognizing NY-ESO-1 antigen short peptide
CN106632660B (en) TCR for recognizing NY-ESO-1 antigen short peptide
CN112646024B (en) T cell receptor for identifying KRAS mutation and coding sequence thereof
CN106749620B (en) T cell receptor for recognizing MAGE-A1 antigen short peptide
CN106831978B (en) T cell receptor recognizing PRAME antigen
CN110776562B (en) T cell receptor for identifying AFP antigen
CN110343167B (en) T cell receptor recognizing SSX2 antigen short peptide
CN110343166B (en) T cell receptor recognizing AFP antigen short peptides
CN110577591B (en) T cell receptor for identifying AFP antigen short peptide and its coding sequence
CN110272482B (en) T cell receptor recognizing PRAME antigen short peptide
CN109575121B (en) T cell receptor recognizing AFP antigen short peptides
CN113321726A (en) T cell receptor for identifying HPV
CN109251244B (en) TCR (T cell receptor) for recognizing LMP1 antigen derived from EBV (Epstein-Barr Virus) membrane protein
CN108264550B (en) TCR (T cell receptor) for recognizing PRAME (platelet-derived antigen) antigen short peptide
CN113321727B (en) T cell receptor for identifying AFP antigen short peptide and coding sequence thereof
TW202144401A (en) T cell receptor recognizing AFP
CN109251243B (en) T cell receptor for recognizing SAGE1 antigen and nucleic acid for encoding receptor
CN113072635A (en) T cell receptor for identifying HPV antigen and its coding sequence
CN107987156B (en) TCR for recognizing SAGE1 antigen short peptide
WO2021139699A1 (en) T cell receptor for recognizing afp and coding sequence thereof
CN110577590B (en) TCR capable of recognizing AFP antigen and encoding nucleic acid thereof
CN110407927B (en) TCR (T cell receptor) capable of recognizing AFP (alpha fetoprotein) antigen
CN110627894B (en) T cell receptor for recognizing NY-ESO-1 antigen short peptide and coding sequence thereof
CN109400696B (en) TCR for identifying PRAME antigen short peptide

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
TA01 Transfer of patent application right
TA01 Transfer of patent application right

Effective date of registration: 20210329

Address after: 519031 2715 office building, no.3000 Huandao East Road, Hengqin New District, Zhuhai City, Guangdong Province

Applicant after: Xiangxue Life Science Technology (Guangdong) Co.,Ltd.

Address before: 510663 No.2, jinfengyuan Road, Science City, Guangzhou hi tech Industrial Development Zone, Guangdong Province

Applicant before: GUANGZHOU XIANGXUE PHARMACEUTICAL Co.,Ltd.

GR01 Patent grant
GR01 Patent grant