CN108403711B

CN108403711B - MicroRNA for detecting and treating inflammatory bowel disease

Info

Publication number: CN108403711B
Application number: CN201710073375.4A
Authority: CN
Inventors: 詹丽杏; 宋乐乐; 常人绪; 周荣敏
Original assignee: Shanghai Institute of Nutrition and Health of CAS
Current assignee: Shanghai Institute of Nutrition and Health of CAS
Priority date: 2017-02-10
Filing date: 2017-02-10
Publication date: 2020-07-31
Anticipated expiration: 2037-02-10
Also published as: CN108403711A

Abstract

The invention relates to microRNA for detecting and treating inflammatory bowel diseases. The invention discloses miRNA directly involved in enteritis, a pharmaceutical composition using the miRNA as an active component, and application of the miRNA.

Description

MicroRNA for detecting and treating inflammatory bowel disease

Technical Field

The invention relates to the field of biomedicine, in particular to microRNA for detecting and treating colitis.

Background

Inflammatory bowel disease, including crohn's disease and ulcerative colitis, is a group of diseases characterized by intestinal inflammation. Wherein, Crohn's disease can occur in any part of the gastrointestinal tract, but preferably in the terminal ileum and right colon; ulcerative colitis lesions are localized to the mucosa and submucosa of the large intestine, and most are located in the sigmoid colon and rectum. The etiology of inflammatory bowel disease is not well understood at present, but arises primarily from a complex interaction between host factors and external factors, including aspects such as the intestinal microbial system, the immune system, the Suzhuder genetic composition, and specific environmental factors. Nearly 400 million people worldwide suffer from conservative Crohn's disease and ulcerative colitis, and the incidence of inflammatory bowel disease in China has increased remarkably in recent years.

Inflammatory bowel disease is often closely related to intestinal cancer associated with enteritis. Only about 20% of colon cancers can be attributed to family genetic mutations, so besides genetic factors, various factors in the environment are most likely to be risk factors for promoting the occurrence and development of the colon cancers. Studies have shown that ulcerative colitis increases the risk of patients suffering from colon cancer by 18-20%, whereas crohn's disease increases the risk of suffering from colon cancer by 8%. The probability of a patient suffering from colon cancer is closely related to the type of inflammatory bowel disease, the degree of inflammation, the duration of the disease, and the treatment history of anti-inflammatory drugs. Thus, uncontrolled inflammation of the intestinal tract is an important factor in promoting colon cancer development.

MicroRNA (miR or miRNA, micro RNA) is a single-stranded RNA molecule which is widely existed in higher eukaryotes and has the length of about 18-26 clips. It can specifically bind to target sites on some miRNAs through the base pairing principle to cause degradation or translational inhibition of target mRNAs, and then regulate and control target genes at the post-transcriptional level.

microRNA is derived from a long-chain RNA initial transcription product (Pri-miRNA) with the length of about 1000bp, and the Pri-miRNA is cut in a cell nucleus by Drosha enzyme to form a miRNA precursor (Pre-miRNA) with a stem-loop structure and the length of about 60-80 nt. After Pre-miRNA is transported to the cytoplasm, it is further cleaved by Dicer enzyme to generate a double-stranded miRNA of about 22 nt. After the double-stranded miRNA is untied, the mature miRNA enters an RNA-induced gene silencing complex to be completely or incompletely paired with complementary mRNA, so that the target mRNA is degraded or the expression of the target mRNA is inhibited.

Although the proportion of microRNA in total cellular RNA is small, the microRNA can effectively regulate and control all mRNA with target sites, and the function of microRNA in the development of organisms, the development of inflammation and the development of tumor related to inflammation is not negligible.

At present, most of microRNAs related to intestinal cancers related to inflammatory bowel diseases and inflammatory bowel diseases are poorly known, so that the research on the effects of microRNAs in the intestinal cancers related to the inflammatory bowel diseases and the development of effective treatment medicines are urgently needed in the field.

Disclosure of Invention

The invention aims to provide microRNA for detecting and treating colitis, which is microRNA-miR-494-3 p.

In a first aspect of the invention, there is provided the use of an active ingredient in the manufacture of a pharmaceutical composition for the alleviation or treatment of enteritis; wherein the active ingredients are selected from the following group:

(a) miR-494-3p, or a modified miR-494-3p derivative, or a miR-494-3p analog;

(b) a precursor miRNA that is capable of being processed to miR-494-3p in a host;

(c) a polynucleotide capable of being transcribed by a host into a precursor miRNA as described in (b) and processed to form miR-494-3p, or capable of being processed in a host to miR-494-3 p;

(d) an expression construct comprising the miR-494-3p of (a) or the precursor miRNA of (b), or the polynucleotide of (c);

(e) an agonist of miR-494-3p described in (a).

In a preferred embodiment, the nucleotide sequence of the miR-494-3p is shown as SEQ ID NO. 1.

In another preferred example, the modified miR-494-3p derivative or miR-494-3p analogue has sequence homology of more than or equal to 80%, preferably more than or equal to 90%, more preferably more than or equal to 95%, and most preferably more than or equal to 99% with miR-494-3 p.

In another preferred example, the miR-494-3p is derived from a human or non-human mammal.

In another preferred embodiment, the non-human mammal is a rat or a mouse.

In another preferred embodiment, the host is: human or rodent (e.g., rat, mouse).

In another preferred embodiment, the expression construct is an expression vector, including but not limited to: a plasmid, or a viral vector; more preferably, the viral vector is an adenovirus vector or an adenovirus-associated vector.

In another preferred embodiment, the modified miRNA derivative of (a) has the structure of formula (I):

Seq_{forward direction}-X-Seq_{Reverse direction}(I)

In the formula (I), Seq_{Forward direction}Is a nucleotide sequence which can be processed into miR-494-3p in a host;

Seq_{reverse direction}Is and Seq_{Forward direction}Are substantially complementaryOr a fully complementary nucleotide sequence;

x is at Seq_{Forward direction}And Seq_{Reverse direction}A spacer sequence therebetween, and the spacer sequence and Seq_{Forward direction}And Seq_{Reverse direction}Are not complementary.

In another preferred embodiment, the structure of formula (I) forms a secondary structure of formula (II) upon transfer into a host:

in the formula (II), Seq_{Forward direction}、Seq_{Reverse direction}And X is as defined above, | | is expressed in Seq_{Forward direction}And Seq_{Reverse direction}The base complementary pairing relationship between them.

In another preferred example, the agonist of miR-494-3p is selected from the group consisting of: substances for promoting miR-494-3p expression and substances for improving miR-494-3p activity; preferably, the agonist of miR-494-3p is miR 494-agomir.

In another preferred embodiment, the sequence of the precursor miRNA in (b) is shown in SEQ ID NO 2.

In another preferred embodiment, the precursor miRNA is human.

In another preferred example, the enteritis is an inflammatory disease caused by the expression of miR-494-3p is down-regulated; preferably, the enteritis includes (but is not limited to): inflammatory bowel disease, colitis.

In another preferred embodiment, the active ingredient acts by inhibiting the JAK/stat3 signaling pathway, or by inhibiting the NF-. kappa.B signaling pathway, or by down-regulating the expression of P-stat3, IKK β and/or P-P65, or by decreasing the expression levels of I L1-beta and I L-6.

In another aspect of the present invention, there is provided a pharmaceutical composition comprising a pharmaceutically acceptable carrier and one or more active ingredients selected from the group consisting of;

(a) miR-494-3p, or a modified miR-494-3p derivative, or a miR-494-3p analog;

(e) an agonist of miR-494-3p described in (a).

In another preferred embodiment, the one or more active ingredients are present in the pharmaceutical composition in an effective amount.

In another preferred embodiment, the pharmaceutical composition is used for alleviating or treating enteritis.

In another preferred embodiment, the dosage form of the pharmaceutical composition is injection, oral preparation (tablet, capsule, oral liquid), transdermal agent, sustained release agent.

In another preferred embodiment, the pharmaceutically acceptable carrier comprises: liposomes. Cellulose, nanogel.

In another aspect of the invention, there is provided a method of detecting enteritis, the method comprising: respectively detecting the expression levels of miR-494-3p of a sample to be detected and a control sample, wherein if the expression level of miR-494-3p of the sample to be detected is significantly reduced compared with the control sample, the sample is a potential colitis diseased sample; wherein the control sample exhibits a normal miR-494-3p expression level or a miR-494-3p expression level of a healthy subject.

In another preferred embodiment, the significant reduction is: compared with a control sample, the reduction amplitude of the expression level of the miR-494-3p is more than or equal to 10%, preferably more than or equal to 20%, preferably more than or equal to 50%, more preferably more than or equal to 80%, and most preferably more than or equal to 100%.

In another preferred embodiment, said detection is not aimed at obtaining a diagnosis of the disease.

In another preferred example, the detection method further comprises the step of detecting the expression levels of IKK β in the test sample and the control sample respectively, and if the expression level of IKK β in the test sample is remarkably increased compared with the control sample, the test sample is a potential colitis diseased sample, wherein the control sample presents a normal IKK β expression level or an IKK β expression level of a healthy person.

In another aspect of the present invention, there is provided a method of screening for potential substances for ameliorating or treating enteritis, the method comprising:

(1) treating the system expressing miR-494-3p with a candidate substance; and

(2) detecting the expression condition of miR-494-3p in the system;

wherein, if the candidate substance can increase the expression of miR-494-3p, the candidate substance is a potential substance for relieving or treating enteritis.

In another preferred example, step (1) includes: in a test group, adding a candidate substance into a system expressing miR-494-3 p; and/or

The step (2) comprises the following steps: detecting the expression of the miR-494-3p in the system of the test group and comparing the expression with a control group, wherein the control group is the system which expresses the miR-494-3p and is not added with the candidate substance;

if the expression of miR-494-3p in the test group is statistically higher (preferably significantly higher, e.g., more than 20%, preferably more than 50%, more preferably more than 80%) than that in the control group, it is indicated that the candidate is a potential agent for relieving or treating enteritis.

In another preferred embodiment, step (1) further expresses IKK β and step (2) further comprises measuring the expression of IKK β in the test group of systems as compared to a control group, wherein the control group is a system expressing IKK β without the addition of the candidate substance, and wherein the candidate substance is a potential substance for ameliorating or treating enteritis if the expression of IKK β in the test group is statistically lower (preferably significantly lower, e.g., more than 20% lower, preferably more than 50% lower, more preferably more than 80% lower) than the control group.

In another preferred embodiment, the candidate substance includes (but is not limited to): an interference molecule, a nucleic acid inhibitor, a binding molecule (such as an antibody or a ligand) and a small molecule compound designed aiming at miR-494-3 p.

In another preferred embodiment, the system is selected from: a cell system (e.g., a cell expressing miR-494-3 p) (or a cell culture system), a subcellular system, a solution system, a tissue system, an organ system, or an animal system.

In another preferred example, the method further comprises: the obtained potential substances are subjected to further cell experiments and/or animal experiments to further select and identify substances useful for alleviating or treating enteritis from the candidate substances.

In another aspect of the present invention, there is provided a method for preventing and treating enteritis by administering the pharmaceutical composition of the first aspect of the present invention to a subject in need thereof.

In another preferred embodiment, the subject comprises a human.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments.

Drawings

The following drawings are included to illustrate specific embodiments of the invention and are not intended to limit the scope of the invention as defined by the claims.

FIG. 1 shows that under normal feeding conditions, miR-494-3p knockout (miR-494-3p-/-) does not affect mouse body weight and colon tissue architecture. FIG. 1a shows that the relative level of miR-494-3p in colon tissue of a miR-494-3p knockout mouse is hundreds of times lower than that of a wild-type mouse (miR-494-3p +/+), so that the miR-494-3p knockout is successful; FIG. 1b shows that under normal feeding conditions, weights of miR-494-3 p-/-mice and wild-type mice were continuously counted for 2-8 weeks, and the statistical structure shows that the weights are basically consistent. FIG. 1c shows that under normal feeding conditions, 8-week-old miR-494-3 p-/-mice have a colon tissue structure similar to that of age-matched wild-type mice.

FIG. 2 shows that in the DSS-induced colitis model, miR-494-3 p-/-mice showed a more severe enteritis than wild-type mice. FIG. 2a shows that miR-494-3 p-/-mice lost weight more significantly than wild-type mice 7 days after 2.5% DSS feeding; FIG. 2b shows that the colon length of miR-494-3 p-/-mice is significantly less than that of wild-type mice 7 days after 2.5% DSS feeding of the mice; FIG. 2c shows that the clinical score (DAI) of miR-494-3 p-/-mice was significantly higher than wild-type mice 7 days after 2.5% DSS feeding; FIGS. 2d and 2e show that 7 days after 2.5% DSS feeding to mice, the colon tissue architecture of miR-494-3 p-/-mice exhibited more severe mucosal epithelial destruction and immune cell infiltration than wild-type mice, and a histological score (2 f); FIG. 2f shows that miR-494-3p levels in colon tissue and plasma of mice were significantly reduced 7 days after DSS feeding wild type mice; p <0.01 in the figures described above.

FIG. 3 shows that colon tissues of miR-494-3P-/-mice present higher levels of infiltration of inflammatory cells and expression of proinflammatory factors than those of wild-type mice in a DSS-induced mouse colitis model FIG. 3a shows that the total amount of leukocytes and the numbers of neutrophils, lymphocytes and monocytes are significantly higher in blood of miR-494-3P-/-mice 7 days after DSS feeding the mice, FIG. 3b colon tissue sections immunofluorescence shows that infiltration of macrophages (F4/80 positive marker) and neutrophils (L y6G positive marker) is significantly higher in colon tissues of miR-494-3P-/-mice than in wild-type mice, FIG. 3c shows that I L1-beta, I L6, IFN-gamma, I L17 c, I L23, CXC L1, miR-12 c is significantly higher in colon tissues of miR-494-3P-/-mice, and FIG. 0.001 < Ccp > in wild-type mice.

FIG. 4 shows that in a DSS-induced murine enteritis model, the knockout of miR-494-3p increases the permeability of colonic epithelial cells in mice. FIG. 4a shows that there is no significant difference in colonic epithelial permeability between normally fed miR-494-3 p-/-mice and wild-type mice, but that permeability of colonic epithelium is significantly enhanced in miR-494-3 p-/-mice over wild-type mice 7 days after DSS feeding; FIG. 4b shows that FITC-dextran content in plasma of miR-494-3 p-/-mice is significantly higher than wild-type mice 7 days after DSS feeding mice; FIG. 4c shows that the expression level of claudin-1, a tight junction protein, in colon tissue of miR-494-3 p-/-mice, is significantly lower than that of wild-type mice 7 days after DSS feeding of the mice; p <0.01 in the figures described above.

FIG. 5 shows that in DSS-induced colitis model, miR-494-3p knockout inhibits proliferation of colon tissue cells and promotes apoptosis of colon tissue cells. FIG. 5a shows that ki67 (marker of proliferation) staining in colon tissue of miR-494-3 p-/-mice was significantly lower than that of wild-type mice 7 days after DSS feeding mice; and the graph b shows that the number of apoptotic cells in colon tissues of miR-494-3 p-/-mice is obviously higher than that of wild-type mice 7 days after DSS feeding of the mice.

FIG. 6 shows that miR-494-3p knockout activates activation of inflammation-associated signaling pathways NF-. kappa.B and JAK/STAT3 in a DSS-induced colitis model. FIGS. 6a and 6b show that the levels of p-stat3 and its upstream p-JAK1 and p-JAK2 in colon tissue of miR-494-3 p-/-mice are significantly higher than those in wild-type mice 7 days after DSS feeding of the mice; FIG. 6c shows that the levels of P-P65 protein were significantly increased in colon tissue of miR-494-3P-/-mice compared to wild-type mice 7 days after DSS feeding mice.

FIG. 7 shows that the miR-494-3p analog protects colon tissue in a DSS-induced colitis model. FIG. 7a shows the operational route of miR-494-3p analogues for treatment of DSS-induced mouse colitis; FIG. 7b shows that miR-494-3p analog significantly increases miR-494-3p expression in colon tissue following caudal vein injection; FIG. 7c shows that the body weight of mice significantly returned after miR-494-3p analogue treatment; FIG. 7d shows a significant increase in colon length in mice following miR-494-3p analog treatment; FIG. 7e shows that clinical score (DAI) of mice is significantly reduced following miR-494-3p analog treatment; figure 7f shows that colon tissue destruction and histological score of mice were significantly reduced following miR-494-3p analog treatment; p <0.05, P <0.01 in the above figures.

FIG. 8 shows that inflammatory cell infiltration and proinflammatory factor expression are significantly reduced in colon tissue of mice treated with the miR-494-3P analog in the DSS-induced mouse colitis model, FIG. 8a shows that the numbers of macrophages (F4/80 positive marker) and neutrophils (L y6G positive marker) in colon tissue of mice are significantly reduced after the miR-494-3P analog is treated with the DSS-induced colitis, and FIGS. 8b and 8c show that the expression levels of cytokines (8b) and chemokines (8c) related to inflammation promotion in colon tissue of mice are significantly reduced after the miR-494-3P analog is treated, wherein P is <0.05, P is <0.01, and P is <0.001 in the above-mentioned figures.

FIG. 9 shows that miR-494-3p analog treatment promotes proliferation and inhibits apoptosis of colon tissue cells in a DSS-induced mouse colitis model. FIG. 9a shows that after miR-494-3p analogue treatment, cells stained positively in mouse colon tissue ki67 (proliferation marker) are increased significantly; FIG. 9b shows that the number of apoptotic cells in colon tissue of mice is significantly reduced after miR-494-3p analogue treatment.

FIG. 10 shows that miR-494-3p analogs inhibit activation of inflammation-associated signaling pathways NF-. kappa.B and JAK/STAT3 in a DSS-induced colitis model. FIGS. 10a and 10b show that the levels of p-stat3 and its upstream p-JAK1 and p-JAK2 protein in colon tissue of mice were significantly reduced following miR-494-3p analogue treatment; FIG. 10c shows that the protein level of P-P65 in colon tissue of mice is significantly inhibited after miR-494-3P analog treatment.

FIG. 11 shows that IKK β is the target gene of miR-494-3P, FIG. 11a shows the prediction of the target site of miR-494-3P in IKK β using TargetScan software, nucleotides complementary to miR-494-3P "seed sequence" are boxed and the numbers represent the sites at the 3' UTR, FIG. 11b shows that murine IKK β can be regulated by miR-494-3P, FIG. 11c shows that miR-494-3P knockout up-regulates protein expression of IKK β in colon tissue in a DSS-induced mouse colitis model, FIG. 11d shows that miR-494-3P analog down-regulates protein levels of IKK β in colon tissue in treatment of mouse colitis, and IKK <0.05 in the above-mentioned figures.

FIG. 12 shows that miR-494-3P mimetics (miR-494-3pmimic) inhibited activation of NF-. kappa.B and JAK/STAT3 signaling pathways and expression of inflammatory cytokines after primary colonic epithelial cells were treated with lipopolysaccharide (lps). FIG. 12a shows that miR-494-3P mimic successfully upregulated miR-494-3P levels in IEC cells and significantly downregulated miR-494-3P expression with prolonged treatment time for lps, FIG. 12B shows that after treatment with lps, miR-494-3P overexpressed primary colonic epithelial cells all significantly downregulated P-STAT3, P-P65 and miR-494-3P target gene IKK β, FIG. 12c shows that IKK L1-beat and I L6 levels in miR-494-3P overexpressed primary colonic epithelial cells were significantly reduced, and in the above-described figures, P <0.05, P < 0.01P < 0.001.

Detailed Description

The present inventors have extensively and intensively studied to find a class of mirnas: miR-494-3p, a modified miR-494-3p derivative, or a miR-494-3p analog; the miRNA can directly participate in enteritis, and miR-494-3p protects the tight connection between colonic epithelial cells to maintain normal intestinal epithelial permeability in the enteritis process; in enteritis, the low expression of miR-494-3p increases infiltration of macrophages and secretion of inflammation-related cytokines in colon tissues; the miR-494-3p analogue injected into a mouse body can relieve the colitis caused by DSS; during the development of enteritis, miR-494-3p is down-regulated. Therefore, the miR-494-3p can be used as a detection or treatment target of enteritis.

MiRNA and its precursor

As used herein, the term "miRNA" refers to an RNA molecule that is processed from a transcript that forms a precursor to a miRNA. Mature mirnas typically have 18-26 nucleotides (nt) (preferably about 19-22nt), although miRNA molecules with other numbers of nucleotides are not excluded. mirnas are typically detectable by Northern blotting. mirnas can be isolated from cells.

mirnas can be processed from Precursor mirnas (Pre mirnas), which can fold into a stable stem-loop (hairpin) structure, typically between 50-100bp in length. The precursor miRNA can fold into a stable stem-loop structure, and the two sides of the stem-loop structure comprise two basically complementary sequences. The precursor miRNA may be natural or synthetic.

A precursor miRNA can be cleaved to generate a miRNA that is substantially complementary to at least a portion of the sequence of the mRNA encoding the gene. As used herein, "substantially complementary" means that the sequences of the nucleic acids are sufficiently complementary to interact in a predictable manner, such as to form secondary structures (e.g., stem-loop structures). Typically, two "substantially complementary" nucleotide sequences are complementary to each other for at least 70% of the nucleotides; preferably, at least 80% of the nucleotides are complementary; more preferably, at least 90% of the nucleotides are complementary; further preferably, at least 95% of the nucleotides are complementary; such as 98%, 99% or 100%. Generally, two sufficiently complementary molecules may have up to 40 mismatched nucleotides between them; preferably, there are up to 30 mismatched nucleotides; more preferably, there are up to 20 non-matching nucleotides; further preferred, there are up to 10 mismatched nucleotides, such as 1, 2, 3, 4, 5, 8, 11 mismatched nucleotides.

As used herein, a "stem-loop" structure, also referred to as a hairpin structure, refers to a nucleotide molecule that can form a secondary structure comprising a double-stranded region (stem) formed by two regions (on the same molecule) of the nucleotide molecule flanking a double-stranded portion; it also includes at least one "loop" structure comprising non-complementary nucleotide molecules, i.e., a single-stranded region. Even if the two regions of the nucleotide molecule are not completely complementary, the double-stranded portion of the nucleotide remains double-stranded. For example, an insertion, deletion, substitution, etc., can result in the non-complementarity of a small region or the small region itself forming a stem-loop structure or other form of secondary structure, however, the two regions can still be substantially complementary and interact in a predictable manner to form a double-stranded region of the stem-loop structure. The stem-loop structure is well known to those skilled in the art, and usually after obtaining a nucleotide sequence having a primary structure, those skilled in the art can determine whether the nucleic acid can form a stem-loop structure.

The miRNA comprises the following components: miR-494-3p, or a modified miR-494-3p derivative, or a miR-494-3p analogue. Wherein, the nucleotide of miR-494-3p is shown in SEQ ID NO. 1.

One of ordinary skill in the art can modify miR-494-3p using general methods in ways including (but not limited to): hydrocarbyl modification, glycosylation modification, nucleic acid modification, peptide fragment modification, lipid modification, halogen modification, methylation modification, methoxylation modification, thio modification, cholesterol modification, alkyl modification, locked nucleic acid modification, peptide nucleic acid modification, and/or modification in which the phosphate backbone is replaced by phospholipid linkage, and the like. Wherein the glycosylation modification group comprises: 2-methoxy-glycosyl, alkyl-glycosyl, glycosyl etc. In order to improve the stability or other properties of miRNA, at least one protective base can be added on at least one end of miRNA, such as 'TT', etc., or one to more nucleotides can be changed on the basis of miR-494-3p sequence to obtain miR-494-3p analogue.

The modified miR-494-3p derivative can be a monomer or a multimer having the structure of formula (III):

(X) n- (Y) m formula (III)

In the formula (III), the compound represented by the formula (III),

x is a nucleotide sequence with a sequence shown as SEQ ID NO. 1;

n is a positive integer optionally from 1 to 50 (preferably 1 to 20, such as 5, 10, 15); for example, n is 1, 2, 3, 4 or 5;

y is a modifier for promoting the drug delivery stability of the micro RNA, and is covalently connected or coupled with or attached to X;

m is a positive integer from 1 to 1500, preferably from 1 to 200, such as 10, 20, 50, 100, 150.

In another preferred example, said Y includes but is not limited to: cholesterol, steroids, sterols, alcohols, organic acids, fatty acids, esters, monosaccharides, polysaccharides, amino acids, polypeptides, mononucleotides, polynucleotides.

Polynucleotide constructs

According to the miRNA sequences provided by the present invention, polynucleotide constructs can be designed which, after introduction, can be processed into mirnas that affect the expression of the corresponding mirnas, i.e. the polynucleotide constructs are capable of up-regulating the amount of the corresponding mirnas in vivo. Accordingly, the present invention provides an isolated polynucleotide (construct) which can be transcribed by a human cell into a precursor miRNA which can be cleaved by a host (e.g. a human cell) and expressed as said miRNA.

As a preferred mode of the invention, the miR-494-3p polynucleotide construct contains a structure shown in a formula (I):

Seq_{forward direction}-X-Seq_{Reverse direction}(I)

In the formula (I), Seq_{Forward direction}Is a nucleotide sequence which can be processed into miR-494-3p in a host; seq_{Reverse direction}Is and Seq_{Forward direction}A substantially complementary or fully complementary nucleotide sequence; x is at Seq_{Forward direction}And Seq_{Reverse direction}A spacer sequence therebetween, and the spacer sequence and Seq_{Forward direction}And Seq_{Reverse direction}Are not complementary.

The structure of formula (I) forms a secondary structure of formula (II) after transfer into a cell:

Typically, the polynucleotide construct is located on an expression vector. Thus, the invention also includes a vector comprising said miRNA, or said polynucleotide construct. The expression vector usually further contains a promoter, an origin of replication, and/or a marker gene. Methods well known to those skilled in the art can be used to construct the expression vectors required by the present invention. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The expression vector preferably comprises one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells, such as kanamycin, gentamicin, hygromycin, ampicillin resistance.

Pharmaceutical composition

The invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier or an effective amount of one or more active ingredients selected from the group consisting of: (a) miR-494-3p, or a modified miR-494-3p derivative, or a miR-494-3p analog; (b) a precursor miRNA that is capable of being processed to miR-494-3p in a host; (c) a polynucleotide capable of being transcribed by a host into a precursor miRNA as described in (b) and processed to form miR-494-3p, or capable of being processed in a host to miR-494-3 p; (d) an expression construct comprising the miR-494-3p of (a) or the precursor miRNA of (b), or the polynucleotide of (c); (e) an agonist of miR-494-3p described in (a).

As a preferable mode of the invention, the miR-494-3p is derived from human or non-human mammals.

In a preferred embodiment of the present invention, the modified miRNA derivative described in (a) has a structure represented by the aforementioned formula (III).

As a preferred embodiment of the present invention, the polynucleotide described in (c) has a structure represented by the above-mentioned formula (II).

As a preferred mode of the invention, the sequence of the precursor miRNA is shown as SEQ ID NO. 2.

As used herein, the term "effective amount" or "effective dose" refers to an amount that produces a function or activity in, and is accepted by, a human and/or an animal.

As used herein, a "pharmaceutically acceptable" component is one that is suitable for use in humans and/or mammals without undue adverse side effects (such as toxicity, irritation, and response), i.e., at a reasonable benefit/risk ratio. The term "pharmaceutically acceptable carrier" refers to a carrier for administration of a therapeutic agent, including various excipients and diluents.

The pharmaceutical composition of the present invention contains a safe and effective amount of the active ingredient of the present invention and a pharmaceutically acceptable carrier. Such vectors include (but are not limited to): saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. The pharmaceutical composition of the invention can be prepared into injections, oral preparations (tablets, capsules and oral liquid), transdermal agents and sustained-release agents. For example, by a conventional method using physiological saline or an aqueous solution containing glucose and other adjuvants. The pharmaceutical composition is preferably manufactured under sterile conditions.

The active ingredients of the present invention may vary depending on the mode of administration and the severity of the disease to be treated, etc. The selection of a preferred effective amount can be determined by one of ordinary skill in the art based on various factors (e.g., by clinical trials). Such factors include (but are not limited to): pharmacokinetic parameters of the active ingredient such as bioavailability, metabolism, half-life, etc.; the severity of the disease to be treated by the patient, the weight of the patient, the immune status of the patient, the route of administration, etc. In general, satisfactory results are obtained when the active ingredient of the invention is administered at a daily dose of about 0.00001mg to 50mg per kg of animal body weight (preferably 0.0001mg to 10mg per kg of animal body weight). For example, divided doses may be administered several times per day, or the dose may be proportionally reduced, as may be required by the urgency of the condition being treated.

The pharmaceutically acceptable carrier of the present invention includes (but is not limited to): the choice of liposomes, cellulose, nanogel carrier should be matched to the mode of administration, and these are well known to those of ordinary skill in the art.

The invention also provides the application of the pharmaceutical composition in preparing medicines for diagnosing and treating enteritis. The enteritis is an inflammatory disease caused by the expression down-regulation of miR-494-3 p; preferably, the enteritis includes (but is not limited to): inflammatory bowel disease, colitis.

Diagnostic method

The present invention also provides a method for diagnosing colitis, which in a preferred embodiment comprises the steps of: respectively detecting the expression levels of miR-494-3p of a sample to be detected and a control sample, wherein if the expression level of miR-494-3p of the sample to be detected is significantly reduced compared with the control sample, the sample is a potential colitis diseased sample; wherein the control sample exhibits a normal miR-494-3p expression level or a miR-494-3p expression level of a healthy subject. Preferably, said significant reduction is: compared with a control sample, the reduction amplitude of the expression level of the miR-494-3p is more than or equal to 10%, preferably more than or equal to 20%, preferably more than or equal to 50%, more preferably more than or equal to 80%, and most preferably more than or equal to 100%.

Drug screening

After the close correlation of miR-494-3p and enteritis is known, substances which can up-regulate the expression of miR-494-3p can be screened based on the characteristics. From said substances (potential) substances can be found which are useful for alleviating or treating intestinal inflammation.

Accordingly, the present invention provides a method of screening for potential agents for ameliorating or treating enteritis, the method comprising: (1) treating the system expressing miR-494-3p with a candidate substance; and (2) detecting the expression condition of miR-494-3p in the system; wherein, if the candidate substance can increase the expression of iR-494-3p, the candidate substance is a potential substance for relieving or treating enteritis.

The system for expressing miR-494-3p can be, for example, a cell (or cell culture) system, and the cell can be a cell endogenously expressing miR-494-3 p; or can be a cell recombinantly expressing miR-494-3 p. The system for expressing miR-494-3p can also be a subcellular system, a solution system, a tissue system, an organ system or an animal system (such as an animal model, preferably a non-human mammal animal model, such as a mouse, a rabbit, a sheep, a monkey and the like) and the like.

In a preferred mode of the invention, in order to more easily observe the change of the expression of miR-494-3p when screening is carried out, a control group can be also arranged, and the control group can be a system which does not add the candidate substance and expresses miR-494-3 p.

As a preferred embodiment of the present invention, the method further comprises: the potential substances obtained are subjected to further cell experiments and/or animal experiments to further select and identify substances which are truly useful for ameliorating or treating enteritis.

The method for detecting the expression, activity, existence amount or secretion of the miR-494-3p is not particularly limited. Conventional quantitative or semi-quantitative detection techniques may be employed.

In another aspect, the invention also provides a potential substance for alleviating or treating enteritis, which is obtained by the screening method. The preliminarily screened substances can form a screening library, so that people can finally screen substances which can be used for up-regulating the expression and activity of miR-494-3p and further relieving or treating enteritis.

The main advantages of the invention are:

(1) the invention discloses the regulation and control effect of miRNA in DSS-induced colitis of mice, proves that miRNA directly participates in the occurrence of colitis, and directly links miRNA and colitis;

(2) in a DSS-induced mouse colitis model, the expression level of miR-494-3p in tissues and blood plasma is reduced along with the occurrence of colitis;

(3) in a DSS-induced mouse colitis model, miR-494-3p knockout mice show more severe inflammatory responses (including more obvious weight loss and colon shortening, more serious damage to colon mucosa and higher expression of inflammatory factors) and activation of NF-kB and JAK/STAT3 signal pathways than wild-type mice.

(4) In a DSS-induced mouse colitis model, miR-494-3p analogue is injected into tail vein of a mouse, so that the occurrence of colorectal inflammation can be remarkably relieved, and the activation of NF-kB and JAK/STAT3 signal channels can be inhibited.

(5) miR-494-3p can reduce the expression of IKK β, and both miR-494-3p and IKK β can be used as a diagnosis or treatment target of colorectal inflammation.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, for which specific conditions are not noted in the following examples, are generally performed according to conventional conditions such as those described in J. SammBruk et al, molecular cloning protocols, third edition, scientific Press, 2002, or according to the manufacturer's recommendations.

Materials and methods

miR-494-3p with C57B L/6 background^-/-Mouse embryonic stem cells were purchased from MMRRC (Mutant mouse resource) in the United states&Research Centers) and entrusted southern model biosciences with embryo thawing and embryo transfer C57B L/6 was purchased from shanghai chang biotechnology limited.

293T (purchased from ATCC), medium thereof: dmem (hyclone) + 10% fetal bovine serum (BI) + 1% streptomycin double antibody solution (Gibco).

Primary colonic epithelial cells, culture medium: DMEM/F12(Hyclone) + 10% fetal bovine serum (BI) + 2% streptomycin double antibody solution (Gibco) + 0.2% insulin (Sigma).

Cells were incubated at 37 ℃ with 5% CO₂Cultured in an incubator.

KOD-plus kit for PCR was purchased from TOYOBO, restriction enzyme, T4 DNA ligase was purchased from NEB, dextran sulfate (DSS) was purchased from MP Biomedicals, Collagenase (collagen type XI) and Dispase (Dispase) were purchased from Sigma, erythrocyte lysate was purchased from Biyunnan, Matrigel was purchased from BD, L PS was purchased from Sigma, TUNE L was purchased from Nanjing Novok Biotech Co., Ltd using TUNE L FITC Apoptosis Detection kit, Paraformaldehyde (Paraformaldehyde, PFA) was purchased from Sigma, feces occult blood Detection test paper was purchased from Aikang Biotech Co., Ltd.

The genotype identification primer sequences of the miR-494-3p knockout mice are shown in Table 1.

TABLE 1

SEQ ID NO:	Orientation of the primers	Primer sequence (5 '-3')
			3	Forward direction	GGTCGCTTCTCATCACCCAC
4	Reverse direction 1	AGTAGAAGGTGGCGCGAAGG
			41	Reverse direction 2	GGGAAGCAGCCAATGATTTG

The Q-PCR primers are shown in Table 2.

TABLE 2

Primers used to clone the 3' UTR sequence are shown in Table 3.

TABLE 3

Primers used to clone the 3' UTR mutant sequences are shown in Table 4.

TABLE 4

Plasmid construction

All 3 ' UTR sequences were PCR amplified from cDNA of C57B L/6 mouse colon tissue and ligated into a commercially available pG L6-miR vector (available from Biyunyian Biotechnology Co.) to obtain L uciferase reporter plasmid, all 3 ' UTR mutant sequences were PCR amplified from a constructed pG L3.1.1-3 ' UTR recombinant plasmid and ligated into a commercially available pG L6-miR vector to obtain L uciferase reporter plasmid.

Both the miR-494-3p mimetic (miR-494-3p imic) and the miR-494-3p analog were synthesized by Ruibo Bio Inc.

Establishment of miR-494-3p knockout mouse (miR-494-3p-/-)

miR-494-3p with C57B L/6 background^-/-Mouse embryonic stem cells were purchased from MMRRC (Mutant mouse resource) in the United states&Research Centers) in brief, a targeting vector L oxP-F3-PGK-EM 7-Puro. DELTA. tk-bpA-L oxP-FRT was transfected into embryonic stem cells (ES cells) of wild-type mice, and the sequence of the targeting vector was introduced into the cellsReplacing miR-494 sequence in embryonic stem cell in wild mouse by homologous recombination method to obtain targeted ES cell. The targeted embryonic stem cells can express puromycin/thymine kinase activity under the action of EM7/PGK promoter so as to successfully resist puromycin screening. The purchased embryonic stem cells were entrusted to Shanghai's Square model organism company to construct knockout mice: firstly, injecting embryonic stem cells into a blastocyst cavity of a mouse in a micro manner, then transplanting the injected blastocyst into the uterus of a pseudopregnant mouse to breed a chimeric mouse, and mating a male chimeric mouse and a wild female mouse to breed a knockout mouse.

Preparation of miR-494-3p analogue

The miR494-agomir sequence is as follows: UGAAACAUACACGGGAAACCUC (SEQ ID NO:42), which has been methylated and cholesterol modified.

The Control-agomir sequence is: UCACAACCUCCUAGAAAGAGUAGA (SEQ ID NO:43), which has been methylated and cholesterol modified.

DSS-induced colitis model

The corresponding 6-8 week old male mice were marked and initial body weights were recorded, 8-10 mice per group, and the drinking water in the mouse cage was replaced with 2.5% DSS solution. The drinking water was changed daily and the weight of the mice was recorded and the mice were sacrificed after 7 days of continuous feeding. During feeding, mouse feces were collected daily and scored according to the following clinical scoring criteria to assess the level of intestinal inflammation.

Fecal occult blood score: 0 ═ occult blood test paper can not detect bleeding; bleeding can be detected by occult blood detection test paper; 2-fecal bloodstain detectable to the naked eye; 3-significant rectal bleeding.

Stool viscosity score: 0 ═ intact fecal particles; semi-formed feces that does not stick to the anus; 2-semi-formed feces adhered to the anus; 3 liquefied feces adhering to the anus.

Isolation and culture of mouse Primary Colon epithelial cells

The colon tissue of the mice was cut radially under sterile conditions, and after removal of the feces, placed in fresh sterile PBS containing 1% (vol/vol) FBS, penicillin (100U/ml) and streptomycin (100. mu.g/ml). The colon was cut into tissue pieces of 1 to 2mm2 with sterile scissors, and after three additional washes with the above PBS solution, the tissue pieces were placed in 25ml of prepared intestinal tissue digest and digested at 37 ℃ for 3 hours. The intestinal tissue digest was prepared using DMEM medium containing 1% (vol/vol) FBS, collagen type XI (75U/ml), dispase (20mg/ml), penicillin (100U/ml) and streptomycin (100. mu.g/ml). After digestion was complete, the mixture was allowed to stand at room temperature for 1 minute to allow large pieces of undigested tissue to settle. At this time, the digestive juice supernatant contains intestinal epithelial cell Crypt (Crypt) structures, the supernatant is carefully aspirated and transferred to a new centrifuge tube, an equal volume of S-DMEM solution (DMEM medium containing 5% (v/v) FBS, 2% (v/v) D-sorbitol, penicillin (100U/ml) and streptomycin (100. mu.g/ml)) is added, the mixture is gently inverted and mixed, and then the mixture is centrifuged at 200g for 4 minutes at room temperature. The supernatant was discarded, and the pellet was resuspended in S-DMEM solution and centrifuged for 4 minutes at 200g at room temperature, and the procedure was repeated at least five times until the supernatant was clear of impurities. The pellet was resuspended in 5% (v/v) FBS, penicilin (100U/ml) and streptomycin (100. mu.g/ml) DMEM medium and dispensed into cell culture plates previously coated overnight with Matrigel at 4 ℃ and fresh medium was replaced for subsequent experiments after 24 hours of cell attachment.

Cell transfection

Plasmid DNA and synthetic miR-494-3p mimic were transfected using L ipofectamine2000 and Fugen, respectively, the procedure being described with reference to the product instructions for a transfection dose of 5ul miR-494-3p mimic for one well of a 6-well plate to examine the effect of miR-494-3p on primary colonic epithelial cells, cells were treated with L PS at specific time points, respectively, 24 hours after transfection.

Immunofluorescent staining and photography

Immunofluorescent staining of mouse colon tissue sections was performed according to a commonly used method; for better dewaxing, the paraffin sections are placed in an oven at 65 ℃ for 30min-1h in advance; in order to obtain better antigenic activity, all experiments used autoclaves to repair the antigens. Immunofluorescence images were taken using an Olympus BX61 laser confocal microscope.

Double fluorescence report experiment

The transfection ratios of miRNA micmic RNA (20um), the firefly luciferase Reporter plasmid containing the 3' UTR of the corresponding gene and the Renilla luciferase plasmid were 2:1:0.1, HEK293T cells were transfected for 24 hours before the firefly L uciferase intensity was determined using the Dual-luciferase Reporter Assay System (Promega), the Renilla luciferase intensity being used as an internal reference.

Reverse transcription PCR (RT-PCR) and Real-time quantitative PCR (Real-time Q-PCR)

Mouse colon tissue was lysed using TRIzol reagent (TaKaRa) and total RNA extracted as per the instructions 1ug of RNA was extracted using PrimeScript RT reagent Kit (Prefect Real Time) Kit (TaKaRa) reverse transcription Real-Time quantitative PCR using the HieffTM qPCR SYBR Green Master Mix Kit (san Biotech Co.) performed on an Applied Biosystems 7900sequence Detection System the reaction System was 10ul, containing 2ul RT-PCR product, 0.5uM primer and 5ul HieffTM PCR SYBR Green Master Mix under reaction conditions of 95 ℃ for 5 minutes, (95 ℃ for 10 seconds, 60 ℃ for 30 seconds) × 40 all reactions were repeated 3 times, the quantification using GAPDH as an internal reference miR-494-3p used U6 as an internal reference.

Immunoblot analysis

Colon tissue or transfected cells from mice were lysed using RIPA lysate for 30min, frozen and centrifuged, and the supernatant was taken as protein lysate, subjected to SDS-PAGE for protein quantification, and the proteins were transferred to nitrocellulose membrane after electrophoresis, blocked with 5% skim milk for 2 hours, then incubated with the corresponding primary antibody (diluted in 3% BSA-TBST) overnight at 4 deg.C, washed off the excess primary antibody the next day, incubated with the corresponding secondary antibody for 1 hour at room temperature, washed with TBST, then washed off with water, and antibody signals were detected using EC L chemiluminescence solution (Sigma) and X-film (Kodak).

Mouse intestinal epithelium permeability assay

On day 7 of DSS feeding, mice were gavaged with a dose of 0.6mg (70Kda FITC-Dextran)/g (mouse body weight), and colon tissue and plasma were collected 4 hours later. The colon tissue was frozen and sectioned for subsequent fluorescence microscopy, plasma diluted in equal volumes with Phosphate Buffered Saline (PBS), and fluorescence emission was measured at 490nm in 100ul 96 well plates.

Data statistics

Statistical data herein are mean ± s.d. of 3 independent experimental results, and unpaired t-test (unpaired student's T-test) was used to test the significance of experimental differences, representing P <0.05,. representing P <0.01,. representing P < 0.001. Significance testing and mapping used graphpad5.0 software.

Example 1 MiR-494-3p knockout under Normal feeding conditions did not affect mouse body weight and colonic tissue architecture

In this example, the relative content of miR-494-3p in colon tissue of miR-494-3 p-/-mice and wild-type mice, respectively, was examined using qPCR to ensure that miR-494-3p was successfully knocked out in mice (FIG. 1 a). Next, it was observed whether the knock-out of miR-494-3p affects the body weight of mice by continuously counting the body weight of miR-494-3 p-/-mice and wild-type mice for 2-8 weeks (FIG. 1 b). The colon tissues of 20-week-old miR-494-3p knockout mice and aged wild-type mice were observed to determine whether the miR-494-3p knockout would cause spontaneous enteritis in the mice, and HE staining results show (FIG. 1c) that the colon tissues of the miR-494-3p knockout mice are similar to normal mice and spontaneous enteritis does not occur.

The results in FIG. 1 show that miR-494-3p knockout does not affect mouse body weight and colon tissue architecture under normal feeding conditions.

Example 2, miR-494-3p knockout promotes the occurrence and development of DSS-induced mouse colitis

This example attempted to examine whether miR-494-3p is associated with DSS-induced colitis. The inventors established a DSS-induced colitis mouse model in miR-494-3 p-/-mice and wild-type mice. The mice were observed and recorded daily for 7 days of DSS feeding for weight, feces and occult blood. Colon tissue and plasma of mice were collected 7 days after feeding for subsequent experiments. The inventors found that colitis of miR-494-3 p-/-mice was more severe than that of wild-type mice and had significant differences by observing and counting body weight, colon length, clinical score, colon tissue section HE staining and histological score of the mice (FIGS. 2 a-e).

On the other hand, in order to detect whether the expression quantity of miR-494-3p per se is changed in a DSS-induced colitis model, the relative content of miR-494-3p in colon tissues and plasma of a DSS-fed wild-type mouse and a normal-fed mouse is detected by the inventor by utilizing qPCR (quantitative polymerase chain reaction), and the miR-494-3p expression is remarkably reduced after the DSS-induced colitis model (figure 2 f).

Further, in order to confirm the proinflammatory effect after miR-494-3p knockout, the inventor detects the blood routine of the mouse, and the total amount of white blood cells in the blood of the miR-494-3 p-/-mouse is about 3 times of that of the blood of a control group; among these, neutrophil upregulation was greatest, followed by monocytes and lymphocytes (fig. 3 a). In addition, immunofluorescence detected a stronger positive signal for macrophages and neutrophils infiltrated in colon tissue sections of miR-494-3 p-/-mice than in wild-type mice (FIG. 3 b). Expression levels of proinflammatory factors were measured by qPCR and found to be significantly higher in miR-494-3 p-/-mice than in wild-type mice (fig. 3 c).

Example 3 MiR-494-3p knockout increased colonic epithelial permeability in a DSS-induced colitis model

To examine the specific mechanism of miR-494-3p knockout for promoting colitis, the inventors used FITC-Dextran intragastric lavage to examine the permeability of colonic epithelium in mice.

After intragastric administration, the inventor observes the content and distribution of FITC in mouse colon epithelium through a laser confocal microscope, and as a result, the FITC fluorescence intensity in the colon of the miR-494-3 p-/-mouse fed with DSS is larger, and the distribution also infiltrates into mucosa and even submucosa (figure 4a), but the miR-494-3 p-/-mouse has no difference with a wild type mouse under normal feeding conditions.

By collecting the plasma of mice, FITC levels were measured in the plasma and it was found that FITC signal was about 4-fold higher in the plasma of DSS-fed miR-494-3 p-/-mice than in the control group, but there was no significant change between the two in the normal-fed mice (FIG. 4 b).

To further confirm the change in intestinal epithelial permeability in mice, the inventors examined the expression of claudin1, a tight protein closely related to intestinal epithelial permeability, and found that claudin1 was expressed in a smaller amount in the colon of miR-494-3 p-/-mice in the DSS-fed mouse model (fig. 4 c).

Example 4 knock-out of miR-494-3p inhibits and promotes proliferation of colonic epithelial cells in a DSS-induced colitis model

The inventor detects the proliferation and apoptosis of colon tissues of mice by immunofluorescence, finds that ki67 fluorescence signals are weaker in miR-494-3 p-/-mice, and ki L fluorescence signals for detecting apoptosis are stronger (figure 5), and shows that the proliferation of colon tissue cells of the mice is remarkably reduced and the apoptosis is remarkably increased in the miR-494-3 p-/-mice.

Example 5 in DSS-induced colitis model, miR-494-3p knockout activated JAK/stat3 and NF-. kappa.B signaling pathway

In order to explore the molecular mechanism of miR-494-3p in the role of DSS-induced colitis, the inventors examined the activation of signaling pathways closely associated with the inflammatory response. By immunoblot and immunofluorescence experiments, it was found that miR-494-3p knock-out results in increased expression levels of p-stat3 (the activated form of stat 3) and its upstream p-JAK1, p-JAK2 (the active forms of JAK1 and JAK2, respectively) in DSS-induced colitis models (fig. 6a, fig. 6 b). In addition, the inventors also detected the activation of NF- κ B, a classical signaling pathway in inflammatory response, and found that the knock-out of miR-494-3P causes the up-regulation of P-P65 (the active form of P65) (FIG. 6 c).

Example 6 treatment of miR-494-3p analogs in a DSS-induced colitis model alleviates the onset of colitis

To further confirm the role of miR-494-3p in colitis, the inventor injects miR-494-3p analogue via tail vein (figure 7a) during DSS feeding to cause the analogue to be over-expressed, so as to achieve the purpose of treating colitis.

After confirming that miR-494-3p is over-expressed in colon tissues (figure 7b), the weight, colon length, clinical score, colon tissue structure and histology score of mice are respectively observed and counted (figure 7 c-figure 7f), and the tendency of colitis in miR-494-3p over-expressed mice is found to be obviously reduced. In addition, the inventors also detected infiltration of inflammatory cells of colon tissues and expression of proinflammatory factors, and also found that compared with a control group, fluorescence intensity of macrophages and neutrophils is obviously weakened in miR-494-3p overexpression mice, and meanwhile expression level of the proinflammatory factors is remarkably reduced (FIG. 8).

Next, the inventor also detects the influence of miR-494-3p on the proliferation and apoptosis of colon epithelial cells of mice after overexpression, and finds that the overexpression of miR-494-3p promotes the proliferation of colon epithelial cells and inhibits the occurrence of apoptosis (FIG. 9).

In order to confirm the molecular mechanism of miR-494-3P in the function of colitis, the inventor detects NF-kB and JAK/STAT3 in colon tissues of mice after miR-494-3P is over-expressed, and finds that the expression levels of P-STAT3 and upstream P-JAK1, P-JAK2 and P-P65 of the P-STAT3 are reduced after miR-494-3P is over-expressed (FIG. 10).

The results show that the miR-494-3p analogue plays a remarkable treatment role in a colitis model.

Example 7 miR-494-3p downregulates expression of IKK β

In the embodiment, 3 ' UTR regions of various genes are analyzed by using software TargetScan, and potential miR-494-3p action sites are found on the 3 ' UTR of IKK β (FIG. 11 a). The inventor proves that the synthesized miR-494-3p imic can inhibit the expression of luciferase with the 3 ' UTR of IKK β through a double-fluorescence reporter gene, and the expression of the luciferase is not inhibited any more after mutation of one site (FIG. 11 b).

To further confirm the down-regulation effect of miR-494-3p on IKK β, the inventors examined the expression of IKK β in colon tissue in a DSS-induced colitis model using immunoblotting, and found that IKK β expression was up-regulated in miR-494-3p knockout mice, but IKK β expression was down-regulated when miR-494-3p was over-expressed (fig. 11 c).

Example 8 inhibition of JAK/stat3 and NF-. kappa.B activation in colonic epithelial cells by miR-494-3p

In the embodiment, the inventor separates colon epithelial cells of 3-week-old C57B L/6 mice and cultures the cells in vitro, when the cells are cultured until the confluence rate is about 70%, control-mim and miR-494-3P mim are transfected into the cells respectively, 1ug/ml lipopolysaccharide is added at different time points after 24 hours of transfection (the treatment time is 0, 5.5 hours and 12.5 hours respectively), miR-494-3P overexpression efficiency is detected by qPCR, miR-494-3P in the transfected cells is found to be up-regulated by about 10 times, and miR-494-3P in the control-mim group is gradually reduced along with the extension of the lipopolysaccharide treatment time (figure 12a), and the activation conditions of an immunoblot detection signal channel JAK/IKT 3 and NF-kappa B are found to obviously down-regulate the expression of P-3, K β and P-P65 (figure 12B).

In addition, the inventors examined the expression levels of I L1-beta and I L-6, and found that the levels of miR-494-3p after overexpression were reduced by 50% and 75% respectively compared with the control group (FIG. 12 c). I L1-beta and I L-6 serve as factors for inducing inflammatory responses, and their down-regulation indicates that the inflammatory responses were significantly alleviated.

Example 9 drug screening

And (3) taking the crypts of the small intestine of the mouse and culturing in vitro to obtain the organoids, wherein the cell structure can endogenously express miR-494-3 p. The cell structure is used as a model for screening drugs for relieving or treating enteritis.

Test group: a culture of the aforementioned organonides treated with a candidate compound;

control group: cultures of the aforementioned organonides not treated with the candidate compound.

At an appropriate time after treatment, the cells are assayed for expression of miR-494-3 p. If the expression of miR-494-3p in the test group is significantly reduced by more than 30% compared with the control group, the candidate substance is a potential substance for relieving or treating enteritis.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings of the present invention, and equivalents may fall within the scope of the invention as defined in the appended claims.

Sequence listing

<110> Shanghai Life science research institute of Chinese academy of sciences

<120> a microRNA for detecting and treating inflammatory bowel disease

<130>170351

<160>43

<170>PatentIn version 3.3

<210>1

<211>22

<212>RNA

<213> Intelligent (Homo Sapiens)

<400>1

ugaaacauac acgggaaacc uc 22

<210>2

<211>85

<212>DNA

<213> Intelligent (Homo Sapiens)

<400>2

ttgatacttg aaggagaggt tgtccgtgtt gtcttctctt tatttatgat gaaacataca 60

cgggaaacct cttttttagt atcaa 85

<210>3

<211>20

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>3

ggtcgcttct catcacccac 20

<210>4

<211>20

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>4

agtagaaggt ggcgcgaagg 20

<210>5

<211>30

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>5

acactccagc tgggtgaaac atacacggga 30

<210>6

<211>16

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>6

tggtgtcgtg gagtcg 16

<210>7

<211>21

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>7

tgtaatgaaa gacggcacac c 21

<210>8

<211>21

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>8

tcttctttgg gtattgcttg g 21

<210>9

<211>22

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>9

gatggatgct accaaactgg at 22

<210>10

<211>23

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>10

ccaggtagct atggtactcc aga 23

<210>11

<211>21

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>11

cctctagctg gaacacagtg c 21

<210>12

<211>19

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>12

gcggttctca tctgtgtcg 19

<210>13

<211>21

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>13

cagggagagc ttcatctgtg t 21

<210>14

<211>20

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>14

gctgagcttt gagggatgat 20

<210>15

<211>21

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>15

cctctagctg gaacacagtg c 21

<210>16

<211>19

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>16

gcggttctca tctgtgtcg 19

<210>17

<211>19

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>17

ggctgcctta ctcctgctg 19

<210>18

<211>21

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>18

tcatcttgcc aggtgagact g 21

<210>19

<211>20

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>19

tccgaggagt cagtgctaaa 20

<210>20

<211>20

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>20

agaacgtctt ccagggtgaa 20

<210>21

<211>18

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>21

cagcagctct ctcggaat 18

<210>22

<211>24

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>22

acaaccatct tcacactgga tacg 24

<210>23

<211>21

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>23

atgaacgcta cacactgcat c 21

<210>24

<211>21

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>24

ccatcctttt gccagttcct c 21

<210>25

<211>19

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>25

gatgctcttc cgagctgtg 19

<210>26

<211>21

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>26

ggattggaac agcaaggatt t 21

<210>27

<211>20

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>27

agactccagc cacactccaa 20

<210>28

<211>18

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>28

tgacagcgca gctcattg 18

<210>29

<211>21

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>29

cctggttcag aaaatcatcc a 21

<210>30

<211>18

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>30

cttccgttga gggacagc 18

<210>31

<211>23

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>31

atttccacac ttctatgcct cct 23

<210>32

<211>23

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>32

atccagtatg gtcctgaaga tca 23

<210>33

<211>20

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>33

aactgggtga aaagggctgt 20

<210>34

<211>20

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>34

gtccaattcc atcccaaaaa 20

<210>35

<211>17

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>35

ctcgcttcgg cagcaca 17

<210>36

<211>20

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>36

aacgcttcac gaatttgcgt 20

<210>37

<211>27

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>37

actggtacct gtttccagac agcagac 27

<210>38

<211>27

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>38

actgagctcg aggcagcaat atccaca 27

<210>39

<211>38

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>39

cttctcccct ggtaaaacaa agaaccttct gtgctggt 38

<210>40

<211>38

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>40

accagcacag aaggttcttt gttttaccag gggagaag 38

<210>41

<211>20

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<223> primer

<400>41

gggaagcagc caatgatttg 20

<210>42

<211>22

<212>RNA

<213> Artificial sequence

<220>

<221>misc_feature

<223>miR494-agomir

<400>42

ugaaacauac acgggaaacc uc 22

<210>43

<211>24

<212>RNA

<213> Artificial sequence

<220>

<221>misc_feature

<223>Control-agomir

<400>43

ucacaaccuc cuagaaagag uaga 24

Claims

1. Use of an active ingredient in the preparation of a pharmaceutical composition for the alleviation or treatment of enteritis; wherein the active ingredients are selected from the following group:

(a)miR-494-3p；

(e) an agonist of miR-494-3p described in (a).

2. The use of claim 1, wherein the nucleotide sequence of miR-494-3p is as shown in SEQ id No. 1.

3. The use of claim 1, wherein said expression construct in (d) has the structure of formula (I):

Seq_{forward direction}-X-Seq_{Reverse direction}(I)

In the formula (I), the compound is shown in the specification,

Seq_{forward direction}Is a nucleotide sequence which can be processed into miR-494-3p in a host;

Seq_{reverse direction}Is and Seq_{Forward direction}A substantially complementary or fully complementary nucleotide sequence;

4. The use according to claim 1, wherein said agonist of miR-494-3p is miR 494-agomir.

5. The use of claim 1, wherein the precursor miRNA of (b) has the sequence shown in SEQ ID NO 2.

6. The use of claim 1, wherein the inflammatory bowel disease is an inflammatory disease caused by down-regulation of miR-494-3p expression.

7. The use of claim 6, wherein the inflammatory bowel disease comprises: inflammatory bowel disease, colitis.

8. Use according to claim 1, wherein the active ingredient acts by inhibiting the JAK/stat3 signalling pathway, or by inhibiting the NF- κ B signalling pathway, or by down-regulating the expression of P-stat3, IKK β and/or P-P65, or by reducing the expression levels of I L1-beta and I L-6.

9. A method of screening for potential agents for ameliorating or treating enteritis, the method comprising:

(1) treating the system expressing miR-494-3p with a candidate substance; and

(2) detecting the expression condition of miR-494-3p in the system;

10. The method of claim 9, wherein step (1) comprises: in a test group, adding a candidate substance into a system expressing miR-494-3 p; and/or

if the expression of miR-494-3p in the test group is statistically higher than that in the control group, the candidate is indicated to be a potential substance for relieving or treating enteritis.

11. The method of claim 9, wherein in step (1), the system further expresses IKK β;

step (2) further comprises detecting expression of IKK β in the test group of systems and comparing with a control group, wherein the control group is a system expressing IKK β without the addition of the candidate substance;

if the expression of IKK β in the test group is statistically lower than in the control group, this candidate is a potential agent for ameliorating or treating enteritis.