KR101544531B1 - Biomaker miR-494-3p for distinguishing non-alcoholic steatohepatitis - Google Patents

Abstract

The present invention relates to a biomarker for distinguishing between simple fatty liver and non-alcoholic lipid hepatitis and its use. More specifically, the present invention relates to compositions and kits for the discrimination of nonalcoholic fatty liver disease from simple fatty liver, comprising an agent capable of measuring the expression level of a specific miRNA. The present invention also relates to a method for detecting a specific miRNA from a patient's sample in order to provide information necessary for discriminating nonalcoholic fatty liver disease from simple fatty liver.

Description

Biomarker miR-494-3p for discriminating nonalcoholic fatty liver disease {Biomaker miR-494-3p for distinguishing non-alcoholic steatohepatitis}

The present invention relates to a biomarker for distinguishing between simple fatty liver and non-alcoholic lipid hepatitis and its use. More specifically, the present invention relates to compositions and kits for the discrimination of nonalcoholic fatty liver disease from simple fatty liver, comprising an agent capable of measuring the expression level of a specific miRNA. The present invention also relates to a method for detecting a specific miRNA from a patient's sample in order to provide information necessary for discriminating nonalcoholic fatty liver disease from simple fatty liver.

Non-alcoholic fatty liver disease (NAFLD) is a disease in which triglyceride accumulates in the liver regardless of alcohol consumption. The risk factors for nonalcoholic fatty liver disease are obesity, diabetes, and hyperlipidemia. Protein-calorie deficiency, weight loss, or intravenous injection may cause the disease.

Non-alcoholic fatty liver disease can be divided into steatosis and non-alcoholic steatohepatitis (NASH). Non-alcoholic fatty liver disease is clinically benign benign disease, It is a progressive liver disease characterized by inflammation or fibrosis, and it is recognized as a serious liver disease because it can progress to cirrhosis or liver cancer.

Thus, among patients with nonalcoholic fatty liver disease, the prognosis of disease and the application of therapeutic regimens depend on whether it is simple fatty liver disease or non-alcoholic fatty liver disease. Therefore, diagnosis of simple fatty liver and nonalcoholic fatty liver disease It is important.

However, in the case of nonalcoholic fatty liver disease, it is very difficult to detect nonalcoholic fatty liver disease, with little or no symptoms of it. In general, when ALT / AST levels are elevated and imaging shows fatty liver findings, non-alcoholic fatty liver disease is diagnosed after excluding other diseases. However, ALT / AST levels in nonalcoholic fatty liver , And it is difficult to differentiate between simple fatty liver and non - alcoholic lipid hepatitis by imaging techniques such as ultrasound, CT and MRI. Gamma-glutamyl transferase (GTP) and alkaline phosphatase (GTP) may also be increased, but the sensitivity and specificity of non-alcoholic lipid hepatitis is low.

In conclusion, liver biopsy is required for the diagnosis of nonalcoholic fatty liver disease with these clinical features. There is still much controversy as to when to perform biopsy. It is generally accepted that tissue testing is required when the liver function (ALT / AST) level is more than twice the normal value. However, there is a limit to the histologic examination of non - alcoholic fatty liver disease patients, which are gradually increasing in clinical practice. Therefore, it is urgent to develop a tool or method for non - invasive diagnosis of nonalcoholic fatty liver disease.

Under these circumstances, the inventors of the present invention conducted comparative studies on the expression levels of microRNAs in non-alcoholic simple fatty liver mice and non-alcoholic lipid hepatitis mice and found that miR-34a, miR-494-3p and miR-451 were non-invasively non- The present invention can be used as a biomarker for distinguishing nonalcoholic fatty liver disease from fatty liver.

It is an object of the present invention to provide a biomarker for non-invasively discriminating between simple fatty liver and non-alcoholic fatty liver.

More specifically, one object of the present invention is to provide a pharmaceutical composition comprising a composition capable of measuring the expression level of one or more microRNAs selected from the group consisting of miR-34a, miR-494-3p and miR-451 And a composition for differentiating nonalcoholic fatty liver disease.

Still another object of the present invention is to provide a kit for discriminating non-alcoholic fatty liver hepatitis from simple fatty liver comprising the composition of the present invention.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating non-alcoholic lipid hepatitis, which comprises at least one member selected from the group consisting of miR-34a, miR-494-3p and miR-451 And to provide a method for detecting microRNA.

In one aspect of the present invention, the present invention provides a pharmaceutical composition comprising an agent capable of measuring the expression level of one or more microRNAs selected from the group consisting of miR-34a, miR-494-3p and miR-451 And a composition for distinguishing nonalcoholic fatty liver disease from simple fatty liver.

Preferably, the miR-34a comprises the nucleotide sequence of SEQ ID NO: 1.

Preferably, the miR-494-3p may comprise the nucleotide sequence of SEQ ID NO: 2.

Preferably, the miR-451 may consist of the nucleotide sequence of SEQ ID NO: 3.

Also preferably, the agent capable of measuring the expression level may be an oligonucleotide, a primer or a probe complementary to one or more microRNAs selected from the group consisting of miR-34a, miR-494-3p and miR-451.

In another aspect, the present invention relates to a kit for discriminating nonalcoholic fatty liver disease from simple fatty liver comprising the above composition.

In another aspect, the present invention provides a method for identifying non-alcoholic lipid hepatitis in a patient, comprising administering to the patient a sample selected from the group consisting of miR-34a, miR-494-3p and miR-451 The present invention relates to a method for detecting microRNAs.

Preferably, the sample may be selected from the group consisting of the tissue, cell, blood, serum, plasma, saliva and urine of the patient.

Further, preferably, the method further comprises the step of discriminating the patient as non-alcoholic fatty liver disease when the relative sample of the patient is detected as miR-34a or miR-494-3p relative to the simple fatty liver sample As shown in FIG.

Also preferably, the invention may further comprise the step of discriminating the patient as non-alcoholic fatty liver hepatitis, when miR-451 is detected to be relatively underexpressed in a patient sample relative to a simple fatty liver sample .

Also, preferably, the detection of one or more microRNAs selected from the group consisting of miR-34a, miR-494-3p, and miR-451 can be performed through PCR.

Hereinafter, the present invention will be described in more detail.

The present invention is based on the fact that miR-34a or miR-494-3p is over-expressed and miR-451 is overexpressed in patients with non-alcoholic fatty liver disease compared to patients with simple fatty liver, and miR-34a, miR-494-3p And miR-451 by detecting one or more microRNAs selected from the group consisting of a non-alcoholic fatty liver disease and a non-alcoholic fatty liver disease.

As used herein, the term "differentiation" refers to diagnosis, judgment or discrimination of a specific disease state, and in particular, in the sense that it accurately distinguishes among diseases which partially share some clinically similar characteristics, To distinguish the disease "was used. However, in terms of identifying a particular disease, the term may be replaced by terms such as diagnosis, judgment, discrimination, identification, and the like.

For the purpose of the present invention, in the present invention, discrimination may mean discrimination between simple fatty liver disease and non-alcoholic fatty liver disease among non-alcoholic fatty liver diseases. Simple fatty liver is a simple benign disease in which triglyceride accumulates in liver. Non-alcoholic fatty liver hepatitis is a progressive liver disease characterized by inflammation or fibrosis along with fatty liver. It is important to distinguish between simple fatty liver disease and nonalcoholic fatty liver disease.

More preferably, in the present invention, the term "differential" means that the patient is admitted to a simple fatty liver disease state or whether it develops into a non-alcoholic fatty liver disease, that is, to distinguish non-alcoholic fatty liver disease from simple fatty liver can do.

In the present invention, a microRNA biomarker is used as a non-invasive tool for discriminating non-alcoholic fatty liver disease from simple fatty liver.

More specifically, the present invention relates to a method for inhibiting miR-34a or miR-494-3p expression by measuring the expression levels of miR-34a, miR-494-3p and / or miR- -451 appears to be under-expressed compared to simple fatty liver, it provides a technique to distinguish the patient's sample from nonalcoholic fatty liver disease.

The nucleotide sequence information of the biomarkers miR-34a, miR-494-3p and miR-451 of the present invention can be confirmed from a known gene database such as miRBASE (http://www.mirbase.org/). More specifically, the nucleotide sequence of miR-34a is registered with the gene registration number MIMAT0000255 and is described in SEQ ID NO: 1 herein. The nucleotide sequence of miR-494-3p is registered with the gene registration number MIMAT0002816 and is shown in SEQ ID NO: 2 of the present application. The nucleotide sequence of miR-451 is registered with the gene registration number MIMAT0001631 and is described in SEQ ID NO: 3 of the present application.

SEQ ID NO: 1: 5'uggcagugucuuagcugguugu 3 '

SEQ ID NO: 2: 5'ugaaacauacacgggaaaccuc 3 '

SEQ ID NO: 3: 5'aaaccguuaccauuacugaguu 3 '

In order to measure the expression levels of miR-34a, miR-494-3p and / or miR-451 present in the sample, various agents capable of detecting these microRNAs can be used.

As used herein, the term "agent capable of measuring expression level" is used to detect the presence of one or more microRNAs selected from the group consisting of miR-34a, miR-494-3p and miR- Means a material that can be used. For example, primers, probes, antisense oligonucleotides and the like that can complementarily bind miR-34a, miR-494-3p and / or miR-451. The antisense oligonucleotide, primer or probe specifically binds to one or more microRNAs selected from the group consisting of miR-34a, miR-494-3p and miR-451, and the nucleotide sequence of the other nucleic acid material is specific It is preferable not to bond.

Here, complementary binding means that the antisense oligonucleotide is sufficiently complementary to hybridize selectively to the microRNA target under a predetermined hybridization or annealing condition, preferably physiological conditions, and substantially complementary (substantially complementary) complementary " and " perfectly complementary ", and preferably means completely complementary.

For example, the agent used to detect microRNA biomarkers herein may be an antisense oligonucleotide. The term "antisense oligonucleotide" refers to a nucleic acid-based molecule capable of forming a dimer with a miRNA having a complementary sequence to the target sequence miRNA, in particular, a miRNA, and the microRNA biomarker Can be used.

In another example, the agent used to detect the microRNA biomarkers herein may be a primer. The term "primer " means 7 to 50 nucleic acid sequences which can form complementary base pairs in a template strand and serve as a starting point for template strand replication. Primers are usually synthesized but can also be used in naturally occurring nucleic acids. The sequence of the primer does not necessarily have to be exactly the same as the sequence of the template, but is sufficiently complementary that it can hybridize with the template. Additional features that do not alter the primer properties of the primer can be incorporated. Examples of additional features that may be incorporated include, but are not limited to, methylation, capping, substitution of one or more nucleic acids with homologues, and modification between nucleic acids. Preferably, the primers of the present invention can be primers capable of amplifying one or more microRNAs selected from the group consisting of miR-34a, miR-494-3p and miR-451.

In another example, the agent used to detect the microRNA biomarkers herein may be a probe. The term "probe" refers to a nucleic acid fragment such as RNA or DNA corresponding to a few bases or a few hundred bases, which can be specifically bound to a target microRNA. Preferably, the probe is labeled so that the presence or absence of a specific microRNA can be easily confirmed. Selection of suitable probes and hybridization conditions can be modified based on what is known in the art.

A composition for distinguishing non-alcoholic fatty liver disease from simple fatty liver comprising an agent capable of measuring the expression level of one or more microRNAs selected from the group consisting of miR-34a, miR-494-3p and miR-451 of the present invention , And a kit.

The kit of the present invention not only includes detection agents such as primers, probes, antisense oligonucleotides and the like for detecting one or more microRNAs selected from the group consisting of miR-34a, miR-494-3p and miR-451, One or more other component compositions, solutions, or devices suitable for the method may be included. Preferably, the kit may be a gene amplification kit comprising a primer for amplifying a microRNA in a sample. Also, preferably, the kit may be a microarray kit in which a probe capable of specifically binding microRNA to a surface of a fixed substrate is immobilized.

The present invention also provides a method for distinguishing nonalcoholic fatty liver disease from simple fatty liver by detecting miR-34a, miR-494-3p and / or miR-451 from a patient sample.

The present invention also provides a method for detecting miR-34a, miR-494-3p and / or miR-451 from a patient's sample to provide information necessary for differentiating nonalcoholic fatty liver disease from simple fatty liver.

Various methods known in the art can be used for detection of miR-34a, miR-494-3p and / or miR-451. For example, polymerase chain reaction (PCR), reverse-transcription polymerase chain reaction (RT-PCR), multiplex PCR, touchdown PCR, hot start PCR, nested PCR, PCR, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), inverse polymerase chain reaction , Vectorette PCR, thermal asymmetric interlaced PCR (TAIL-PCR), ligase chain reaction, restorative chain reaction, transcription-mediated amplification, autoradiography, and selective amplification of the target sequence, The scope of the present invention is not limited thereto.

Preferably, when the miR-34a or miR-494-3p is overexpressed or the miR-451 is underexpressed in the patient's sample as compared to the simple fatty liver sample, the step of discriminating the patient as non-alcoholic fatty liver disease . ≪ / RTI >

Also preferably, the sample may be a sample selected from a group consisting of a patient's tissue, cells, blood, serum, plasma, saliva, and urine, but is not limited thereto.

The present invention provides a technique for distinguishing nonalcoholic fatty liver disease from simple fatty liver using a non-invasive method by using miR-34a, miR-494-3p and / or miR-451 as biomarkers, Rapid and accurate identification of patients with nonalcoholic fatty liver disease is possible.

Figure 1 shows liver tissue changes in mice and mice fed a normal diet and a high fat diet for 12 months.
FIG. 2 shows H & E staining, Oil red O staining, and Masson's trichrom staining of liver tissues in order to confirm the degree of fat accumulation and fibrosis progression in the liver of mice.
FIG. 3 shows the expression of miR-34a in simple fatty liver and non-alcoholic lipid hepatitis.
Figure 4 compares the expression of miR-494-3p in simple fatty liver and non-alcoholic lipid hepatitis.
Figure 5 compares the expression of miR-451 in simple fatty liver and non-alcoholic lipid hepatitis.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited by the following examples.

Example  1. Target Organization

A mouse capable of confirming the progression from non-alcoholic steatosis to non-alcoholic fatty liver disease (NASH) by ingesting high fat diet (# TD.88137, Harlan Teklad) feed for 12 months in C57BL / Model. Serum levels of aspartate aminotransferase (AST), alanine aminotransferase (ALT) and cytokines were measured by hematology.

Example  2. Immunohistochemical staining of liver tissue immunohistochemistry )

The hepatic tissue fixed in 10% formalin was embedded in paraffin, cut into 4 μm thickness, and stained with hematoxylin and eosin to confirm liver tissue lesions. In order to measure the size and weight of the liver and to confirm the accumulation of fat in liver tissue, Oil red O staining was carried out. Masson's trichrome staining was used to confirm the progress of fibrosis. And a method of staining to confirm the accumulation of collagen) was performed and then observed under an optical microscope.

To perform oil red staining, the liver tissues were periodically frozen and fixed on OCT (Optimum cutting temperature) compound (Tissue-Tek, Miles Inc, USA), cut to a thickness of 6 μm, . The frozen sections were rinsed with distilled water and washed with 60% isopropyl alcohol. The tissue was stained with Oil Red O dye for about 15 minutes and then washed with 60% isopropyl alcohol. The nucleus was stained with Mayer's haematoxylin solution for 1 to 1 minute and 30 seconds, rinsed with distilled water, and fixed on a slide with aqueous mountants (glycerin). The completed slides were stained with a fluorescence microscope and photographed at a magnification of 400 times.

For Masson's trichrome staining, hepatocyte tissues were fixed in 4% formaldehyde for 16 hours and then paraffin block was formed. Liver tissue paraffin blocks were cut to a thickness of 3 um using a tissue cutter and mounted on a slide glass and dried. The slides were rehydrated, stained with Biebrich scarlet-acid fuchsin solution for 5 min and collagen stained with aniline blue solution for 10 min. Finally, it was stained with Mayer's haematoxylin solution for 30 seconds, rinsed with distilled water, fixed with mounting solution and stored. The completed slides were scanned at high magnification using a 3DHISTECH slide scanner to compare the degree of collagen accumulation in the liver tissue of the liver.

Example  3. Total RNA extraction

The frozen tissues were disrupted in a mortar and mixed with 1 ml of trizol reagent (Invitrogen, Carlsbad, Calif., USA) and allowed to stand at room temperature for 5 minutes. After adding 0.2 ml of chloroform, the mixture was allowed to stand at room temperature for 2-3 minutes, and the colorless supernatant obtained by centrifugation at 12,000 g for 15 minutes at 4 ° C was transferred to a new tube . 0.5 ml of isopropanol was added to the supernatant, and the mixture was allowed to stand at room temperature for 10 minutes, followed by centrifugation at 12,000 g for 10 minutes at 4 ° C to precipitate RNA and remove the upper layer. The precipitated RNA was mixed well with 1 ml of 75% ethanol and centrifuged at 12,000 g for 10 minutes at 4 ° C to remove the upper layer and then dried at room temperature for 10 minutes. 100 μl of distilled water was added to the dried RNA, and 1 μl of the RNA was dissolved. The absorbance was measured with a spectrometer and the purity of the RNA was determined by performing electrophoresis on 1% agarose gel. Respectively.

Example  4. Candidates miRNA Real time Polymerase chain reaction

The real-time PCR reaction of miRNA consists of 5 mL of cDNA (corresponding to 100 ng of RNA), 1 × Taqman Universal PCR Master Mix (PE Applied Biosystems) and 500 nM of primer, Respectively. The polymerase chain reaction was carried out at 50 ° C for 2 minutes, followed by reaction at 95 ° C for 5 minutes, followed by 45 cycles of reaction at 95 ° C for 15 seconds and 60 ° C for 60 seconds. U6 small nuclear RNA (gene registration number: NR_003027) was used as a control gene and U6 small nuclear RNA gene was measured in the same manner. All samples simultaneously measured each microRNA and U6 small nuclear RNA gene. Finally, the amount of candidate microRNA was expressed as the ratio of the CT value of the candidate microRNA to the CT value of the U6 small nuclear RNA. The primer sequences used are shown below (Table 1).

SEQ ID NO: Gene name The base sequence (5 '- > 3') 4 miR-34a Forward Primer TGGCAGTGTCTTAGCTGGTTGT 5 miR-494 Forward Primer TGAAACATAC ACGGGAAACCTC 6 miR-451 Forward Primer TGGGAATGGCAAGGAAACCG 7 The U6 small nuclear RNA Forward Primer GCTTCGGCAGCACATATACTAAAAT

The nucleotide sequence of miR-494-3p is registered with the gene registration number (MIMAT0002816) and is shown in SEQ ID NO: 2 of the present application.

Experiment result

The body weight gain and liver weight of the sacrificed mice after 12 months of normal diet and high fat diet were significantly higher in the high fat diet group than in the normal fat fat diet group and the body fat increase due to the high fat diet was significantly induced (Fig. 1).

Histological analysis (H & E, Oil red O, Masson 's trichrome and immunohistochemical staining) showed fat accumulation in mouse liver tissues consuming high fat diet for 3 months or more and consumed high fat diet for 6 months In one mouse, the inflammatory response began to progress, and it was confirmed that non-alcoholic fatty liver hepatitis with fibrosis persisted in chronic inflammatory state at 9 months or more after high-fat diet (Fig. 2).

As a result, it was confirmed that mouse model that consumed high-fat diet for 3 months was steatosis and model of non-alcoholic lipid hepatitis (NASH) consumed for 9 months. These samples were used to confirm the expression of each candidate microRNA Respectively.

It was confirmed that miR-34a and miR-494-3p among the microRNAs were overregulated in non-alcoholic fatty liver disease (NASH) (FIGS. 3 and 4).

In addition, miR-451 among the microRNAs was found to be downregulated in non-alcoholic fatty liver disease (NASH) (Fig. 5).

<110> CATHOLIC UNIVERSITY INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> Biomaker miR-494-3p for distinguishing non-alcoholic          steatohepatitis <160> 7 <170> Kopatentin 1.71 <210> 1 <211> 22 <212> RNA <213> Homo sapiens <400> 1 uggcaguguc uuagcugguu gu 22 <210> 2 <211> 22 <212> RNA <213> Homo sapiens <400> 2 ugaaacauac acgggaaacc uc 22 <210> 3 <211> 22 <212> RNA <213> Homo sapiens <400> 3 aaaccguuac cauuacugag uu 22 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> miR-34a Forward Primer <400> 4 tggcagtgtc ttagctggtt gt 22 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> miR-494 Forward Primer <400> 5 tgaaacatac acgggaaacc tc 22 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> miR-451 Forward Primer <400> 6 tgggaatggc aaggaaaccg 20 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> The U6 small nuclear RNA Forward Primer <400> 7 gcttcggcag cacatatact aaaat 25

Claims (8)

A composition for distinguishing nonalcoholic fatty liver disease from simple fatty liver comprising an agent capable of measuring the expression level of miR-494-3p.
2. The composition of claim 1, wherein the miR-494-3p comprises the nucleotide sequence of SEQ ID NO: 2.
The composition of claim 1, wherein the agent capable of measuring the expression level of miR-494-3p is an antisense oligonucleotide complementary to miR-494-3p, a primer or a probe.
A kit for the differential diagnosis of nonalcoholic fatty liver disease from simple fatty liver comprising the composition of any one of claims 1 to 3.
A method for detecting miR-494-3p from a patient's sample to provide information necessary to differentiate nonalcoholic fatty liver disease from simple fatty liver.
The method according to claim 5, wherein the sample is a sample selected from the group consisting of tissue, cell, blood, serum, plasma, saliva and urine of a patient.
6. The method of claim 5, further comprising the step of distinguishing the patient as a non-alcoholic fatty liver disease when miR-494-3p is detected to be relatively overexpressed in a patient sample relative to a simple fatty sample.
6. The method of claim 5, wherein the detection of miR-494-3p is performed through real-time PCR.

Images