CN108251541A

CN108251541A - A kind of detection MTRR gene SNP site Genotyping PCR primers and method

Info

Publication number: CN108251541A
Application number: CN201810235241.2A
Authority: CN
Inventors: 何震宇; 顾取良
Original assignee: Guangdong Pharmaceutical University
Current assignee: Guangdong Pharmaceutical University
Priority date: 2018-03-21
Filing date: 2018-03-21
Publication date: 2018-07-06
Anticipated expiration: 2038-03-21
Also published as: CN108251541B

Abstract

The invention discloses a kind of methods and kit for detecting MTRR gene rs1801394 polymorphic site genotype, the genotype in its based on PCR RFLP methods detection MTRR gene rs1801394 sites, internal reference restriction enzyme site of the PCR product with NdeI or its isoschizomers, use quick restriction endonuclease digestion PCR product, restriction map is obtained for Genotyping, the parting time can be shortened.Comprehensive descision can be made to result according to the characteristic bands that should occur after remaining PCR product, remaining digestion intermediate product and each genotype samples complete degestion simultaneously, avoid conventional method genotype caused by digestion is incomplete and judge by accident.

Description

A kind of detection MTRR gene SNP site Genotyping PCR primers and method

Technical field

The invention belongs to Molecular Detection field, (i.e. rs1801394 is more for more particularly to a kind of detection MTRR gene SNP sites State property site) Genotyping PCR primer and method.

Background technology

Folic acid has important physiological function to human body, but human body itself cannot synthesize folic acid, it is necessary to from food intake. Folic acid supplement is insufficient or Utilization ability difference can cause folic acid deficiency, leads to hyperhomocysteinemiainjury, and it is athero- to increase artery The danger of hardening, thrombus generation and hypertension；Folic acid deficiency can also cause the hypomethylation of DNA, increase the danger of certain cancers It is dangerous；Pregnant woman, which lacks folic acid, can lead to Fetal Birth Defect, and pregnant woman itself also will appear many ill symptoms, but folic acid supplemented Amount can also cause various side effects.

Methionine synthetase reductase, that is, 5-methyltetrahydrofolate-homocysteine methyltransgerase reductase (5- Methyltetrahydrofolate-homocysteine methyltransferase reductase, MTRR) it is folic acid generation Thank to one of key enzyme of access.The main function of MTRR is that the methionine synthetase of inactivation is reduced to activated state, and first Methyllanthionine synzyme can assist methionine, tetrahydrofolic acid and homocysteine to maintain appropriate concentration level.MTRR Mutation is to cause the Etiological of folic acid/methyl vitamin-deficiency and abnormal main of homocysteine, folic acid metabolism One of reason, and the metabolism of homocysteine, folic acid and Down syndromes (mongolism), nerve channel disease, cardiovascular disease The diseases such as disease are related, therefore MTRR mutation are considered as the high risk factor of these diseases.

The MTRR assignments of genes gene mapping are in chromosome 5p15.2-15.3, and sequence length 32,021bp is (referring to GenBank dependency numbers According to https://www.ncbi.nlm.nih.gov/nuccore/NG_008856.1), the polypeptide of 698 amino acid residues of coding Chain is (referring to GenBank related datas https://www.ncbi.nlm.nih.gov/protein/NP_002445.2), MTRR (dbSNP sequence datas are shown in Fig. 1, base sequence such as SEQ ID NO to gene rs1801394 mononucleotide polymorphism sites：15 institutes Show) it is the 66th bit base A → G of its opening code-reading frame (A66G, corresponding to 203 of mRNA sequence NM_002454.2 in GenBank 6757 bit bases of bit base or genome sequence NG_008856.1), cause its encode zymoprotein (the 22nd amino acids) by Isoleucine (Ile) becomes methionine (Met) (Ile22Met, I22M), which leads to its enzyme activity and homocysteine The rate that methylates reduces, and causes the generation of relevant disease.In dbSNP databases, polymorphic site in global population etc. Position gene frequency distribution be：A accounts for 57.4%, G and accounts for 42.6% or so.The polymorphic site allele in Chinese population Frequency distribution is：A accounts for 75%, G and accounts for 25% or so.

At present, the method for detection MTRR gene rs1801394 genotype has PCR-RFLP methods, PCR sequencing PCR, fluorescent PCR, base Because of chip etc..Other than PCR-RFLP methods, other methods are both needed to expensive device or the high personnel of reagent, competency profiling, cumbersome Operation, high testing cost.PCR-RFLP methods are easy to operate, low to instrument and equipment requirement, convenient for application.The document report site Mainly be detected using restriction endonuclease NdeI, also have indivedual laboratories using restriction endonuclease NspI into Row detection, but the cost of the latter is higher than the former, with Thermo Scientific^TMFor the fast enzyme of company, NspI for 576 yuan/ 50 times, and NdeI is 540 yuan/300 times, i.e. the former cost is the latter more than 6 times.Either use NdeI or NspI enzymes It cuts, when there is the incomplete situation of digestion using existing method, all it is possible that genotype is caused to be judged by accident, concrete analysis is as follows:

1、Zhu H,Wicker NJ,Shaw GM,Lammer EJ,Hendricks K,Suarez L,Canfield M, Finnell RH.Homocysteine remethylation enzyme polymorphisms and increased Risks for neural tube defects [J] .Mol Genet Metab, 2003,78 (3):216-221.

2、Barbosa PR,Stabler SP,Machado AL,Braga RC,Hirata RD,Hirata MH, Sampaio-Neto LF,Allen RH,Guerra-Shinohara EM.Association between decreased vitamin levels and MTHFR,MTR and MTRR gene polymorphisms as determinants for elevated total homocysteine concentrations in pregnant women[J].Eur J Clin Nutr[J],2008,62(8):1010-1021.

3、Zhang J,Zhou YW,Shi HP,Wang YZ,Li GL,Yu HT,Xie XY.5,10- Methylenetetrahydrofolate reductase(MTHFR),methionine synthase(MTRR),and methionine synthase reductase(MTR)gene polymorphisms and adult meningioma risk[J].J Neurooncol,2013,115(2):233-239.

4、Rai V,Yadav U,Kumar P,Yadav SK.Analysis of methionine synthase reductase polymorphism(A66G)in Indian Muslim population[J].Indian J Hum Genet,2013,19(2):183-187.

5、Mfady DS,Sadiq MF,Khabour OF,Fararjeh AS,Abu-Awad A,Khader Y.Associations of variants in MTHFR and MTRR genes with male infertility in the Jordanian population[J].Gene,536(1):40-44.

Such as above-mentioned table Literature 1, in the enzymatic cleavage methods with NdeI detection restriction enzyme sites, PCR product 145bp, A etc. Position gene enzyme will generate 125bp and 20bp segments after cutting entirely, G allele will be kept as PCR product without cleavage site The segment of size, that is, 145bp.If the sample digestion of an AA type is incomplete, existing 125bp, 20bp band, and remain 145bp Segment will be likely to be mistaken for AG pattern product.It is, therefore, desirable to provide a kind of efficient detection MTRR gene polymorphism sites bases Because of the method for type, the defects of to make up the prior art.

In order to save the time that PCR-RFLP is used to carry out Genotyping, quick restriction nuclease inscribe may be used at present Enzyme (referred to as fast enzyme) carries out digestion, and traditional digestions is usually 4~16 hours, and most of fast enzymes can be at 5~15 minutes Digestion of the interior completion to PCR product, but fast enzyme NdeI belongs to atypical, and Thermo Scientific companies are directed to the explanation of the enzyme It is mentioned in book and digests the time of PCR product for >=60min, it means that fast efficiency phases of the enzyme NdeI when cutting PCR product For other fast enzymes or relatively low, it is meant that it is larger that it digests the incomplete possibility of PCR product digestion, if using passing The design of primers of system, the possibility of genotype erroneous judgement increase.

Invention content

In view of the deficienciess of the prior art, the present invention uses restriction endonuclease NdeI detections MTRR to existing The method in gene rs1801394 sites is improved so that PCR product carries matter of the internal reference restriction enzyme site as digestion Control, it can overcome quick restriction endonuclease NdeI digestion PCR product relatively inefficient so as to be easy to cause digestion not Complete situation can identify the incomplete situation of digestion, and in the incomplete feelings of digestion according to the electrophoresis pattern of digestion products Under condition, PCR product and the background interference of digestion intermediate product can be excluded, is judged according to the situation of the characteristic bands of each genotype Genotype, it is ensured that the accuracy that genotype differentiates.

The primary and foremost purpose of the present invention is to provide a kind of side for detecting MTRR gene rs1801394 polymorphic site genotype Method.

Another object of the present invention is to provide a kind of reagent for detecting MTRR gene rs1801394 polymorphic site genotype Box.

The technical solution used in the present invention is：

A kind of PCR primer for being used to detect MTRR gene rs1801394 polymorphic site Genotypings, the PCR primer Obtained product is expanded containing there are one internal reference NdeI restriction enzyme sites and an identification sequences for including rs1801394 polymorphic sites Row；The internal reference NdeI restriction enzyme sites can be identified and cut by NdeI or its isoschizomers；The polymorphic site is known Other sequence is only identified by identical restriction endonuclease in the case where polymorphic site is by one of which base and is cut It cuts；The distance between the internal reference NdeI restriction enzyme sites and polymorphic site, which are subject to its digestion products, to be distinguished.

Further, the internal reference restriction enzyme site is CATATG；The identification sequence of the polymorphic site is CATRTG patterns, wherein R are any one of polymorphic site base, two kinds of bases of R=A, G；The restriction nuclease Restriction endonuclease is NdeI or its isoschizomers.

Further, the forward primer of the PCR primer centering 3rd bit base reciprocal is C, the with MTRR genes 6754 bit base mispairing so that the base sequence AATRTG that MTRR genes are the 6754th~6759 becomes CATRTG after PCR；Its Middle R is any one of rs1801394 polymorphic site bases, two kinds of bases of R=A, G, when R is A, the identification sequence energy Enough to be identified and cut by restriction endonuclease NdeI or its isoschizomers, when R is G, which can not be restricted Endonuclease NdeI or its isoschizomers are identified and are cut；Accession number of the MTRR genes on GenBank is NG_ 008856.1。

Further, the target sequence of the reverse primer in the PCR primer is located at the 7072nd~7077 alkali of MTRR genes After basic sequence CATATG.

Further, the PCR primer is:

Forward primer F：

5′-CCGGGAGCTGCATGTGTCAGAGGCAAAGGCCATCGCAGAAGACAT-3′(SEQ ID NO:1),

Reverse primer R：5′-CGCAAATGGGCGGTAGGCGTGGGACACTGAGATTCAAGAG-3′(SEQ ID NO: 2)。

A kind of method for detecting MTRR gene rs1801394 polymorphic site Genotypings, includes the following steps：

1) genomic DNA of sample is extracted；

2) PCR primer is designed：Design such as PCR primer described in any one of the above embodiments；

3) PCR amplification is carried out to sample gene group DNA using the PCR primer designed by step 2)；

4) digestion is carried out to PCR product using specific restriction endonuclease；

5) genotype of MTRR gene rs1801394 polymorphic sites is determined according to the electrophoresis pattern of digestion products.

Further, the PCR primer is following sequence：

Forward primer F：

5′-CCGGGAGCTGCATGTGTCAGAGGCAAAGGCCATCGCAGAAGACAT-3′(SEQ ID NO:1),

Reverse primer R：5′-CGCAAATGGGCGGTAGGCGTGGGACACTGAGATTCAAGAG-3′(SEQ ID NO: 2)；

Further, the specific side of rs1801394 polymorphic site genotype is determined according to the electrophoresis pattern of digestion products Method is：After NdeI digestion PCR products, the genotype of sample judges by the situation of two characteristic bands of 363bp, 318bp；

There are 318bp bands in gained band after NdeI digestions, there is no 363bp bands, sample rs1801394 polymorphisms The genotype in site is wild-type homozygote AA；

There is no 318bp bands in gained band after NdeI digestions, but there are 363bp bands, sample rs1801394 is more The genotype in state property site is saltant type homozygote GG；

The existing 318bp bands in gained band after NdeI digestions, and when having 363bp bands, if 363bp bands ratio The brightness of 318bp bands is high, then is heterozygote AG；If 363bp bands are more shallow than the brightness of 318bp band, for wild-type homozygous Sub- AA samples.

Further, the segment molar ratio of 363bp, 318bp are 1 in theory in real heterozygote AG：1, syncaryon After acid dye, 363bp segments are higher than the brightness of 318bp segment；On the contrary, wild-type homozygote AA samples are when digestion is incomplete, The digestion intermediate product of 363bp can be remained, while will appear the band of 318bp, but the band of 363bp is brighter than 318bp item It spends shallow, and often also has some other digestion intermediate product more than 363bp or even the PCR product not being digested.

A kind of kit for being used to detect MTRR gene rs1801394 polymorphic site Genotypings, contains above-mentioned Primer and corresponding restriction endonuclease described in one.

Further, the restriction endonuclease is NdeI restriction endonucleases or its isoschizomers.

The beneficial effects of the invention are as follows：

The present invention introduces internal reference restriction enzyme site in PCR product, overcomes fast enzyme NdeI cutting PCR products used It is relatively inefficient, the incomplete drawback of digestion is be easy to cause, can identify that digestion is incomplete according to the electrophoresis pattern of digestion products Situation, it is and incomplete in digestion, still can genotype be differentiated according to the situation of the characteristic bands of each genotype, Ensure the accuracy that genotype differentiates.

Testing cost of the present invention is relatively low, accuracy is high, parting speed, easy to operate, suitable for kit scale Metaplasia is produced.

Description of the drawings

Fig. 1 is rs1801394 polymorphic sites and front and rear correlated series in GenBank dbSNP databases, and R is SNP Point base, R=A or G (sequence reference https://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi Rs=1801394)；

Fig. 2 is the sequence of each 1000 bases before and after MTRR gene rs1801394 polymorphic sites (with reference to https:// Www.ncbi.nlm.nih.gov/nuccore/NG_008856.1, the 6757th bit base be polymorphic site base, this sequence Show the base A of wild-type allele)；

Fig. 3 is MTRR gene rs1801394 polymorphic site Genotyping forward primer F and reverse primer R and template pair Answering relational graph, (template sequence refers to https://www.ncbi.nlm.nih.gov/nuccore/NG_008856.1), wherein SNP is located at the 6757th；Forward primer correlated series and genome sequence are in the same direction, reverse primer correlated series and genome sequence Reverse complemental；By 5 ' → 3 ' direction, F the 3rd bit base C of inverse and template T mispairing so that corresponding sequence AATRTG is in PCR After become CATRTG, to achieve the purpose that screen the polymorphic site with NdeI or isoschizomers.PCR product is in polymorphic site Contain intrinsic NdeI or isoschizomers identification sequence C ATATG (the 7072nd~7077 bit base for corresponding to MTRR genes) in downstream；

5 ' the ends of another F attached one section of additional sequences unrelated with template, it is intended to increase polymorphic site be digested out with Difference in length between the segment not being digested out improves the resolution ratio of electrophoresis；In order to keep close with the annealing temperature of F, R's 5 ' ends also attached one section of additional sequences unrelated with template；Appended sequence employed in the present embodiment is：F5 ' ends are additional Sequence is CCGGGAGCTGCATGTGTCAGAGG (SEQ ID NO:3)；R 5 ' holds the additional sequence to be CGCAAATGGGCGGTAGGCGTG(SEQ ID NO:4)。

Fig. 4 is MTRR gene rs1801394 sites PCR product electrophoretogram；M marks (Beijing village ally border for DNA molecular amount Biological gene Science and Technology Ltd. DNA Marker I：700,600,500,400,300,200,100bp)；1-10 is PCR product, Size is 478bp.

Fig. 5 is one of MTRR gene rs1801394 sites PCR product NdeI digestion parting electrophoresis patterns；M is DNA molecular Amount label (DNA Marker I：700,600,500,400,300,200,100bp)；1-10 is PCR product, size 478bp.P For PCR product, size 478bp.1-7 is the PCR product digestion band of 7 kinds of different samples, wherein 1,2,4,5 digestions are complete, It can clearly judge very much its genotype for 1 (AA), 2 (AG), 4 (AA), 5 (GG)；3rd, 6,7 digestions are incomplete, not only there is PCR Product remains, also other digestion intermediate product band residuals, such as visible faint 363bp bands, it is clear that it is digestion Intermediate product, because band of adjacent 318bp is clearly under it, if 363bp bands are real digestion last items eventually If band, the band that color should be than 318bp is deep.Because heterozygote AG will appear the feature combination of 363bp, 318bp Band, and the molar ratio of 363bp, 318bp band is 1：1 relationship, the dyestuff that big band (363bp) combines should be than small item Band (318bp) is more, and band should be deep.Therefore 3,6,7 be apparently not heterozygote AG, but wild-type homozygote AA.

Fig. 6 is the two of MTRR gene rs1801394 sites PCR product NdeI digestion parting electrophoresis patterns, and wherein A figures are this Chromatic graph, B figures are inverse figure；M marks (DNA Marker I for DNA molecular amount：700,600,500,400,300,200,100bp)； P is the PCR product of 478bp.1-6 is the digestion products of different samples, there are the incomplete situation of digestion that degree differs, In 1, No. 5 sample have PCR product residual；2nd, 3,4,6 banding patterns are consistent, have digestion intermediate product to remain, but these residues Will not interference characteristic band identification, 6 samples can understand parting, and 2,3,4,6 be wild-type homozygote AA, and 5 be heterozygote AG, 1 is saltant type homozygote GG.

Fig. 7 is MTRR gene rs1801394 sites PCR product sequencing peak figure；1. the CATATG that centre circle gets up is PCR product In NdeI internal reference restriction enzyme sites.2. 3. the sequence that 4. centre circle gets up is polymorphic site context, wherein arrow is signified It is 2. wild-type homozygote AA for polymorphic site base；3. for heterozygote AG；4. for saltant type homozygote GG.

Specific embodiment

With reference to specific embodiment, the present invention is further illustrated.

A kind of design of primers for detecting MTRR gene rs1801394 polymorphic site Genotypings of embodiment 1

The present embodiment devises pair of primers, transfers each 1000bp before and after MTRR gene rs1801394 polymorphic sites Sequence (see Fig. 2), the wherein base sequence of the 6121st~7260 of MTRR genes such as SEQ ID NO：Shown in 16, according to the sequence Row are to the specific serotype specific primer of rs1801394 SNP site designs.Wherein, polymorphic site is adjoined at 3 ' ends of forward primer, and 3rd bit base reciprocal is C, and sequence is identified into one by pcr amplification primer to realizeCATRTG, whereinCIt is introduced by base mismatch, The corresponding sequence of wild-type allele A isCATATG, can be by NdeI or isoschizomers identification cutting；Mutant allele G's Corresponding sequence isCATGTG, it is impossible to by restriction endonuclease NdeI or isoschizomers identification cutting, therefore can be split with NdeI or same Enzyme screens the polymorphic site.The end of forward primer 5 ' adds one section of sequence unrelated with template, it is intended to increase polymorphic site quilt The difference in length between the segment that is not digested out is opened in digestion, improves the resolution ratio of electrophoresis.Reverse primer is located at one inherently CATATG sequences after, and maintained a certain distance with the sequence, convenient for the digestion internal reference as NdeI or isoschizomers, be The Tm values of reverse primer and the Tm values of forward primer is made to keep close, 5 ' ends also attached one section of unrelated sequences (see Fig. 3).

The present embodiment devises following pair of primers and meets above-mentioned requirements：

Forward primer F:5′-CCGGGAGCTGCATGTGTCAGAGGCAAAGGCCATCGCAGAAGACAT-3′(SEQ ID NO：1)；

Reverse primer R:5′-CGCAAATGGGCGGTAGGCGTGGGACACTGAGATTCAAGAG-3′(SEQ ID NO： 2)。

Wherein forward primer F 5 ' holds the additional sequence to be：CCGGGAGCTGCATGTGTCAGAGG(SEQ ID NO:3)；

Reverse primer R 5 ' holds the additional sequence to be：CGCAAATGGGCGGTAGGCGTG(SEQ ID NO:4).

The specific location to primer and see Fig. 4 with the correspondence of template (for convenience, forward primer is related in figure Sequence is consistent with template sequence direction, reverse primer correlated series and template sequence reverse complemental).

A kind of method for detecting MTRR gene rs1801394 polymorphic site genotype of embodiment 2

1) extracting genome DNA

Using the buccal swab genome DNA extracting reagent kit of Tiangeng company, the operating procedure of by specification extracts people's Mouth epithelial cells genomic DNA.DNA sources are without being limited thereto, the DNA of any somatic sources.

2) PCR amplification of target fragment

PCR reaction systems：

PCR reaction conditions：

PCR product is identified using 1.5% agarose gel electrophoresis.

3) the digestion parting of PCR product

The restriction endonuclease that the present embodiment uses is the quick restriction nuclease inscribe of Thermo Scientific Enzyme NdeI.

Digestion system total volume is 30 μ L, and specific formula is as follows：

The amount (X μ L) of wherein PCR product can be adjusted depending on the concentration of PCR product.

Digestion keeps the temperature 5min to inactivate restriction endonuclease, is then judged by electrophoresis in 37 DEG C of water-bath 1h, then 65 DEG C of water-baths Genotype.

The PCR product size of the primer pair amplifies is 478bp, after with NdeI complete degestion PCR products, 3 kinds of genotype The band of sample is as follows：

Wild-type homozygote AA：318bp、115bp、45bp；

Heterozygote AG：363bp、318bp、115bp、45bp；

Saltant type homozygote GG：363bp、115bp.

Due to the band of 115bp, which kind of genotype all has, and can bypass and not see, 45bp bands are too weak, and non-key Band, therefore the differentiation of 3 kinds of genotype is reduced to：

Wild-type homozygote AA：318bp；

Heterozygote AG：363bp、318bp；

Saltant type homozygote GG：363bp；

I.e. the band of 363bp, 318bp are the characteristic bands for distinguishing 3 kinds of genotype, it is worth mentioning at this point that, in heterozygote AG The segment molar ratio of middle 363bp, 318bp are 1：1, after nucleic acid dye, segment face that the segment of 363bp ought to be than 318bp Color is deep.

If digestion is incomplete, it will residual PCR product or other digestion intermediate product bands, by with PCR product, Marker is compareed, and this system can be identified, and can be according to two kinds of feature items of 363bp, 318bp in restriction enzyme mapping easily The combined situation of band and the concentration relationship of the two judge genotype.

To sum up, with after NdeI digestion PCR products, the genotype of sample relies on the shape of two characteristic bands of 363bp, 318bp Condition judges：

The existing 318bp bands in gained band after NdeI digestions, and when having 363bp bands, if 363bp bands ratio The brightness of 318bp bands is high, then is heterozygote AG；If 363bp bands are more shallow than the brightness of 318bp band, for wild-type homozygous Sub- AA samples.Because the segment molar ratio of 363bp, 318bp are 1 in theory in real heterozygote AG：1, it is contaminated with reference to nucleic acid After material, 363bp segments are higher than the brightness of 318bp segment；On the contrary, wild-type homozygote AA samples, when digestion is incomplete, meeting is residual The digestion intermediate product of 363bp is stayed, while will appear the band of 318bp, but the band of 363bp is more shallow than the brightness of 318bp item, And often there are some other digestion intermediate product more than 363bp or even the PCR product not being digested.

4) accuracy of sequence verification this method

3 kinds of genotype samples of above-mentioned PCR-RFLP methods detection are chosen, by its corresponding PCR product student on commission work biology work Journey (Shanghai) limited company carries out Sanger method sequencings.

A kind of method for detecting MTRR gene rs1801394 polymorphic site genotype of embodiment 3

1) extracting genome DNA

Extract subject's cell genomic dna.

2) PCR amplification of target fragment

PCR amplification is carried out using forward primer F, the reverse primer R that the present invention designs, obtains PCR primer.

3) the digestion parting of PCR product

Digestion is carried out to PCR product using restriction endonuclease NdeI.The agarose gel electrophoresis of pcr amplification product See that Fig. 4, swimming lane 1-10 are PCR product, size is 478bp, and target stripe size meets.

The Fig. 5 that sees of the electrophoresis pattern after PCR product digestion, P are produced for PCR using restriction endonuclease NdeI Object, size 478bp；Swimming lane 1-7 is the PCR product digestion band of 7 kinds of different samples, can be with wherein 1,2,4,5 digestions are complete Clearly judge very much its genotype for 1 (AA), 2 (AG), 4 (AA), 5 (GG)；3rd, 6,7 digestions are incomplete, not only there is PCR product Residual, also other digestion intermediate product band residuals, such as visible faint 363bp bands, it is the centre of a digestion Product, the band colour developing of close 318bp become apparent from.If if 363bp bands are the whole last band of real digestion, Color should be than 318bp band it is deep because heterozygote AG will appear the feature combined sheet of 363bp, 318bp, and 363bp, The molar ratio of 318bp bands is 1：1 relationship, the dyestuff that 363bp bands combine should be more than small 318bp bands, and band should be deep Some, so 3,6,7 be apparently not heterozygote AG, but wild-type homozygote AA.

The two of PCR product restriction enzyme digestion and electrophoresis collection of illustrative plates see that the PCR that Fig. 6 (A figures are this chromatic graph, and B figures are inverse), P are 478bp is produced Object, swimming lane 1-6 are the digestion products of different samples, and there are the incomplete situations of digestion that degree differs.Wherein 1, No. 5 sample There is PCR product residual；2nd, 3,4,6 banding patterns are consistent, have digestion intermediate product residual, but the not identification of interference characteristic band, as a result Judgement 2,3,4,6 is wild-type homozygote AA, and 5 be heterozygote AG, and 1 is saltant type homozygote GG.

4) accuracy of sequence verification this method

3 kinds of genotype samples for choosing the present embodiment carry out Sanger methods sequencing (see Fig. 7).It is found by comparing, PCR- RFLP is consistent with the testing result being sequenced, rate of accuracy reached 100%.

Above example is only to introduce the preferred case of the present invention, to those skilled in the art, without departing substantially from this Any obvious changes and improvements carried out in the range of spirit are regarded as the part of the present invention.

SEQUENCE LISTING

<110>Guangdong pharmaceutical university

<120>A kind of detection MTRR gene SNP site Genotyping PCR primers and method

<130>

<160> 16

<170> PatentIn version 3.5

<210> 1

<211> 45

<212> DNA

<213>Artificial sequence

<400> 1

ccgggagctg catgtgtcag aggcaaaggc catcgcagaa gacat 45

<210> 2

<211> 40

<212> DNA

<213>Artificial sequence

<400> 2

cgcaaatggg cggtaggcgt gggacactga gattcaagag 40

<210> 3

<211> 23

<212> DNA

<213>Artificial sequence

<400> 3

ccgggagctg catgtgtcag agg 23

<210> 4

<211> 21

<212> DNA

<213>Artificial sequence

<400> 4

cgcaaatggg cggtaggcgt g 21

<210> 5

<211> 23

<212> DNA

<213>Artificial sequence

<400> 5

gcaaaggcca tcgcagaaga cat 23

<210> 6

<211> 22

<212> DNA

<213>Artificial sequence

<400> 6

tggtggtatt agtgtccttt tg 22

<210> 7

<211> 20

<212> DNA

<213>Artificial sequence

<400> 7

aaggccatcg cagaagacat 20

<210> 8

<211> 26

<212> DNA

<213>Artificial sequence

<400> 8

cacttcccaa ccaaaattct tcaaag 26

<210> 9

<211> 26

<212> DNA

<213>Artificial sequence

<400> 9

caggcaaagg ccatcgcaga agacat 26

<210> 10

<211> 26

<212> DNA

<213>Artificial sequence

<400> 10

cacttcccaa ccaaaattct tcaaag 26

<210> 11

<211> 23

<212> DNA

<213>Artificial sequence

<400> 11

gcaaaggcca tcgcagaaga cat 23

<210> 12

<211> 26

<212> DNA

<213>Artificial sequence

<400> 12

gtgaagatct gcagaaaatc catgta 26

<210> 13

<211> 23

<212> DNA

<213>Artificial sequence

<400> 13

gcaaaggcca tcgcagaaga cat 23

<210> 14

<211> 25

<212> DNA

<213>Artificial sequence

<400> 14

aaacggtaaa atccactgta acggc 25

<210> 15

<211> 1112

<212> DNA

<213>Artificial sequence

<400> 15

tgggaagtga tagaaatttt agctgtagta aggttttcat tatcgtttcc accgttttct 60

gtgagctgtc aatgtgtagt gttttcatat tgtttattca ctcattcaga taacttatcg 120

agtaccagtt tcatgccagg tgccgttctg ggcggttcat tcaccgaaag ccaagmtttt 180

ggtttggrtt tcagtttaaa tctgtctctg caaattgaca gcccaccaat tttagccgtt 240

agatgagtat ggaaaaaaat ctgtgagtgt cgtttgtttt actactgctt atctcttgcg 300

gaaaaacgtg ttagtaaaat gtttaagtgg attggaaata ttttttcgtt atatgcaccc 360

gtttgtatat atgcccatac actcacatat ttttgatttg cattaaataa tgaaggagag 420

tatgtgcttc agttaccttt agtactatga ttagtttgtt tagcgttagg atcaaataag 480

aaccaagaat cctatcattt taatatagtt tttactttta tcttttttta aaaagaggaa 540

accaaaagct atttaagact gttgtgaatg atactgtggc tcaagttttg ttcaggttct 600

tggcttgtgc cacatcgttt ttcaggtagg tggtaatact ctcattttta ggataaagga 660

gctgtggtac ggatcatttg gggagcttgt ctacagggtt gcacttagga aacacagatt 720

caagcccaag tagtttcgag ccgatcatct gatttctgag ccatggaatt agagtttcat 780

tcgtacactc tccttaattt gatgaattct tatttaggct catttgagat tagtgctgaa 840

aacaaattta gaaaaggcca tttcatatta tgtgtgggta ttgttgcatt gtttcttaaa 900

gattgaggga gaattaatat ctttaggttg ttactgcttc attaaaaaga ggatcttttt 960

tcccccattt ttcagtttca ctgttacatg ccttgaagtg atgaggaggt ttctgttact 1020

atatgctaca cagcagggac aggcaaaggc catcgcagaa gaaatrtgtg agcaagctgt 1080

ggtacatgga ttttctgcag atcttcactg ta 1112

<210> 16

<211> 1140

<212> DNA

<213>Artificial sequence

<400> 16

cagttacctt tagtactatg attagtttgt ttagcgttag gatcaaataa gaaccaagaa 60

tcctatcatt ttaatatagt ttttactttt atcttttttt aaaaagagga aaccaaaagc 120

tatttaagac tgttgtgaat gatactgtgg ctcaagtttt gttcaggttc ttggcttgtg 180

ccacatcgtt tttcaggtag gtggtaatac tctcattttt aggataaagg agctgtggta 240

cggatcattt ggggagcttg tctacagggt tgcacttagg aaacacagat tcaagcccaa 300

gtagtttcga gccgatcatc tgatttctga gccatggaat tagagtttca ttcgtacact 360

ctccttaatt tgatgaattc ttatttaggc tcatttgaga ttagtgctga aaacaaattt 420

agaaaaggcc atttcatatt atgtgtgggt attgttgcat tgtttcttaa agattgaggg 480

agaattaata tctttaggtt gttactgctt cattaaaaag aggatctttt ttcccccatt 540

tttcagtttc actgttacat gccttgaagt gatgaggagg tttctgttac tatatgctac 600

acagcaggga caggcaaagg ccatcgcaga agaaatatgt gagcaagctg tggtacatgg 660

attttctgca gatcttcact gtattagtga atccgataag gttagagccg ttacagtgga 720

ttttaccgtt ttgtgctttg aagaattttg gttgggaagt gatatttatg aaacaaaagg 780

acactaatac caccacatag tctttgtttt ttaacagaaa tgtgtttgtt caatggtata 840

gtaagatatc accagcattt ttttaatata gaagtgtgta gttgaattag actaaatggt 900

ctcaaaaatt gaaacaagta acaactcctt aactgtaaat gacagaagta gcatatgctg 960

tgtctgtttc acagggtggc tgtgagaaca agtgagatgt gtgtttgcct gctcaggtgt 1020

gctttccacc tcttgaatct cagtgtccca cttttttccc caaaagaaag gccttgccgt 1080

gcgtgttaga gttcctcctg atgaaggacc gcctagattc ttttgtgaaa tagaatttaa 1140

Claims

1. a kind of PCR primer for being used to detect MTRR gene rs1801394 polymorphic site Genotypings, it is characterised in that：Institute It states the product that PCR primer expands and contains that there are one internal reference NdeI restriction enzyme sites and one to include rs1801394 polymorphic positions The identification sequence of point；The internal reference NdeI restriction enzyme sites can be identified and cut by NdeI or its isoschizomers；Described is more State property site recognition sequence is only in the case where polymorphic site is one of which base by identical restriction nuclease inscribe Enzyme identifies cutting；The distance between the internal reference NdeI restriction enzyme sites and polymorphic site can be by with its digestion products Subject to differentiation.

2. PCR primer according to claim 1, which is characterized in that the internal reference restriction enzyme site is CATATG；It is described Polymorphic site identification sequence for CATRTG patterns, wherein R is polymorphic site base, times in R A, G two kind base What is a kind of；The restriction endonuclease is NdeI or its isoschizomers.

3. PCR primer according to claim 1, which is characterized in that the forward primer inverse of the PCR primer centering 3 bit bases be C, the 6754th bit base mispairing with MTRR genes so that the base sequence that MTRR genes are the 6754th~6759 AATRTG becomes CATRTG after PCR；Wherein R is rs1801394 polymorphic site bases, any in two kinds of bases of R=A, G One kind, when R is A, which can be identified and cut by restriction endonuclease NdeI or its isoschizomers, when R is G When, which can not be identified and cut by restriction endonuclease NdeI or its isoschizomers；The MTRR genes exist Accession number on GenBank is NG_008856.1.

4. PCR primer according to claim 1, which is characterized in that the target sequence of the reverse primer in PCR primer is located at After the 7072nd~7077 bit base sequence C ATATG of MTRR genes.

5. according to Claims 1 to 4 any one of them PCR primer, which is characterized in that the PCR primer is:

Forward primer F：

5′-CCGGGAGCTGCATGTGTCAGAGGCAAAGGCCATCGCAGAAGACAT-3′(SEQ ID NO:1),

Reverse primer R：5′-CGCAAATGGGCGGTAGGCGTGGGACACTGAGATTCAAGAG-3′(SEQ ID NO:2).

A kind of 6. method for detecting MTRR gene rs1801394 polymorphic site Genotypings, which is characterized in that including following step Suddenly：

1) genomic DNA of sample is extracted；

2) PCR primer is designed：Design such as Claims 1 to 5 any one of them PCR primer；

7. according to the method described in claim 6, it is characterized in that, the PCR primer is following sequence：

Forward primer F：

5′-CCGGGAGCTGCATGTGTCAGAGGCAAAGGCCATCGCAGAAGACAT-3′(SEQ ID NO:1)；

8. the method according to the description of claim 7 is characterized in that the electrophoresis pattern according to digestion products determines rs1801394 The specific method of polymorphic site genotype is：

After NdeI digestion PCR products, the genotype of sample judges by the situation of two characteristic bands of 363bp, 318bp, There are 318bp bands in gained band after NdeI digestions, there is no 363bp bands, the base of sample rs1801394 polymorphic sites Because type is wild-type homozygote AA；

There is no 318bp bands in gained band after NdeI digestions, but there are 363bp bands, sample rs1801394 polymorphisms The genotype in site is saltant type homozygote GG；

The existing 318bp bands in gained band after NdeI digestions, and when having 363bp bands, if 363bp bands are than 318bp item The brightness of band is high, then is heterozygote AG；If 363bp bands are more shallow than the brightness of 318bp band, for wild-type homozygote AA samples Product.

A kind of 9. kit for being used to detect MTRR gene rs1801394 polymorphic site Genotypings, which is characterized in that the examination Agent box contains Claims 1 to 5 any one of them primer and corresponding restriction endonuclease.

10. according to the method described in claim 9, which is characterized in that the restriction endonuclease for NdeI restriction endonucleases or Its isoschizomers.