CN105567847A - Method for detecting polymorphism rs9005 of human stomach cancer susceptibility gene IL-1RN through MspI - Google Patents
Method for detecting polymorphism rs9005 of human stomach cancer susceptibility gene IL-1RN through MspI Download PDFInfo
- Publication number
- CN105567847A CN105567847A CN201610095044.6A CN201610095044A CN105567847A CN 105567847 A CN105567847 A CN 105567847A CN 201610095044 A CN201610095044 A CN 201610095044A CN 105567847 A CN105567847 A CN 105567847A
- Authority
- CN
- China
- Prior art keywords
- primer
- genotype
- restriction enzyme
- dna
- mspi
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
- C12Q1/683—Hybridisation assays for detection of mutation or polymorphism involving restriction enzymes, e.g. restriction fragment length polymorphism [RFLP]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Pathology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for detecting polymorphism rs9005 of a human stomach cancer susceptibility gene IL-1RN through MspI. A polymerase chain reaction-restrictive fragment length polymorphism method is adopted, target DNA fragments are amplified through a polymerase chain reaction, then digestion is conducted on the DNA fragments to be detected with restriction enzyme, the restriction enzyme identifies and cuts a specific sequence, then a product obtained after digestion is subjected to electrophoresis, then specific cutting loci of the sequence are analyzed through a restriction enzyme map, and difference of gene sequences of different sources is compared through fragment diversity. Briefly speaking, the corresponding target fragments are amplified through the PCR, then a restriction enzyme digestion reaction is conducted, and difference of the sequences is analyzed by observing the restrictive map after electrophoresis is conducted. The method is good in repeatability, easy to operate and low in cost, and the digestion result is easy to identify.
Description
Technical field
The invention belongs to biological technical field, relate to a kind of method that MspI detects people's stomach cancer susceptible genes IL-1RN polymorphism rs9005.
Background technology
Single nucleotide polymorphism (singlenucleotidepolymorphism, SNP), mainly refers to the DNA sequence polymorphism caused by the variation of single core thuja acid in genomic level.It is modal one in the heritable variation of the mankind.Account for more than 90% of all known polymorphisms.SNP extensively exists in human genome, on average just has 1 in every 500 ~ 1000 base pairs, estimate its sum can reach 3,000,000 even more.CAPs (cleavedamplificationpolymorphismsequence-taggedsites) CAPs technology is also called PCR-RFLP, restriction fragment length polymorphism polymerase chain reaction (PCR-RFLP) technology.The ultimate principle of PCR-RFLP uses pcr amplification target DNA, and amplified production cuts into different size fragment with specificity endonuclease digestion again, directly differentiates in gel electrophoresis.Not homoallelic restriction enzyme site distribution is different, produces the DNA fragmentation band of different lengths.Technique substantially increases content and the relative specificity of target DNA, and method is easy, and the somatotype time is short.This method, compared with RFLP, instead of enzyme cut unlike with amplification, avoids the steps such as the loaded down with trivial details DNA enzymatic of RFLP is cut, shifted, hybridization.
In worldwide, cancer of the stomach remains one of the highest malignant tumour of M & M.Cancer of the stomach be a multi-step, multifactor, the multistage, the coefficient result of number of mechanisms, comprises genetic factors, biotic factor and multiple environmental risk factors.Although the existing significant decline of the mortality ratio of cancer of the stomach in recent years, the five year survival rate of cancer of the stomach is still very low.Inflammatory reaction and the research of relation between tumor are the focuses of relevant focus of attention always, the experimental results show stomach helicobacter pylori infection and stomach chronic inflammatory diseases in close relations.Helicobacter pylori infection and immune cytokine be interleukin family significant correlation especially.Increasing result of study shows inflammatory cytokine, as IL-1, IL-1R1 and TNF-α can affect the susceptibility of cancer of the stomach significantly.Therefore, cancer of the stomach gene genetic diversity is studied necessary.As the cytokine that a class is important, IL-1 family gene can participate in physiological process widely, and one of them important role regulates acute and chronic inflammation disease.IL-1 plays keying action in startup and enhancing in the reaction of helicobacter pylori infection, also play very strong gastric acid secretion inhibiting effect, and long-term gastric acid secretion inhibiting effect is the major cause causing the precancerous lesions such as atrophy of gastric mucosa simultaneously.Much research finds that the gene pleiomorphism of IL-1 gene family is relevant to gastric cancer susceptibility.IL-1RN achieves greater advance in the research of tumor area in recent years, but it carries out relatively less in the research in cancer of the stomach field, the IL-1RN loci polymorphism of therefore certain function being correlated with combines with cancer of the stomach better can inquire into its effect to cancer of the stomach forming process, discloses the cognation that itself and cancer of the stomach occur and then the concrete molecular mechanism inquired into wherein.
Sequence specific primers PCR also claims ApoE gene (AS-PCR), its principle be based on TaqDNA polymerase can not DNA plerosis primer at the single base mispairing of 3 ' end.So when 3 ' terminal nucleotide and the complementation of allelic variation site sequences of primer, then template is amplified.But, when primer 3 ' terminal nucleotide and template mispairing, then template can not be amplified or amplification efficiency extremely low.Each allelic detection, need design two cover primers, and a set of is allele-specific primers, and a set of is general primer.After PCR primer gel electrophoresis, whether the existence of DNA is detected by ultraviolet (uv) transmission, and existence or the disappearance of DNA band can determine genotype.Another pair of primers (one section of the human growth hormone gene that usually increases) in same reaction always produces a DNA segment, has nothing to do, as the control of PCR validity with HPA genotype.The shortcoming of gene specific PCR (AS-PCR) is that amplification efficiency is lower, and specific amplification is poor, and therefore the specificity of PCR primer and stability cannot ensure, meanwhile, genotyping result is also easier to erroneous judgement, less stable.
TaqMan probe method adds a specific fluorescent probe in addition when referring to pcr amplification while adding pair of primers, this probe only with template specificity combine, its binding site is between two primers.5 ' end of probe is marked with fluorescent reporter group (Reporter, R), and as FAM, VIC etc., 3 ' end is marked with fluorescent quenching group (Quencher, Q), as TAMRA etc.When probe is complete time, the fluorescence that 5 ' end reporter group excites through light source for instrument is just in time held fluorophor cancellation by in-plant 3 ', instrument can't detect the fluorescent signal (emission wavelength of 5 ' fluorophor is just in time the absorbing wavelength of 3 ' fluorophor in other words, and thus energy is delivered to 3 ' fluorophor by absorption and sends other fluorescence) that 5 ' end reporter group excites.Along with the carrying out of PCR, Taq enzyme runs into the probe be combined with template in chain extension process, (this activity is double-stranded specific to its 5 '-3 ' 5 prime excision enzyme activity, free single-stranded probe is unaffected) will will cut probe, release 5 ' end reporter group is free in reaction system, away from the shielding of 3 ' end fluorescent quenching group, 5 ' end reporter group launched fluorescent signal that is stimulated just can be detected by probe.That is often increase a DNA chain, and just have a fluorescence molecule to be formed, the accumulation and the PCR primer that achieve fluorescent signal form Complete Synchronization.The intensity of report signal just represents the copy number of template DNA.
Taqman fluorescence probe method needs expensive instrument and longer step, and cost is higher, is difficult to popularize use in the lab.
The shortcoming of dye method gene method for qualitative analysis is that as long as the DNA of double-strand can in conjunction with luminescence, therefore, specificity is poor because dye method specificity is not strong.
In sum, in order to finally realize the sickness rate reducing cancer of the stomach, this area is in the urgent need to stomach cancer susceptible genes, and the test kit of the detection stomach cancer susceptible genes that development and operation is simple, cost is low, applied widely.
Summary of the invention
In order to overcome the defect existed in prior art, the invention provides a kind of method that MspI detects people's stomach cancer susceptible genes IL-1RN polymorphism rs9005, adopt PCR machine (PCR-RFLP) method, adopt polymerase chain reaction (PCR) to increase target DNA fragment, then by DNA fragmentation digestion with restriction enzyme to be detected, restriction enzyme identification also cuts special sequence, then the product after being cut by enzyme carries out electrophoresis, analyze the special of this section of sequence by restriction endonuclease map (restrictionmap) again and cut site, diversity by fragment carrys out the otherness of comparison different sources gene order.In brief, be exactly the corresponding object segment of first pcr amplification, then carry out restriction enzyme and cut reaction, after electrophoresis, observation and comparison restriction map carrys out the difference between analytical sequence.This method is reproducible, and operation is comparatively simple, and cost is low, and enzyme cuts the easy identification of result.Therefore, the object of this invention is to provide method and the detection kit of a kind of simple to operate, detection people stomach cancer susceptible genes IL-1RN polymorphism rs9005 that cost is low, applied widely.
Its technical scheme is as follows:
MspI detects a method of people's stomach cancer susceptible genes IL-1RN polymorphism rs9005, comprises the following steps:
The genomic dna of (a) extracting sample;
B () provides forward primer and the reverse primer of amplification people IL-1RN gene pleiomorphism rs9005 location proximate sequence, rs9005 upstream primer: 5 '-GCACTTGGAGACTTGTATG-3 ', rs9005 downstream primer: 5 '-GTGAGGCTGAAGGAAGAA-3 ', the human gene group DNA to be measured extracted with step (a) is template, carry out pcr amplification, obtain amplified production;
C () uses restriction enzyme to carry out enzyme to the amplified production obtained in (b) and cuts, obtain corresponding digestion products;
D digestion products adopts the sepharose of 3% to carry out electrophoresis, to judge each genotype of IL-1RN gene pleiomorphism rs9005 by ().Wherein, after electrophoresis, have a band person for AA genotype, two band persons are GG genotype, and three band persons are GA genotype.
Compared with prior art, beneficial effect of the present invention:
The present invention aims to provide a kind of method of simple to operate, detection people stomach cancer susceptible genes IL-1RN polymorphism rs9005 that cost is low, applied widely.Research finds that rs9005 is significantly higher than with GG genotype individuals with the onset risk of the individual cancer of the stomach of A genotype (especially AG genotype).There is provided this method detecting people's stomach cancer susceptible genes IL-1RN polymorphism rs9005 to be easily and efficiently expected to predict the susceptibility of cancer of the stomach in this context, can be used for clinical early diagnosis.
Accompanying drawing explanation
Fig. 1 is pcr amplification reaction program;
Fig. 2 is the electrophoretogram in IL-1RArs9005 site;
Fig. 3 is IL-1RNrs9005 site GG genotype Sequencing chromatogram (backward sequencing);
Fig. 4 is IL-1RNrs9005 site AA genotype Sequencing chromatogram (backward sequencing);
Fig. 5 is IL-1RNrs9005 site GA genotype Sequencing chromatogram (backward sequencing).
Embodiment
Technical scheme of the present invention is further illustrated below in conjunction with drawings and Examples.
The invention provides a kind of method detecting stomach cancer susceptible genes, applied widely owing to identifying the restriction endonuclease MspI of specific site, price is comparatively economical, and then greatly reduces the cost detecting SNP.Find through sequential analysis, detect the polymorphic method of this G/A and can use 8 kinds of enzymes in table 1, in wherein showing, front four kinds of enzymes are all containing a base mismatch, the position of this base mismatch is often very close far from mutational site, this considerably increases the difficulty of design of primers, in addition require that upstream or downstream primer must comprise this base mismatch, this turn increases new difficulty to the design of primer.Consider simple operations and economic and practical, restriction endonuclease MspI is only selection.
The price of the restriction enzyme provided in table 1 is from NEB company (http://www.neb-china.com), does the selection of restriction enzyme obtain (http://watcut.uwaterloo.ca/template.php from WatCut restriction endonuclease analysis software? act=snp_new), in this, as the reference of restriction enzyme enzyme recognition site and price.
Several restriction endonuclease recognition sequence of table 1 and price thereof
In enforcement of the present invention, the design of forward primer and reverse primer adopts Primer6.0 software to carry out, and the principle of design considers the impact of the sensitivity of primer pair pcr amplification, specific degree and amplification efficiency.According to the principle design primer that base is unpaired mutually, primer length, generally between 15 ~ 30 bases, long or shortly all can cause poor specificity, and long its elongating temperature that also can cause is greater than 74 DEG C, is unsuitable for Taq DNA polymerase and reacts.Primer GC content is between 40% ~ 60%, and Tm value is best close to 72 DEG C, GC too high levels or be too lowly all unfavorable for initiation reaction.Base wants stochastic distribution, should not there is complementary sequence between primer self and primer, otherwise primer self can be folded into hairpin structure makes the renaturation of primer own.Primer 5 ' is held and middle Δ G value should be relatively high, and 3 ' end Δ G value is lower.The strand of amplified production can not form secondary structure.Primer should have specificity, after design of primers completes, tackles it and carries out BLAST detection, to guarantee that itself and other gene does not have complementarity.On this basis, the upstream primer finally chosen is 5 '-GCACTTGGAGACTTGTATG-3 ', and downstream primer is 5 '-GTGAGGCTGAAGGAAGAA-3 '.The fragment 374bp in face that goes out of primer amplification thus, amplified production is as follows:
GCACTTGGAGACTTGTATGAAAGATGGCTGTGCCTCTGCCTGTCTCCCCCACCRGGCTGGGAGCTCTGCAGAGCAGGAAACATGACTCGTATATGTCTCAGGTCCCTGCAGGGCCAAGCACCTAGCCTCGCTCTTGGCAGGTACTCAGCGAATGAATGCTGTATATGTTGGGTGCAAAGTTCCCTACTTCCTGTGACTTCAGCTCTGTTTTACAATAAAATCTTGAAAATGCCTATATTGTTGACTATGTCCTTGGCCTTGACAGGCTTTGGGTATAGAGTGCTGAGGAAACTGAAAGACCAATGTGTCTTTCTTACCCCAGAGGCTGGCGCCTCCTGGCTTCTCTGAGAGTTCTT
TTCTTCCTTCAGCCTCAC(374bp)
Underscore part is respectively forward primer and reverse primer, and the 54th bpR represents the polymorphic i.e. SNP site rs9005 of A/G.This length is that the amplified production of 341bp can produce 374bp after restriction endonuclease MspI enzyme is cut, 320bp (this fragment downstream sequence is compared the sticky end that upstream sequence cuts generation due to MspI enzyme and reduced by two strand bases), 54bp (this fragment downstream sequence compares the sticky end that upstream sequence cuts generation due to MspI enzyme increases by two strand bases) totally three kinds of clip types.Genotype result of determination: AA mutated-genotype, long is 374bp; GG wild-type genotype, long is 320bp and 54bp two band; GA heterozygous genotypes, long is 374bp, 320bp and 54bp tri-band.
Gel electrophoresis is divided into agarose gel electrophoresis and polyacrylamide gel electrophoresis, and agarose (Agarose) is a kind of linear polysaccharide polymkeric substance, is extract from Red seaweeds product agar and come.After agarose solution is heated to boiling point, cooled and solidified just can form good electrophoretic medium, and its density is determined by the concentration of agarose, can be used for the PAGE production of DNA fragmentation.Polyacrylamide gel mainly contains two kinds of modes: one is for separating of the non-denaturing polyacrylamide gel with purifying double chain DNA fragment, two be for separating of and the denaturing polyacrylamide gel of purification of single stranded DNA fragmentation.But consider practicality, convenience and economy, use agarose gel electrophoresis to can yet be regarded as a kind of optimal selection.In the present invention, as shown in Figure 1, object amplified production uses enzyme in restriction endonuclease MspI5U water-bath to cut 6-14h to primer amplification condition.Digestion products adopts the agarose of 3% to carry out agarose gel electrophoresis, judges wild homozygous genotype, heterozygous genotypes and mutant homozygous genotype under ultra violet lamp according to different bands.
In the present invention, the reaction conditions of PCR amplification system is not particularly limited, PCR-based principle three step and arrange sex change-annealing-extension three temperature spot.In standard reaction, adopt three temperature spot methods, double-stranded DNA 90 ~ 95 DEG C of sex change, then is cooled to rapidly 40 ~ 60 DEG C, primer annealing is also attached on target sequence, then be rapidly heated to 70 ~ 75 DEG C, under the effect of Taq DNA polymerase, primer strand extended along template.Two temperature spot methods can be adopted for shorter target gene (when length is 100 ~ 300bp), except denaturation temperature, annealing and elongating temperature can unite two into one, general employing 94 DEG C of sex change, about 65 DEG C annealing and extension (this temperature TaqDNA enzyme still has higher catalytic activity).And higher concentration and purity requirement be there is no yet for DNA to be measured, the DNA that both can be human body fluid or extract in organizing, also can be through the genome of degradation treatment in advance.But for convenience of implementation and to reduce experimenter painful, ordinary priority selects the extraction carrying out genomic dna from blood.
The present invention is through studying for many years, demonstrate IL-1RN gene mononucleotide polymorphism site rs9005 first and be arranged in introne 3 '-UTR, find to there is significant difference (P<0.05) in the distribution of IL-1RN gene rs9005G → A in case and control group.The invention provides a kind of method detecting gastric cancer susceptibility gene on this basis, also disclose corresponding detection kit, this test kit contains the primer in amplification site.Utilize the genotype of detection site of the present invention, method is simple, rapidly and efficiently, with low cost, and the diagnosis for cancer of the stomach provides a simple and direct new way.
In specific embodiment of the invention scheme, the concrete steps that the present invention detects people IL-1RN gene polymorphic rs9005 are as follows:
L () extracts human gene group DNA's template to be measured, described human gene group DNA's template is the human genome template that human body any part obtains.
(2) pcr amplification genomic dna, carries out pcr amplification to the templet gene group DNA extracted, and obtains the PCR primer containing polymorphic neighbouring sequence.
(3) endonuclease reaction is carried out to pcr amplification product restriction endonuclease MspI, obtain digestion products;
(4) digestion products carries out agarose and carries out agarose gel electrophoresis, under ultra violet lamp, judge wild homozygous genotype according to different bands, heterozygous genotypes and mutant homozygous genotype.
Below each key step above-mentioned is described in detail:
1 materials and methods
1.1 key instruments and reagent
Instrument: BCD-228CH refrigerator (newly flying electrical equipment), HH-2 digital display thermostat water bath (magnificent peak instrument), SmartGel gel imaging instrument (Beijing match intelligence is started an undertaking), GT9612 grads PCR instrument (hundred Tykes are biological), WD900SL23-2 model microwave oven (Glanz electrical equipment), DG-300C type electrophoresis apparatus (ancient cooking vessel state is prosperous biological) etc.
Reagent: NEP004-1DNA extracts test kit (ancient cooking vessel state is prosperous biological), 50bpDNALadder (Lay is thing humorously), 2 × TaqPCRMix (Lay is thing humorously), MspI (Thermo), agarose (SIGMA) etc.
1.2 design of primers
In the dbSNP database of NCBI, the nucleotide sequence searching IL-1RNrs9005 is as follows:
AATTAGGATTTCATGATTTTTTTTTTTCAGTCCCCGTGAAGGAGAGCCCTTCATTTGGAGATTATGTTCTTTCGGGGAGAGGCTGAGGACTTAAAATATTCCTGCATTTGTGAAATGATGGTGAAAGTAAGTGGTAGCTTTTCCCTTCTTTTTCTTCTTTTTTTGTGATGTCCCAACTTGTAAAAATTAAAAGTTATGGTACTATGTTAGCCCCATAATTTTTTTTTTCCTTTTAAAACACTTCCATAATCTGGACTCCTCTGTCCAGGCACTGCTGCCCAGCCTCCAAGCTCCATCTCCACTCCAGATTTTTTACAGCTGCCTGCAGTACTTTACCTCCTATCAGAAGTTTCTCAGCTCCCAAGGCTCTGAGCAAATGTGGCTCCTGGGGGTTCTTTCTTCCTCTGCTGAAGGAATAAATTGCTCCTTGACATTGTAGAGCTTCTGGCACTTGGAGACTTGTATGAAAGATGGCTGTGCCTCTGCCTGTCTCCCCCACCRGGCTGGGAGCTCTGCAGAGCAGGAAACATGACTCGTATATGTCTCAGGTCCCTGCAGGGCCAAGCACCTAGCCTCGCTCTTGGCAGGTACTCAGCGAATGAATGCTGTATATGTTGGGTGCAAAGTTCCCTACTTCCTGTGACTTCAGCTCTGTTTTACAATAAAATCTTGAAAATGCCTATATTGTTGACTATGTCCTTGGCCTTGACAGGCTTTGGGTATAGAGTGCTGAGGAAACTGAAAGACCAATGTGTCTTTCTTACCCCAGAGGCTGGCGCCTGGCCTCTTCTCTGAGAGTTCTTTTCTTCCTTCAGCCTCACTCTCCCTGGATAACATGAGAGCAAATCTCTCTGCAAAAAAGATATGGGGCAGCACTGTCCACAACAGCCTCTGCTGGAAACAACCCAAGCACCCATCACAGAATGAATTAGTACATCATGTATCTGCACACAACACAGTGCTCCTTGGCAAAGAAAATGAATGAATTACAGCCAGCTGCA
It is polymorphic that 501st base R of gene order represents A/G, is the pleomorphism site of rs9005.Above sequence is affixed in primer-design software PrimerPremier6.0, the parameter such as primer length and amplification object fragment length is set and carries out design of primers, optimum upstream and downstream primer is selected according to GC content and annealing temperature etc., again the Blast sequence alignment function (http://blast.ncbi.nlm.nih.gov/Blast.cgi) in this primer and Pubmed is carried out primer comparison, the upstream and downstream primer finally determined is forward primer sequence: 5 '-GCACTTGGAGACTTGTATG-3 ', reverse primer sequences: 5 '-GTGAGGCTGAAGGAAGAA-3 ', the method (as solid-phase synthesis) that the synthesis of primer can adopt this area general, also biotech firm can be entrusted to synthesize.
The selection of 1.3 restriction enzymes
According to the base sequence in rs9005 site in dbSNP, with the online restriction endonuclease analysis software of WatCut, on-line search obtains the information of the restriction enzyme in identifiable design mutational site, considers the restriction endonuclease MspI that its enzyme cuts specificity and economic and practical Sexual behavior mode the best.
1.4 genomic dnas extracting sample to be tested from whole blood
Genomic dna is extracted in strict accordance with centrifugal column type DNA extraction kit operation steps.
L) add 300 μ l hemocytes in 1.5ml centrifuge tube after, add 900 μ l cell pyrolysis liquids to be again mixed evenly, after placing 10min on ice, the centrifugal 1min of 12000rpm in centrifuges, abandon supernatant, again add 900 μ l cell pyrolysis liquids, blow afloat with rifle and precipitate and after mixing, repeat above-mentioned steps;
2) in throw out, add 600 μ lsolutionB solution, after blowing afloat precipitation gently with liquid-transfering gun, add 10 μ l Proteinase K mixings, place 10min in 70 DEG C of water-baths after, the centrifugal 5min of 12000rpm;
3) proceeded to by the supernatant in centrifuge tube in the new centrifuge tube to compile number, then in new centrifuge tube, add 500 μ l dehydrated alcohols, may there is flocculent precipitate in period, this floss is DNA;
4) liquid of mixing is proceeded to (if once cannot not turn completely, graded proceeds to) in centrifugal column, room temperature leaves standstill 2min, the more centrifugal 1min of 12000rpm, abandons waste liquid;
5) add the solutionC rinsing liquid that 700 μ l have added respective volume dehydrated alcohol, room temperature leaves standstill 2min, and the centrifugal 1min of 12000rpm, abandons waste liquid;
6) add the solutionD rinsing liquid that 700 μ l have added respective volume dehydrated alcohol, room temperature leaves standstill 2min, and the centrifugal 1min of 12000rpm, abandons waste liquid;
7) add 500 μ lsolutionD rinsing liquids, the centrifugal 1min of 12000rpm, abandons waste liquid;
8) recentrifuge 2min, is placed in the centrifuge tube of the new volume number of mistake by centrifugal column, uncoveredly put into 37 DEG C of thermostat container 10min until without obvious ethanol taste;
9) add in silica-based plasma membrane central authorities the solutionE100 μ l being preheating to 65 DEG C, room temperature places the centrifugal 1min of 5min, 12000rpm, repeats above-mentioned steps once, and the liquid after whole centrifugal is the genomic dna extracted;
10) draw the DNA NanoPhotometerPearl micro-spectrophotometer that 2 μ l extract and measure its concentration and purity.
2 results
2.1PCR amplification
(1) according to the concentration extracting genomic dna, the DNA of research object is diluted, makes final concentration be 20 μ g/ μ l.
(2) PCR amplification system is each 0.3 μ l of 2 × TaqPCRMix7.5 μ l, upstream primer and downstream primer, template DNA 1.0 μ l, finally supplements cumulative volume to 15 μ l with distilled water.
(3) the PCR reaction conditions in rs9005 site: first stage is the denaturation stage, 94 DEG C/5min; Second stage comprises totally 35 circulations of three steps, set gradually be 94 DEG C/30s, 57.6 DEG C of annealing time 45s, 72 DEG C/45s; Three phases 72 DEG C/5min.Product Sequence after amplification is:
GCACTTGGAGACTTGTATGAAAGATGGCTGTGCCTCTGCCTGTCTCCCCCACCRGGCTGGGAGCTCTGCAGAGCAGGAAACATGACTCGTATATGTCTCAGGTCCCTGCAGGGCCAAGCACCTAGCCTCGCTCTTGGCAGGTACTCAGCGAATGAATGCTGTATATGTTGGGTGCAAAGTTCCCTACTTCCTGTGACTTCAGCTCTGTTTTACAATAAAATCTTGAAAATGCCTATATTGTTGACTATGTCCTTGGCCTTGACAGGCTTTGGGTATAGAGTGCTGAGGAAACTGAAAGACCAATGTGTCTTTCTTACCCCAGAGGCTGGCGCCTCCTGGCTTCTCTGAGAGTTCTT
TTCTTCCTTCAGCCTCAC
Underscore part is respectively forward primer and reverse primer, and the 54th bpR represents the polymorphic i.e. SNP site rs9005 of A/G.
2.2 endonuclease reaction
The enzyme system of cutting is pcr amplification product 5 μ l, upper restriction enzyme 0.5 μ l, Buffer1.0 μ l, finally supplements cumulative volume to 15 μ l with distilled water.Mixing is placed on 37 DEG C of water-bath 4-16 hour in water-bath.
2.3 genotypic judgements
By digestion products with 3% sepharose under the condition of 4-10V/cm, electrophoresis 20-40min, after distinguishing obvious band and qualification of taking pictures to ultraviolet lamp.For different genotype, rs9005 site different genotype shows different bands (see Fig. 2), and AA genotype is a fragment of 374bp; GG genotype is two fragments of 320bp and 54bp; GA genotype is three fragments of 374bp, 320bp and 54bp.Each genotype is all through checking order to identify further, and sequencing result (see Fig. 3-5) display is identical with the result that prior art records.
Embodiment 1. Human Stomach Tissue sample measures people IL-1RNrs9005 polymorphism
In specific embodiment of the invention scheme, the concrete steps detecting people IL-1RN gene polymorphic rs9005 are as follows:
L () obtains the stomach organization of performing the operation and cutting, adopt phenol-chloroform method to extract the genomic dna of stomach organization as DNA to be measured, extraction step is as follows:
1) thawed by stomach organization block, wash away blood stains with physiological saline, the tissue of clip 0.1g is milled, and adds the aqua sterilisa of 1ml, puts upside down mixing, and the centrifugal 10min of 10000rpm, abandons supernatant, and above step repeats twice
2) add the DNA cleavage liquid of 200 μ l, the Proteinase K mixing of 5 μ l, 55 DEG C of water-bath digestion are spent the night.
3) add isopyknic phenol chloroform mixed solution (1:1) after having digested, concuss, make it become milk coffee look.The centrifugal 10min of 12000rpm.
4) avoid when getting supernatant touching intermediate medium and lower floor's liquid.Mixing is put upside down after adding isopyknic chloroform.The centrifugal 10min of 12000rm.
5) get supernatant, note avoiding touching intermediate medium and lower floor's liquid.Add the sodium-acetate of 1/10 and the dehydrated alcohol of 2.5 times, put upside down mixing, the centrifugal 10min of 12000rpm, abandons supernatant.
6) add 1ml70% ethanol, its white precipitate is suspended, put upside down mixing for several times, the centrifugal 10min of 12000rpm, abandons supernatant, and room temperature leaves standstill 5-10min makes ethanol volatilize totally.
7) add 50 μ l aqua sterilisa dissolving DNAs, obtain stomach organization genomic dna.
(2) base sequence information obtains from the dbSNP database of NCBI, CHIP website is checked, specify accurate rear employing PrimerPremier6.0 and design each site primer, in conjunction with annealing temperature, it is forward primer sequence: 5 '-GCACTTGGAGACTTGTATG-3 ' that the information siftings such as the Blast sequence alignment result (http://blast.ncbi.nlm.nih.gov/Blast.cgi) in GC content and Pubmed go out optimum primer, reverse primer sequences: 5 '-GTGAGGCTGAAGGAAGAA-3 ', carry out PCR primer amplification, preparation PCR amplification system: 2 × TaqPCRMix7.5 μ l, distilled water 5.9 μ l, upstream primer 0.3 μ l, downstream primer 0.3 μ l and template DNA 1.0 μ l, namely 15.0 μ lPCR amplification reaction systems are obtained after abundant mixing, according to the first stage: 94 DEG C of sex change 5min, subordinate phase comprises 35 circulations three steps, first 94 DEG C of sex change 30s altogether, 57.6 DEG C of annealing 45s, last 72 DEG C extend 45s, the phase III: 72 DEG C extend 5min, final 4 DEG C store with for subsequent use, must grow the pcr amplification product for 374bp,
(3) in the SNP fragment restriction endonuclease MspI5U water-bath after amplification, enzyme cuts 6-14h, PCR reaction product 5 μ l, restriction enzyme 0.5 μ l, Buffer1.0 μ l and nuclease free pure water 8.5 μ l amounts to 15 μ l enzymes and cuts system, in water-bath, 37 DEG C of enzymes cut 6-14h, obtain digestion products.The restriction enzyme of described identification CCGG sequence is restriction endonuclease MspI and isoschizomers thereof; The restriction enzyme of described identification CCGGG sequence is restriction endonuclease MvaI, NciI, EcoRII and isoschizomers thereof; The restriction enzyme of described identification GCCC sequence is restriction endonuclease BanII, Bsp1286I and isoschizomers thereof; The restriction enzyme of described identification GCCG sequence is restriction endonuclease BstMCI and isoschizomers thereof; The restriction enzyme of described identification GGGCC sequence is restriction endonuclease Sau96I and isoschizomers thereof.But Primer site suddenlys change by rear four kinds of enzyme requires, consider economic and practical and simple operations and finally select MspI to carry out enzyme to cut qualification;
(4) digestion products adopts the agarose of 3% to carry out agarose gel electrophoresis, judges wild homozygous genotype, heterozygous genotypes and mutant homozygous genotype (see table 2) under ultra violet lamp according to different bands.
Table 2rs9005 loci gene type judges
Embodiment 2. human peripheral whole blood sample measures people IL-1RNrs9005 polymorphism
Substantially identical with the step of embodiment 1, just adopt in the following method from human peripheral and extract genomic dna as DNA to be measured.
Carry out the extraction of blood sample genomic dna to be measured according to the operation steps of NEP004-1 Whole Blood Genomic DNA extraction test kit, concrete steps are as follows:
L) add 300 μ l hemocytes in 1.5ml centrifuge tube after, add 900 μ l cell pyrolysis liquids to be again mixed evenly, after placing 10min on ice, the centrifugal 1min of 12000rpm in centrifuges, abandon supernatant, again add 900 μ l cell pyrolysis liquids, blow afloat with rifle and precipitate and after mixing, repeat above-mentioned steps;
2) in throw out, add 600 μ lsolutionB solution, after blowing afloat precipitation gently with liquid-transfering gun, add 10 μ l Proteinase K mixings, place 10min in 70 DEG C of water-baths after, the centrifugal 5min of 12000rpm.
3) proceeded to by the supernatant in centrifuge tube in the new centrifuge tube to compile number, then in new centrifuge tube, add 500 μ l dehydrated alcohols, may there is flocculent precipitate in period, this floss is DNA;
4) liquid of mixing is proceeded to (if once cannot not turn completely, graded proceeds to) in centrifugal column, room temperature leaves standstill 2min, the more centrifugal 1min of 12000rpm, abandons waste liquid;
5) add the solutionC rinsing liquid that 700 μ l have added respective volume dehydrated alcohol, room temperature leaves standstill 2min, and the centrifugal 1min of 12000rpm, abandons waste liquid;
6) add the solutionD rinsing liquid that 700 μ l have added respective volume dehydrated alcohol, room temperature leaves standstill 2min, and the centrifugal 1min of 12000rpm, abandons waste liquid;
7) add 500 μ lsolutionD rinsing liquids, the centrifugal 1min of 12000rpm, abandons waste liquid;
8) recentrifuge 2min, is placed in the centrifuge tube of the new volume number of mistake by centrifugal column, uncoveredly put into 37 DEG C of thermostat container 10min until without obvious ethanol taste;
9) add in silica-based plasma membrane central authorities the solutionE100 μ l being preheating to 65 DEG C, room temperature places the centrifugal 1min of 5min, 12000rpm, repeats above-mentioned steps once, and the liquid after whole centrifugal is the genomic dna extracted.
Step according to case one after extracting complete genomic dna carries out genotypic qualification, and qualification result is as follows: by digestion products qualification of taking pictures under ultraviolet lamp after the agarose gel electrophoresis of 3%.For different genotype, rs9005 site different genotype shows different bands (see Fig. 2), and GG isozygotys wild-type genotype, 320bp and 54bp two band; GA heterozygous genotypes, long is 374bp, 320bp and 54bp tri-band; AA homozygous mutant genotypes, long is 374bp mono-band.Each genotype is all through checking order to identify further, and sequencing result (see Fig. 3-5) display is identical with the result that prior art records.
The above, be only best mode for carrying out the invention, is anyly familiar with those skilled in the art in the technical scope that the present invention discloses, and the simple change of the technical scheme that can obtain apparently or equivalence are replaced and all fallen within the scope of protection of the present invention.
Claims (1)
1. detect a method of people's stomach cancer susceptible genes IL-1RN polymorphism rs9005 with MspI, it is characterized in that, comprise the following steps:
The genomic dna of (a) extracting sample;
B () provides forward primer and the reverse primer of amplification people IL-1RN gene pleiomorphism rs9005 location proximate sequence, rs9005 upstream primer: 5 '-GCACTTGGAGACTTGTATG-3 ', rs9005 downstream primer: 5 '-GTGAGGCTGAAGGAAGAA-3 ', the human gene group DNA to be measured extracted with step (a) is template, carry out pcr amplification, obtain amplified production;
C () uses restriction enzyme to carry out enzyme to the amplified production obtained in (b) and cuts, obtain corresponding digestion products;
D digestion products adopts the sepharose of 3% to carry out electrophoresis, to judge each genotype of IL-1RN gene pleiomorphism rs9005 by (); Wherein, after electrophoresis, have a band person for AA genotype, two band persons are GG genotype, and three band persons are GA genotype.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610095044.6A CN105567847A (en) | 2016-02-22 | 2016-02-22 | Method for detecting polymorphism rs9005 of human stomach cancer susceptibility gene IL-1RN through MspI |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610095044.6A CN105567847A (en) | 2016-02-22 | 2016-02-22 | Method for detecting polymorphism rs9005 of human stomach cancer susceptibility gene IL-1RN through MspI |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105567847A true CN105567847A (en) | 2016-05-11 |
Family
ID=55878463
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610095044.6A Pending CN105567847A (en) | 2016-02-22 | 2016-02-22 | Method for detecting polymorphism rs9005 of human stomach cancer susceptibility gene IL-1RN through MspI |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105567847A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107130054A (en) * | 2017-07-06 | 2017-09-05 | 河南省医药科学研究院 | With the method for HaeIII surveyor's LNCRNA HOTTIP gene rs1859168 polymorphisms |
| CN107365837A (en) * | 2017-07-06 | 2017-11-21 | 郑州大学 | With BanII identification human gastric cancers ZNF33B 2:The method of 1 gene rs579501 polymorphisms |
| CN108048539A (en) * | 2017-12-21 | 2018-05-18 | 郑州大学第附属医院 | With the method for XcmI detection human oral cancer LINC00520 tumor susceptibility gene rs4144657 polymorphisms |
| CN108588228A (en) * | 2018-07-10 | 2018-09-28 | 河南省肿瘤医院 | Detect the primer and kit of human breast carcinoma gene M IR2052HG polymorphisms rs200237842 |
| CN108823313A (en) * | 2018-07-10 | 2018-11-16 | 河南省肿瘤医院 | A kind of primer and kit detecting human breast carcinoma gene PCAT1 polymorphism rs4473999 |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104736723A (en) * | 2012-08-06 | 2015-06-24 | 默克专利有限公司 | Genetic markers for predicting responsiveness to FGF-18 compound |
| CN104755629A (en) * | 2012-08-06 | 2015-07-01 | 默克专利有限公司 | Prognosis biomarkers in cartilage disorders |
-
2016
- 2016-02-22 CN CN201610095044.6A patent/CN105567847A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104736723A (en) * | 2012-08-06 | 2015-06-24 | 默克专利有限公司 | Genetic markers for predicting responsiveness to FGF-18 compound |
| CN104755629A (en) * | 2012-08-06 | 2015-07-01 | 默克专利有限公司 | Prognosis biomarkers in cartilage disorders |
Non-Patent Citations (2)
| Title |
|---|
| CHEN X ET AL.: "Associations of Il-1 Family-Related Polymorphisms With Gastric Cancer Risk and the Role of Mir-197 In Il-1f5 Expression", 《MEDICINE(BALTIMORE)》 * |
| Z ZHANG ET AL: "Two genes encoding immune-regulatory molecules (LAG3 and IL7R) confer susceptibility to multiple sclerosis", 《GENES AND IMMUNITY》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107130054A (en) * | 2017-07-06 | 2017-09-05 | 河南省医药科学研究院 | With the method for HaeIII surveyor's LNCRNA HOTTIP gene rs1859168 polymorphisms |
| CN107365837A (en) * | 2017-07-06 | 2017-11-21 | 郑州大学 | With BanII identification human gastric cancers ZNF33B 2:The method of 1 gene rs579501 polymorphisms |
| CN108048539A (en) * | 2017-12-21 | 2018-05-18 | 郑州大学第附属医院 | With the method for XcmI detection human oral cancer LINC00520 tumor susceptibility gene rs4144657 polymorphisms |
| CN108588228A (en) * | 2018-07-10 | 2018-09-28 | 河南省肿瘤医院 | Detect the primer and kit of human breast carcinoma gene M IR2052HG polymorphisms rs200237842 |
| CN108823313A (en) * | 2018-07-10 | 2018-11-16 | 河南省肿瘤医院 | A kind of primer and kit detecting human breast carcinoma gene PCAT1 polymorphism rs4473999 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105586427B (en) | Primers, kit and method for detecting human BRCA1 and BRCA2 gene mutation | |
| CN105567847A (en) | Method for detecting polymorphism rs9005 of human stomach cancer susceptibility gene IL-1RN through MspI | |
| JP2010535031A (en) | Target sequence enrichment | |
| CN104805206B (en) | The kit and its detection method of detection TERT gene promoter mutation | |
| CN101532051A (en) | Method for detecting the polymorphism of ADH2 genes | |
| CN104293920A (en) | Kit for quickly detecting polymorphism of human VKORC1 and CYP2CP genes and using method of kit | |
| JP2012040029A (en) | Method for detecting mutation and kit used in the same | |
| CN110484621A (en) | A kind of method of liver cancer early warning | |
| CN114672568A (en) | Kit for detecting cervical cell gene methylation | |
| CN106498034A (en) | A kind of method for identifying human breast carcinoma MALAT1 gene rs619586 polymorphisms with BseNI | |
| CN105695614A (en) | Method for identifying polymorphism of human breast cancer genes BRCA1 rs8176318 by aid of NsiI | |
| CN107012232A (en) | Primer and detection method for detecting the related SNP site of gastric cancer susceptibility | |
| CN112442525B (en) | Kit for detecting human natural killer cell immunoglobulin-like receptor KIR genotyping | |
| CN106434925A (en) | Method for identifying polymorphism of human breast cancer LINC-ROR gene rs6420545 with NsiI | |
| CN106434877A (en) | Method for detecting esophagus cancer susceptibility gene PTEN polymorphism with Hae III | |
| CN105695613A (en) | Method for detecting polymorphism of human gastric cancer susceptible genes IL17A rs3748067 by aid of ApoI | |
| CN106319071A (en) | Method for identifying human breast cancer LINC-ROR (Long Intergenic Non-Protein Coding RNA, Regulator Of Reprogramming) gene rs4801078 polymorphism by BsmAI | |
| CN105695615A (en) | Method for identifying polymorphism of human breast cancer genes RAD51 rs7180135 by aid of BccI | |
| CN107828868A (en) | With the method for HindIII identification human breast carcinoma BCAR4 gene rs13334967 polymorphisms | |
| CN109321658B (en) | Kit for detecting susceptibility of cervical cancer | |
| JP5866669B2 (en) | Breast cancer susceptibility determination method | |
| CN105925712A (en) | Method for identifying rs45549040 polymorphism of human esophageal cancer RAD51 gene by virtue of XmnI | |
| CN107385041A (en) | A kind of method for detecting people's XPA gene label mononucleotide polymorphism sites rs1800975 | |
| CN111172248A (en) | General kit for verifying copy number variation based on fragment analysis technology | |
| CN108823313A (en) | A kind of primer and kit detecting human breast carcinoma gene PCAT1 polymorphism rs4473999 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160511 |