CN106319071A - Method for identifying human breast cancer LINC-ROR (Long Intergenic Non-Protein Coding RNA, Regulator Of Reprogramming) gene rs4801078 polymorphism by BsmAI - Google Patents

Abstract

The invention discloses a method for identifying human breast cancer LINC-ROR (Long Intergenic Non-Protein Coding RNA, Regulator of Reprogramming) gene rs4801078 polymorphism by BsmAI. The method comprises the following steps of extracting sample genome DNA (deoxyribose nucleic acid); providing forward primers and reverse primers of sequences near LINC-ROR gene polymorphism rs4801078 sites of an amplification person; performing PCR (polymerase chain reaction) by using the human genome DNA to be tested to obtain an amplification product; performing enzyme digestion on the amplification product by using restriction enzymes to obtain corresponding enzyme-digested products; performing electrophoresis on the enzyme-digested products by 3-percent agarose gel for judging each genotype of the LINC-ROR gene rs4801078 polymorphism sites. The built method is simple, fast, safe and accurate; the sensitivity is high; the method is worthy of being popularized in clinics and research, and can be used for other polymorphism gene distribution.

Description

Method by BsmAI surveyor's breast carcinoma LINC-ROR gene rs4801078 polymorphism

Technical field

The invention belongs to biological technical field, relate to one BsmAI surveyor's breast carcinoma LINC-ROR gene The method of rs4801078 polymorphism.

Background technology

Single nucleotide polymorphism (single nucleotide polymorphism, SNP), is primarily referred to as at genome water By the DNA sequence polymorphism caused by the variation of single core thuja acid on Ping, including forms such as the displacement/insert of editing and disappearances. SNP is modal one in the heritable variation of the mankind, be widely used in the genetic linkage analysis of simple and complex disease/ Association analysis and the location of diseases predisposing gene, instruct tumor susceptibility gene to clone. the detection in single base polymorphisms site more typically Method includes PCR machine technology (PCR-RFLP), three-primer amplified allele The methods such as method (TP-PCR) and order-checking.Though these methods are respectively arranged with advantage, but are also respectively arranged with its weak point.

PCR-RFLP is a kind of classical way quick, easy, detection SNP genotype accurately.Its principle is: restricted Restriction endonuclease is class identification DNA specific site (usual 4-6bp), and carries out the enzyme cut at specific site.Restriction enzyme site Specificity means specific allelic catapepsis can be produced same fragment sequence.And the displacement of base, insert and Disappearance can produce or eliminate a specific restriction enzyme site, thus produces size and the number of fragment after changing enzyme action.These enzymes The difference of section section banding pattern is referred to as restriction fragment length polymorphism.If SNP produces and eliminates certain restricted enzyme Site, then can by PCR primer is carried out enzyme action, electrophoresis is detected.The advantage of the method is that quickly and easily, terminal is sentenced Disconnected accurate.But its major defect is the selection of restriction enzyme site, it is desirable to pleomorphism site to be measured is relevant with a certain restriction enzyme site. The selection of PCR-RFLP enzyme has limitation, and not all SNP site can differentiate in this way, and in part Cutting enzyme expensive, experimental cost is high.Three-primer amplified allele method (TP-PCR) one need not restricted enzyme and The recombinant DNA method of ligase.Reaction system has 2 kinds of templates and 3 kinds of primers, thus in same reaction system, produces one Individual recombinant DNA molecules.The major advantage of this method is quick, is independent of the restriction enzyme sites of junction fragment.But its shortcoming is Amplification efficiency is low, and specific amplification is poor, it is impossible to ensureing specificity and the stability of PCR primer, genotyping result easily causes erroneous judgement. Taqman fluorescence probe method is a kind of new and effective methods of genotyping accurately, and its advantage is that detection sensitivity is high, and typing is accurate Really.But the method needs expensive instrument and longer step, relatively costly.

LINC-ROR(Long Intergenic Non-Protein Coding RNA,Regulator Of Reprogramming) belong to long-chain non-coding RNA, be positioned at No. 18 chromosomes of the mankind.LINC-ROR has been confirmed as promoting induction Human pluripotent stem cell (iPSCs), is considered to suppress consideration convey record in the self renewal of the hESC of miRNA mediation The factor.It is reported, as a kind of competitive endogenous RNA, lincRNA ROR by being combined in three negative breast with miR-145 The generation of cancer, invasive procedure play a significant role.Additionally, lincRNA ROR can also be with miR-145 competitive binding in regulation Play a role during the differentiation of endometrium cancer stem cell.

There are three kinds of genotype in LINC-ROR gene rs4801078 loci polymorphism in crowd: TT type (human genome Two allele bases of rs4801078 polymorphic site are T), CT type (the two of human genome rs4801078 polymorphic site Individual allele base is respectively C and T) and CC type (two allele bases of human genome rs4801078 polymorphic site are equal For C) (NIH's state-run medical library biology information technology center, http: // www.ncbi.nlm.nih.gov)。

The qualification of people LINC-ROR gene polymorphic rs4801078 is frequently with PCR-RFLP method at present.But identify at present Expensive (the ginseng about part restriction endonuclease of restricted enzyme that people LINC-ROR gene polymorphic rs4801078 uses often Examine price and refer to table 1 below), experimental cost is high, it is difficult to universal use in the lab.

Summary of the invention

In order to overcome defect present in prior art, the present invention provides a kind of simple to operate, low cost, applied widely The general method using BsmAI surveyor's breast carcinoma LINC-ROR gene rs4801078 polymorphism, by changing of PCR-RFLP technology Enter, the test kit of exploiting economy, quickly detection people's LINC-ROR rs4801078 gene pleiomorphism.

Its technical scheme is as follows:

A kind of method of BsmAI surveyor's breast carcinoma LINC-ROR gene rs4801078 polymorphism, including following step Rapid:

(a) extracting sample gene group DNA；

B () provides the forward primer of amplification people's LINC-ROR gene pleiomorphism rs4801078 location proximate sequence with reverse Primer, with described human gene group DNA to be measured as template, carries out pcr amplification reaction, obtains amplified production；

C () uses restricted enzyme that described amplified production is carried out enzyme action, obtain corresponding digestion products；

D digestion products is used the agarose gel of 3% to carry out electrophoresis, to judge LINC-ROR gene pleiomorphism by () Each genotype in rs4801078 site.

Further, the design of forward primer described in step (b) and reverse primer and synthesis are particularly as follows: base sequence information Obtain from the dbSNP data base of NCBI, CHIP website is checked, determines LINC-ROR polymorphic site nucleotide variation number According to, the partial gene sequence containing LINC-ROR rs4801078 as shown in SEQ:ID:NO:1, the 501st alkali of gene order It is polymorphic that base Y represents C/T, is the pleomorphism site of rs4801078.Particular sequence according to rs4801078 and polymorphism alkali What the position of base used that Primer Premier 6.0 designs have most upstream and downstream primer SEQ:ID:NO:2, SEQ:ID:NO:3 institute Show；

Wherein in forward primer sequence, bit base third from the bottom is base mismatch G, polymorphic neighbouring sequence in PCR primer after mispairing Row are changed to TAGAGAC or TAGAGAT by TAAAGAC or TAAAGAT, and therefore in amplified production, C allele fragment can be known The restricted enzyme BsmAI of other GTCTCN sequence identifies, can cut situation according to fragment and judge polymorphic gene type,

According to forward primer sequence and reverse primer sequences synthetic primer, the synthesis of primer can use solid-phase synthesis, Or entrust biotech firm to synthesize and detect forward and reverse primer.

Further, step (b) is prepared PCR amplification system particularly as follows: 2 × Taq PCR Mix7.5 μ in pcr amplification reaction L, distilled water 5.9 μ l, i.e. obtain 15.0 μ after forward primer 0.3 μ l downstream primer 0.3 μ l and template DNA 1.0 μ l, fully mixing LPCR amplification reaction system；According to the first stage: 94 DEG C of degeneration 5min, second stage includes three steps of 35 circulations altogether, first First 94 DEG C of degeneration 30s, 56.1 DEG C of annealing 45s, last 72 DEG C extend 45s, the phase III: 72 DEG C extend 5min, final 4 DEG C of storages With standby, obtaining the pcr amplification product of a length of 109bp, the Product Sequence after amplification is as shown in SEQ:ID:NO:4.

Further, step (c) carries out the enzyme action system of enzyme action particularly as follows:: PCR product 5 μ l, restricted enzyme 0.5 μ l, Buffer1.0 μ l and nuclease free pure water 8.5 μ l amounts to 15 μ l enzyme action systems, 37 DEG C of enzyme action 6-in water-bath 14h, obtains digestion products, selects BsmAI to carry out enzyme action qualification.

Further, step (d) agarose gel electrophoresis, determine gene pleiomorphism particularly as follows: by digestion products with 3% fine jade Sepharose is under conditions of 4-10V/cm, and electrophoresis 20-40min, after distinguishing obvious band and mirror of taking pictures to uviol lamp Fixed.For different genotype, rs4801078 site different genotype shows different bands, and CC wild-type genotype is a length of 88bp and 21bp two band；CT heterozygous genotypes, a length of 109bp, 88bp and 21bp tri-band；TT mutated-genotype, 109bp mono- Band.

Compared with prior art, beneficial effects of the present invention:

The present invention uses Created Restriction Site method (Created Restriction Site PCR, CRS-PCR), and utilization is drawn Thing base mispairing Technology design detection LINC-ROR polymorphism rs4801078.Mispairing is held owing to this method applies primer 3 ' Technology, PCR primer can carry out the appraisal of genotype, therefore have the biggest in practice after carrying out restriction enzyme digestion and electrophoresis Motility, and detection method is simple, is a kind of better method carrying out single base mutation loci gene type qualification.The present invention The LINC-ROR polymorphism rs4801078 methods of genotyping set up is simple, quick, safe and accurate, highly sensitive, is worth Clinic and research are promoted, and the typing for other Genetic polymorphism can be used for reference.

Accompanying drawing explanation

Fig. 1 is the electrophoresis pattern in LINC-RORrs4801078 site；

Fig. 2 is LINC-RORrs4801078 site CC genotype Sequencing chromatogram (backward sequencing)；

Fig. 3 is LINC-RORrs4801078 site CT genotype Sequencing chromatogram (backward sequencing)；

Fig. 4 is LINC-RORrs4801078 site TT genotype Sequencing chromatogram (backward sequencing).

Detailed description of the invention

Technical scheme is further illustrated below in conjunction with the accompanying drawings with embodiment.

The method of the present invention comprises the following steps:

(a) extracting sample gene group DNA；

B () provides the forward primer of amplification people's LINC-ROR gene pleiomorphism rs4801078 location proximate sequence with reverse Primer, with described human gene group DNA to be measured as template, carries out pcr amplification reaction, obtains amplified production

C () uses restricted enzyme that described amplified production is carried out enzyme action, obtain corresponding digestion products；

D digestion products is used the agarose gel of 3% to carry out electrophoresis, to judge LINC-ROR gene pleiomorphism by () Each genotype in rs4801078 site.

Wherein, its 3 ' end bit base last of described forward primer alkali adjacent with polymorphic rs4801078 base Base, bit base third from the bottom is base mismatch G, in order to form GTCTC structure with polymorphic T allele in amplified production.

Sequence near SNP can be changed into and can be determined in advance by the base mismatch on primer by the method for the present invention The sequence of restricted enzyme identification.Therefore, it can overcome traditional needs existing for PCR-RFLP method to use costliness The defect of restriction endonuclease, and then greatly reduce the cost of detection SNP.Concrete principle: due to reciprocal in this forward primer sequence 3rd bit base is base mismatch G (this base relevant position in people's LINC-ROR gene order is A), therefore after mispairing In PCR primer, polymorphic neighbouring sequence is changed to ATAGAGAC by ATAAAGAC.Therefore in amplified production, C allele fragment can quilt Identify the restricted enzyme identification (i.e. C allele fragment can be cut by restriction endonuclease) of GTCTCN sequence；And then, can basis Fragment is cut situation and is judged polymorphic gene type.More specifically, understand through sequence analysis, in gene original series, C/T is polymorphic can By first two restriction endonuclease identification in table 1.As the 4th bit base A before pleomorphism site changed into G by base mispairing PCR, Then this polymorphic comprise GTCTCN sequence for C allele and can be identified the restricted enzyme of GTCTCN sequence after PCR expands BsmAI identifies, and T allele can not cut.

Find through sequence analysis, detect method polymorphic for this G/T and can use three kinds of enzymes in table 1, wherein first two in table Enzyme is expensive, and enzyme action effect is undesirable.Using Created Restriction Site method (Created Restriction Site PCR, CRS-PCR) in reverse primer sequences, antepenulatimate base mispairing is T after, in PCR primer polymorphic near sequence generate ATGCAT sequence, thus can be identified by restricted enzyme BsmAI.Owing to identifying the restricted enzyme BsmAI of specific site Applied widely, price is relatively inexpensive, and then greatly reduces the cost of detection SNP.Therefore, consider simple operations with Economic and practical, restricted enzyme BsmAI is only selection.

The price of the restricted enzyme provided in table 1, from NEB company (http://www.neb-china.com), limits The selection of property restriction endonuclease obtains (http://watcut.uwaterloo.ca/ from WatCut restriction endonuclease analysis software template.php？Act=snp_new), in this, as restriction enzyme enzyme recognition site and the reference of price.

Several restriction endonuclease recognition sequence of table 1 and price thereof

In embodiments of the invention, the Primer6.0 software that is designed with of forward primer and reverse primer is carried out, if The principle of meter considers the impact of sensitivity, specificity and amplification efficiency that PCR is expanded by primer.It is unworthy of mutually according to base To principle design primer, primer length typically between 15～30 bases, the long or too short poor specificity that all can cause, long Also result in its elongating temperature and be more than 74 DEG C, be unsuitable for Taq DNA polymerase and react.Primer G/C content is 40%～60% Between, Tm value is preferably close to 72 DEG C, and G/C content is too high or too low is all unfavorable for initiation reaction.Base wants random distribution, and primer is certainly Should there is not complementary series between body and primer, otherwise primer self can be folded into hairpin structure and make the renaturation of primer own.Primer 5 ' ends and middle △ G-value should be of a relatively high, and 3 ' end △ G-value are relatively low.The strand of amplified production can not form secondary structure.Draw Thing should have specificity, after design of primers completes, tackles it and carries out BLAST detection, to guarantee that it does not has with other gene Complementary.

Final forward primer is constituted by selected from following nucleotide sequence: ATTTCAAGCTCAGATCACTATAGAG；

Reverse primer is constituted by selected from following nucleotide sequence: TCTAAGGGACAGAATAAATAATCGT.

Main sensitivity, specificity and the amplification effect considering that PCR is expanded by primer of the design of forward primer and reverse primer The impact of rate.Generally according to base pair complementarity principle design primer, the sequence of primer and template wants close complementary.Primer length For 15-30bp, the too short or long poor specificity that may result in, long its elongating temperature also can be caused to be unfavorable for PCR more than 74 DEG C Reaction.Reverse primer contains base mismatch T in its 3 ' end antepenulatimate, in order to polymorphic T equipotential base in amplified production Because forming ATGCAT structure, such that it is able to by BsmAI restriction endonuclease identification.Amplified production total length is 109bp, and amplified production is such as Under:

ATTTCAAGCTCAGATCACTATAGAGAYGTTTTTCAATCTATTCCAATGTTTAGTGGAACATCTGAAA GTCACATAGAGCACGGGACGATTATTTATTCTGTCCCTTAGAUnderscore part is respectively forward primer and reverse primer, 27th bpY represents polymorphic i.e. SNP site rs4801078 of C/T.23rd bp is the bases G (being base A originally) after mispairing.Should The amplified production of a length of 109bp can produce 109bp, 88bp (this fragment upstream sequence phase after restricted enzyme BsmAI enzyme action The sticky end produced due to BsmAI enzyme action than downstream sequence increases by 3 strand bases), 21bp (compare by this fragment upstream sequence The sticky end that downstream sequence produces due to BsmAI enzyme action reduces by 3 strand bases) totally three kinds of clip types.Genotype judges Result: CC wild-type genotype, a length of 88bp and 21bp two band；CT heterozygous genotypes, a length of 109bp, 88bp and 21bp tri- Band；TT mutated-genotype, 109bp mono-band.

Gel electrophoresis is divided into agarose gel electrophoresis and polyacrylamide gel electrophoresis, agarose (Agarose) to be a kind of Linear polysaccharide polymer, is to extract from Red seaweeds product agar and come.Cool down after agarose solution is heated to boiling point Solidification will form good electrophoretic medium, and its density is to be determined by the concentration of agarose, can be used for the electrophoresis of DNA fragmentation. Polyacrylamide gel mainly has two ways: one is for separating and the non-denaturing polyacrylamide of purification double chain DNA fragment Gel, two is for separating and the denaturing polyacrylamide gel of purification of single stranded DNA fragmentation.But consider practicality, facility Property and economy, use agarose gel electrophoresis to can yet be regarded as a kind of optimum selection.In the present invention, primer amplification condition such as figure Shown in 1, purpose amplified production uses enzyme action 6-14h in restriction endonuclease BsmAI 3U water-bath.Digestion products uses The agarose of 3% carries out agarose gel electrophoresis, judges wild homozygous genotype according to different bands under ultra violet lamp, Heterozygous genotypes and mutant homozygous genotype.

Below specific embodiments of the present invention are described in detail, but it is emphasized that this invention is not It is limited to described detailed description of the invention.

In specific embodiments of the present invention, the present invention detects human breast carcinoma LINC-ROR gene polymorphic rs4801078 Specifically comprise the following steps that

L () extracts human gene group DNA's template to be measured, described human gene group DNA's template is the people that human body any part obtains Genomic templates.

(2) PCR amplifying genom DNA, carries out PCR amplification to templet gene group DNA extracted, it is thus achieved that containing polymorphic neighbouring sequence The PCR primer of row.

(3) pcr amplification product restriction endonuclease BsmAI is carried out endonuclease reaction, obtain digestion products；

(4) digestion products carries out agarose and carries out agarose gel electrophoresis, according to different bands under ultra violet lamp Judge wild homozygous genotype, heterozygous genotypes and mutant homozygous genotype.

Below each key step above-mentioned is described in detail:

(1) design of primers and synthesis

Base sequence information obtains from the dbSNP data base of NCBI, checks, determine LINC-ROR on CHIP website Polymorphic site nucleotide variation data.

Partial gene sequence containing LINC-RORrs4801078 is as follows:

GCCACACGGGAAGTCCCCAGCCAGCTTGTACAGAGAAATCAAACTTTAGAACAGTCCCCAGGGAGAAGGAAGAAAGT GGGAAtcctgatacccaatggccaaagttcattccatggggaattgactctcctgtacttctgggttatgttatctg gtcccttggcaactgagcaggaagccagatcacacctccttgagcgtggcctgttatgtgatgctagaagcaacaga agcattctgagattcacggcacaagggcacatggctggtggggcttaggtggtggaatgaggatgccttgttgagac tcaggtggagcagaaagctgaaagcccaggtggcaaggtgcagcgaagagaatctgaggagatgaatatgctgtgtc cgatccaATATAGTGATTGCAATCCTGGAAGACCCGTTGTATGTTAAAACCTTTTAAATTTTTTATGTTTATATATG AAAAAGAGTTACATTTCAAGCTCAGATCACTATAGAGAYGTTTTTCAATCTATTCCAATGTTTAGTGGAACATCTGA AAGTCACATAGAGCACGGGACGATTATTTATTCTGTCCCTTAGATTTCAGGAAAATGATCACTGATATTTGtaagtt ttaggccttgttctaggggctttgtaaaggttgattcacagcatgtgcacaacaatcttgggaggtaggcatggtta ttattgccattttacagatgaggaaactgaggccagagaagttTACACAGCCAATCAGTGCTAGAACTGTGATTGGA ACTCAGGGGTCTGGATCTTCAGCGGTTCCAGTCTTCATCCTCTAAATGCCACTGGTATCTCCTCTACCAATTGTTGG GACAAGAAACACACTCCCAGAAATTTCTCCCCAGCCCATGGGAGCAGTATGTTCCCCACAGGCCCTTTGCACAGTTC ACAGATGGACACATGGCCCCCAGGGAGCTGGGCCTGCTGGGGCCACCACCTAGAGCCCCAGGTTTACTAACCCTGAG

It is polymorphic that 501st base Y of gene order represents C/T, is the pleomorphism site of rs4801078.According to What the position of the particular sequence of rs4801078 and polymorphic base used that Primer Premier 6.0 designs most has upstream and downstream Primer is as follows；

Forward primer sequence: 5 '-ATTTCAAGCTCAGATCACTATAGAG-3 '

Reverse primer sequences: 5 '-TCTAAGGGACAGAATAAATAATCGT-3 '.

Wherein in forward primer sequence, bit base third from the bottom is that (this base is in people's LINC-ROR gene sequence for base mismatch G Relevant position in row is A), therefore after mispairing, in PCR primer, polymorphic neighbouring sequence is changed to by TAAAGAC or TAAAGAT TAGAGAC or TAGAGAT (wherein the 7th base C/T polymorphic site, the 3rd base T is base mismatch).Therefore product is expanded In thing C allele fragment can be identified GTCTCN sequence restricted enzyme BsmAI identify (i.e. C allele fragment can Cut by restriction endonuclease).And then, situation can be cut according to fragment and judge polymorphic gene type.

According to forward primer sequence and reverse primer sequences synthetic primer, the synthesis of primer can use generally in the art Method (such as solid-phase synthesis), also can entrust biotech firm to synthesize and detect forward and reverse primer.

(2) PCR amplification system is prepared: 2 × Taq PCR Mix7.5 μ l, distilled water 5.9 μ l, forward primer 0.3 μ l downstream 15.0 μ lPCR amplification reaction systems are i.e. obtained after primer 0.3 μ l and template DNA 1.0 μ l, fully mixing；According to the first stage: 94 DEG C degeneration 5min, second stage includes three steps of 35 circulations altogether, first 94 DEG C degeneration 30s, 56.1 DEG C of annealing 45s, finally 72 DEG C extend 45s, the phase III: 72 DEG C extend 5min, and final 4 DEG C store with standby, and the PCR amplification obtaining a length of 109bp is produced Thing.Product Sequence after amplification is:

ATTTCAAGCTCAGATCACTATAGAGAYGTTTTTCAATCTATTCCAATGTTTAGTGGAACATCTGAAA GTCACATAGAGCACGGGACGATTATTTATTCTGTCCCTTAGAUnderscore part is respectively forward primer and reverse primer, 27th bpY represents polymorphic i.e. SNP site rs4801078 of C/T.23rd bp is the bases G (being base A originally) after mispairing.

(3) enzyme action system: PCR product 5 μ l, restricted enzyme 0.5 μ l, Buffer1.0 μ l and nuclease free Pure water 8.5 μ l amounts to 15 μ l enzyme action systems, and in water-bath, 37 DEG C of enzyme action 6-14h, obtain digestion products.Consider economical real BsmAI is finally selected to carry out enzyme action qualification with property and simple operations.

(4) agarose gel electrophoresis, determines gene pleiomorphism: by digestion products with 3% agarose gel at 4-10V/ Under conditions of cm, electrophoresis 20-40min, after distinguishing obvious band and qualification of taking pictures to uviol lamp.For different genes Type, rs4801078 site different genotype shows different bands (see Fig. 1), CC wild-type genotype, a length of 88bp and 21bp Two bands；CT heterozygous genotypes, a length of 109bp, 88bp and 21bp tri-band；TT mutated-genotype, 109bp mono-band.Each base Because type is all identified with further through order-checking, the result that sequencing result (see Fig. 2-4) display records with prior art is identical.

Embodiment 1. human breast carcinoma peripheral blood whole blood sample measures people's LINC-ROR rs4801078 polymorphism

1 materials and methods

1.1 key instruments and reagent

Instrument: BCD-228CH refrigerator (newly flies electrical equipment), HH-2 digital display thermostat water bath (China's peak instrument), SmartGe gel Imager (Beijing match intelligence is started an undertaking), GT9612 grads PCR instrument (hundred Tykes are biological), WD900SL23-2 model microwave oven (Glanz Electrical equipment), DG-300C type electrophresis apparatus (ancient cooking vessel state prosperity is biological) etc..

Reagent: NEP004-1DNA extraction test kit (ancient cooking vessel state prosperity is biological), 50bp DNA Ladder (Lay thing humorously), 2 × Taq PCR Mix (Lay thing humorously), BsmAI (Thermo), agarose (SIGMA) etc..

1.2 design of primers

In the dbSNP data base of NCBI, search the nucleotide sequence of LINC-RORrs4801078, soft in design of primers In part Primer Premier 6.0, the parameter such as primer length and amplification purpose fragment length is set and carries out design of primers, according to G/C content and annealing temperature etc. select optimum upstream and downstream primer, and wherein in forward primer sequence, bit base third from the bottom is mispairing alkali Base G (this base relevant position in people's LINC-ROR gene order is A), therefore after mispairing in PCR primer polymorphic near sequence Row are changed to TAGAGAC or TAGAGAT (wherein the 7th base C/T polymorphic site, the 3rd alkali by TAAAGAC or TAAAGAT Base T is base mismatch).Therefore in amplified production, C allele fragment can be identified the restricted enzyme of ATGCAT sequence BsmAI identifies (i.e. C allele fragment can be cut by restriction endonuclease).Again by this primer and the Blast sequence alignment in Pubmed Function (http://blast.ncbi.nlm.nih.gov/Blast.cgi) carries out primer comparison, and the upstream and downstream finally determined is drawn Thing is forward primer sequence: 5 '-ATTTCAAGCTCAGATCACTATAGAG-3 ', reverse primer sequences: 5 '- TCTAAGGGACAGAATAAATAATCGT-3’。

The selection of 1.3 restricted enzyme

According to the base sequence in before and after rs4801078 in dbSNP five sites, divide with the online restricted enzyme of WatCut Analysis software, on-line search obtains the information of the restricted enzyme in recognizable mutational site, consider its enzyme action specificity and The restricted enzyme BsmAI that economic and practical Sexual behavior mode is optimal.

1.4 genomic DNAs extracting sample to be tested from human breast carcinoma whole blood

Human gene group DNA is extracted in strict accordance with centrifugal column type DNA extraction kit operating procedure.

L), after adding 300 μ l human blood cells in 1.5ml centrifuge tube, add 900 μ l cell pyrolysis liquids and be mixed evenly, After placing 10min on ice, in centrifuge, 12000rpm is centrifuged 1min, abandons supernatant, again adds 900 μ l cell pyrolysis liquids, uses After rifle blows afloat precipitation and mixes, repeat the above steps；

2) in precipitate, add 600 μ l solution B solution, after blowing afloat precipitation gently with liquid-transfering gun, add 10 μ l E.C. 3.4.21.64 mixes, and after placing 10min in 70 DEG C of water-baths, 12000rpm is centrifuged 5min.

3) in the new centrifuge tube proceeding to the supernatant in centrifuge tube to compile number, then in new centrifuge tube, 500 μ l are added Dehydrated alcohol, period, this floccule was DNA it is possible that flocky precipitate；

4) being proceeded to by the liquid of mixing (if once cannot not turn completely, graded proceeds to) in centrifugal column, room temperature stands 2min, then 12000rpm is centrifuged 1min, abandons waste liquid；

5) adding 700 μ l and added the solution C rinsing liquid of respective volume dehydrated alcohol, room temperature stands 2min, 12000rpm is centrifuged 1min, abandons waste liquid；

6) adding 700 μ l and added the solution D rinsing liquid of respective volume dehydrated alcohol, room temperature stands 2min, 12000rpm is centrifuged 1min, abandons waste liquid；

7) adding 500 μ l solution D rinsing liquids, 12000rpm is centrifuged 1min, abandons waste liquid；

8) recentrifuge 2min, is placed in centrifugal column in the new centrifuge tube compiled number, uncovered puts into 37 DEG C of calorstats 10min is until without obvious ethanol taste；

9) have been preheated with the solution E 100 μ l of 65 DEG C in the addition of silica-based plasma membrane central authorities, room temperature places 5min, 12000rpm is centrifuged 1min, and once, the liquid after being centrifuged eventually is the genomic DNA extracted to repeat the above steps；

10) draw the DNA NanoPhotometer Pearl micro-spectrophotometer that 2 μ l extract measure its concentration and Purity.

2 results

2.1PCR amplification

(1) according to the concentration of extraction human gene group DNA, the DNA of object of study is diluted, makes final concentration of 20 μ g/ μ l。

(2) PCR amplification system is each 0.3 μ l of 2 × Taq PCR Mix 7.5 μ l, forward primer and downstream primer, template DNA 1.0 μ l, finally supplements cumulative volume to 15 μ l with distilled water.

(3) PCR reaction condition: first stage is the denaturation stage, 94 DEG C/5min；Second stage includes 3 steps Totally 35 circulations, to set gradually be 94 DEG C/35s, 58 DEG C of annealing time 45s, 72 DEG C/30s；72 DEG C/5min of three phases.

2.2 endonuclease reaction

Enzyme action system is pcr amplification product 5 μ l, restricted enzyme 0.5 μ l, Buffer 1.0 μ l, finally uses distilled water Supplement cumulative volume to 15 μ l.Mixing is placed in water-bath 37 DEG C of water-baths 4-16 hour.

The judgement of 2.3 genotype

Table 2 rs4801078 loci gene type judges

Embodiment 2. human breast carcinoma tissue specimen measures people's LINC-RORrs4801078 polymorphism

Essentially identical with the step of embodiment 1, simply use method below to extract DNA from breast cancer tissue's specimen and make For DNA to be measured.

Using mobile phone to excise breast cancer tissue, phenol-chloroform method extracts breast cancer tissue's genomic DNA as DNA to be measured.

1) being thawed by breast cancer tissue's block, wash away blood stains with normal saline, the tissue of clip about 0.1g is milled, and adds The aquesterilisa of 1ml, reverse mixing, 10000 leave the heart 10 minutes, abandon supernatant.Precipitation should be had at the bottom of pipe.It is repeated twice

2) the DNA lysate of 200ul is added, the E.C. 3.4.21.64 mixing of 5ul, 55 degree of digested overnight.

3) add isopyknic phenol chloroform mixed liquor (1:1) after having digested, acutely shake so that it is become milk coffee color. 12000 leave the heart 10 minutes.

4) take supernatant, be careful not to wash intermediate medium and lower floor's liquid.Add isopyknic chloroform, reverse mixing. 12000 leave the heart 10 minutes.

5) take supernatant, be careful not to wash intermediate medium and lower floor's liquid.Add the sodium acetate and 2.5 of 1/10th Dehydrated alcohol again, reverse mixing.

6) 12000 the heart is left 10 minutes.Abandon supernatant.

7) 1ml 70% ethanol is added so that it is white precipitate suspends, and reverse mixing is for several times.12000 leave the heart 10 minutes.

8) abandoning supernatant, then room temperature standing of uncapping minute makes the volatilization of its ethanol clean.

9) adding aquesterilisa dissolving DNA, the general 50ul aquesterilisa that adds dissolves

10)-20 DEG C of preservations, Ji get breast cancer tissue genomic DNA

Result: by digestion products with the agarose gel electrophoresis 20-40min of 3%, obvious bar can be distinguished to uviol lamp Carry and take pictures qualification.For different genotype, rs4801078 site different genotype shows different bands (see Fig. 1), CC wild-type genotype, a length of 88bp and 21bp two band；CT heterozygous genotypes, a length of 109bp, 88bp and 21bp tri-band；TT Mutated-genotype, 109bp mono-band.Each genotype is all identified with further through order-checking, and sequencing result (see Fig. 2-4) shows with existing The result having technology to record is identical.

From above-described embodiment it can be seen that the present invention is directed to use CRS-PCR to identify, LINC-ROR rs4801078 is polymorphic Property, normal PCR-RFLP method is improved, applies primer 3 ' and hold mispairing technology, overcome normal PCR-RFLP method restriction endonuclease The shortcomings such as choice is little, expensive, and experimental cost is high, the inspection of the LINC-ROR rs4801078 polymorphism that this research is set up Survey method, restriction endonuclease price is very cheap, and PCR primer purity is higher simultaneously, and enzyme action result is prone to differentiate.This detection method is passed through Sequence verification, its result is accurately and reliably.

SNP detection technique is the most ripe, and the detection method in single base polymorphisms site more typically includes order-checking, three draws Thing amplified allele method (TP-PCR), PCR machine technology (PCR-RFLP) etc. Method.Though these methods are respectively arranged with advantage, but are also respectively arranged with its weak point.It is all prominent that order-checking can directly be measured in DNA sequence The base alternative case of displacement point, but the method needs expensive instrument and longer step, relatively costly；TP-PCR method is accurate Really property is low, and result easily causes erroneous judgement；PCR-RFLP method comparative maturity, but require pleomorphism site to be measured and a certain restriction enzyme site Relevant, the selection of enzyme has limitation, the most relatively costly.

Therefore, in view of restricted enzyme used in the present invention is cheap, and primer synthesis and each reagent are the most relatively For economy, CRS-PCR is simple to operate in addition, reproducible, is therefore most economical efficient gene type detection method.

Normal PCR-RFLP technology is improved by the present invention, uses Created Restriction Site method (Created Restriction Site PCR, CRS-PCR), utilize primer base mispairing Technology design to detect LINC-ROR polymorphism rs4801078.Holding mispairing technology owing to this method applies primer 3 ', PCR primer can carry out base after carrying out restriction enzyme digestion and electrophoresis Because of the appraisal of type, therefore there is in practice the biggest motility, and detection method is simple, be that one is carried out The better method that single base mutation loci gene type is identified.The key problem in technology point of this invention is that the LINC-ROR designed is polymorphic The upstream and downstream primer of property rs4801078, forward primer sequence: 5 '-ATTTCAAGCTCAGATCACTATAGAG-3 ', reverse primer Sequence: 5 '-TCTAAGGGACAGAATAAATAATCGT-3 ' and the use of restricted enzyme BsmAI.In a word, the present invention builds Vertical LINC-ROR polymorphism rs4801078 methods of genotyping is simple, quick, safe and accurate, highly sensitive, is worth facing Bed and research are promoted, and the typing for other Genetic polymorphism can be used for reference.

The above, only best mode for carrying out the invention, any those familiar with the art is in the present invention In the technical scope disclosed, the simple change of the technical scheme that can become apparent to or equivalence are replaced and are each fallen within the present invention's In protection domain.

Claims (5)

1. the method by BsmAI surveyor's breast carcinoma LINC-ROR gene rs4801078 polymorphism, it is characterised in that bag Include following steps:

(a) extracting sample gene group DNA；

B () provides forward primer and the reverse primer of amplification people's LINC-ROR gene pleiomorphism rs4801078 location proximate sequence, With described human gene group DNA to be measured as template, carry out pcr amplification reaction, obtain amplified production；

C () uses restricted enzyme that described amplified production is carried out enzyme action, obtain corresponding digestion products；

D digestion products is used the agarose gel of 3% to carry out electrophoresis, to judge LINC-ROR gene pleiomorphism by () Each genotype in rs4801078 site.

The side of BsmAI surveyor's breast carcinoma LINC-ROR gene rs4801078 polymorphism the most according to claim 1 Method, it is characterised in that the design of forward primer described in step (b) and reverse primer and synthesis are particularly as follows: base sequence information Obtain from the dbSNP data base of NCBI, CHIP website is checked, determines LINC-ROR polymorphic site nucleotide variation number According to, the partial gene sequence containing LINC-RORrs4801078 as shown in SEQ:ID:NO:1, the 501st base of gene order It is polymorphic that Y represents C/T, is the pleomorphism site of rs4801078；Particular sequence according to rs4801078 and polymorphic base Position use that Primer Premier 6.0 designs have most upstream and downstream primer SEQ:ID:NO:2, SEQ:ID:NO:3 institute Show；

Wherein in forward primer sequence, bit base third from the bottom is base mismatch G, after mispairing in PCR primer polymorphic near sequence by TAAAGAC or TAAAGAT changes to TAGAGAC or TAGAGAT, and therefore in amplified production, C allele fragment can be identified The restricted enzyme BsmAI of GTCTCN sequence identifies, can cut situation according to fragment and judge polymorphic gene type；

According to forward primer sequence and reverse primer sequences synthetic primer, the synthesis of primer can use solid-phase synthesis, or Biotech firm is entrusted to synthesize and detect forward and reverse primer.

The side of BsmAI surveyor's breast carcinoma LINC-ROR gene rs4801078 polymorphism the most according to claim 1 Method, it is characterised in that prepare PCR amplification system in step (b) in pcr amplification reaction particularly as follows: 2 × Taq PCR Mix 7.5 μ L, distilled water 5.9 μ l, i.e. obtain 15.0 μ l after forward primer 0.3 μ l downstream primer 0.3 μ l and template DNA 1.0 μ l, fully mixing Pcr amplification reaction system；According to the first stage: 94 DEG C of degeneration 5min, second stage includes three steps of 35 circulations altogether, first 94 DEG C of degeneration 30s, 56.1 DEG C annealing 45s, last 72 DEG C extend 45s, the phase III: 72 DEG C extend 5min, final 4 DEG C store with Standby, obtain the pcr amplification product of a length of 109bp, the Product Sequence after amplification is as shown in SEQ:ID:NO:4.

The side of BsmAI surveyor's breast carcinoma LINC-ROR gene rs4801078 polymorphism the most according to claim 1 Method, it is characterised in that step (c) carries out the enzyme action system of enzyme action particularly as follows:: PCR product 5 μ l, restricted enzyme 0.5 μ l, Buffer1.0 μ l and nuclease free pure water 8.5 μ l amounts to 15 μ l enzyme action systems, in water-bath 37 DEG C of enzyme action 6～ 14h, obtains digestion products, selects BsmAI to carry out enzyme action qualification.

The side of BsmAI surveyor's breast carcinoma LINC-ROR gene rs4801078 polymorphism the most according to claim 1 Method, it is characterised in that step (d) agarose gel electrophoresis, determine gene pleiomorphism particularly as follows: by digestion products with 3% fine jade Sepharose is under conditions of 4～10V/cm, and electrophoresis 20～40min, after distinguishing obvious band and take pictures to uviol lamp Identify；For different genotype, rs4801078 site different genotype shows different bands, CC wild-type genotype, length For 88bp and 21bp two band；CT heterozygous genotypes, a length of 109bp, 88bp and 21bp tri-band；TT mutated-genotype, 109bp One band.