CN107365837A - With BanII identification human gastric cancers ZNF33B 2:The method of 1 gene rs579501 polymorphisms - Google Patents

Abstract

The invention discloses identify human gastric cancer ZNF33B 2 with BanII:The method of 1 gene rs579501 polymorphisms, comprises the following steps：Human gene group DNA to be measured is provided；Amplification people LNCRNA ZNF33B 2 are provided:The sense primer and anti-sense primer of 1 gene pleiomorphism rs579501 location proximate sequences, using the human gene group DNA to be measured as template, pcr amplification reaction is carried out, obtains amplified production；Digestion is carried out to the amplified production using restriction enzyme, obtains corresponding digestion products；Electrophoresis is carried out to digestion products, to judge people LNCRNA ZNF33B 2:Each genotype in 1 gene pleiomorphism rs579501 sites.The invention provides a kind of detection human gastric cancer tumor susceptibility gene LNCRNA ZNF33B 2 simple to operate, cost is low, applied widely:1 polymorphism rs579501 method.

Description

With BanII identification human gastric cancers ZNF33B-2:The method of 1 gene rs579501 polymorphisms

Technical field

The invention belongs to biological technical field, and in particular to identify human gastric cancer ZNF33B-2 with BanII:1 gene The method of rs579501 polymorphisms.

Background technology

SNP (single nucleotide polymorphism, SNP), refers to single in DNA sequence dna Nucleotide diversity, including base replacement, insertion or gene pleiomorphism caused by missing.SNP is widely distributed in human genome, DNA sequence encoding area SNP can further be had an impact with the forming process of the structure of regulation protein to its function, while SNP Shearing can be influenceed and produce different transcripts.The detection method of more typical mononucleotide polymorphism site includes polymerase chain Reaction-RFLP technology (PCR-RFLP), allele-specific amplification hair（AS-PCR）, Taqman probes The methods of technology and sequencing.

PCR-RFLP analytical technologies grow up on the basis of round pcr, are a kind of quick, easy, accurately inspections Survey the classical way of SNP genotype.Its principle is：Restriction enzyme is a kind of identification DNA specific sites (usual 4-6bp), And the enzyme cut in specific site.The specificity of restriction enzyme site means that the complete digestion to specific allele can produce Raw same fragment sequence.During generation point mutation, if DNA base displacement occurs exactly at certain restriction enzyme identification position On point so that restriction enzyme site increases or disappeared, so as to produce different size sum purpose endonuclease bamhi.Utilize this digestion property Change, PCR specially expand includes editing displacement DNA fragmentation, through limit cleavage, recycle agarose gel electrophoresis separation Digestion products, compare the generation whether the fragment banding pattern of product there can be SNP.The advantages of this method is quickly and easily, terminal Accuracy of judgement.But its major defect is that polymorphic site needs to be measured are related to a certain restriction enzyme site, therefore the selection of enzyme has Limitation, not all SNP site has corresponding restriction enzyme site, and part restriction endonuclease is expensive, and experimental cost is high.Deng Position gene amplification method (AS-PCR) does not need restriction enzyme and ligase then.Due to the primer extend in PCR courses of reaction It is since holding 3 ', if this base can be complementary with template, primer can uninterruptedly extend, and PCR is normally carried out, and obtains spy Measured length amplified band, it is on the contrary then can not extend, as long as so will be mutated or that base arrangement that normal allele is different In 3 ' least significant ends, enter performing PCR with the primer containing a certain mutant nucleotide sequence, determined whether by the way that whether identification has specific amplification to bring Mutation.The major advantage of this method is quick, the restriction enzyme sites independent of junction fragment.But its shortcoming is that resolution is prolonged in mispairing Rate is low, and point mutation recall rate is unstable.Taqman fluorescence probe method is a kind of new and effective accurate methods of genotyping, and its is excellent Point is detection sensitivity height, and parting is accurate.But this method needs expensive instrument and longer step, cost higher.

LNC-ZNF33B-2:1(Long Non-Protein Coding RNA, Zinc Finger33B-2:1) belong to long Chain non-coding RNA, positioned at human chromosomal 10.Not yet find LNC-ZNF33B-2 at present:1 and rs579501 and disease association Document report, at present, high flux chip and sequencing technologies provide to find and screening the lncRNA of disease relevant difference expression Strong instrument, the genome-wide association study based on Chinese population（Genome-wide Association Study, GWAS）Also confirm that the variation of lncRNA gene genetics exists with gastric cancer tumor neurological susceptibility significantly to associate, LNC-ZNF33B-2:1 be Stomach cancer related chip data based on Chinese population in GEO databases（GSE50710, GSE53137, GSE58828）In filter out The stomach cancer correlation lncRNA. of the differential expression come

LNCRNA-ZNF33B-2:Three kinds of genotype in crowd be present in 1 gene rs579501 loci polymorphisms：CC types（People's base Because two allele bases of group rs579501 polymorphic sites are C）, AC types（Human genome rs579501 polymorphic sites Two allele bases are respectively A and C）With AA types（Two allele bases of human genome rs579501 polymorphic sites It is A）（The state-run medical library biology information technology center of NIH, http:// www.ncbi.nlm.nih.gov）.

People LNCRNA-ZNF33B-2 at present:1 gene polymorphic rs579501 identification is frequently with PCR-RFLP methods.But Surveyor LINCRNA-ZNF33B-2 at present:The restriction enzyme price that 1 gene polymorphic rs579501 is used often is higher（Close Table 1 below is referred in the reference price of part restriction endonuclease）, experimental cost height, it is difficult to which popularization uses in the lab.

Therefore, this area is present to simple to operate, and cost is low, the demand of new detection SNP methods applied widely.

The content of the invention

In order to overcome defect present in prior art, present invention offer one kind is simple to operate, cost is low, applied widely General identifies human gastric cancer ZNF33B-2 with BanII:The method of 1 gene rs579501 polymorphisms.

To achieve the above object, the technical solution adopted in the present invention is specific as follows：

With BanII identification human gastric cancers ZNF33B-2:The method of 1 gene rs579501 polymorphisms, comprises the following steps：

（a）Human gene group DNA to be measured is provided；

（b）Amplification people LNCRNA-ZNF33B-2 is provided:The sense primer of 1 gene rs579501 location proximate sequences and downstream are drawn Thing, with step（a）The human gene group DNA to be measured is template, and pcr amplification reaction is carried out using sense primer and anti-sense primer, Obtain amplified production；

（c）Using restriction enzyme BanII to step（b）Gained amplified production carries out digestion, obtains corresponding digestion products；

（d）By step（c）Gained digestion products carry out electrophoresis using 3% Ago-Gel, to judge LNCRNA-ZNF33B-2: Each genotype in 1 gene pleiomorphism rs579501 sites；

Wherein, its 3 ' end bit base last of sense primer base adjacent with polymorphic rs579501 bases, fall The bit base of number the 3rd is base mismatch G, to form GRGCYC structures with polymorphic C allele in amplified production.

Preferably, step（b）Described in upstream primer sequence：5 '-CCTCAGTTTGGGAATTCAGTG-3 ', anti-sense primer Sequence：5’-AAGCAAGCAGGCGAAGAA-3’.

ZNF33B-2 in topic of the present invention:The LNCRNA-ZNF33B-2 mentioned in 1 gene, as present invention:1 Gene.

The beneficial effects of the invention are as follows：

The present invention is directed to using CRS-PCR identifications LNCRNA-ZNF33B-2:1rs579501 polymorphisms, to normal PCR-RFLP methods It is improved, using Created Restriction Site method (Created Restriction Site PCR, CRS-PCR), utilizes primer alkali Base mispairing Technology design detects LNCRNA-ZNF33B-2:1 polymorphism rs579501, held because this method applies primer 3 ' Mispairing technology, PCR primer can carry out the appraisal of genotype after carrying out restriction enzyme digestion and electrophoresis, therefore have in practice Very big flexibility, and detection method is simple and easy, is a kind of better method for carrying out single base mutation loci gene type identification, And the shortcomings of it is small to overcome normal PCR-RFLP method restriction endonucleases choice, expensive, and experimental cost is high；The skill of the present invention Art key point is to design LINCRNA-ZNF339 polymorphisms rs579501 upstream and downstream primer, upstream primer sequence：5’- CCTCAGTTTGGGAATTCAGTG-3 ', downstream primer sequence：5 '-AAGCAAGCAGGCGAAGAA-3 ' and restriction enzyme Enzyme BanII use；In a word, the LNCRNA-ZNF33B-2 that the present invention establishes:The letter of 1 polymorphism rs579501 methods of genotyping Single, quick, safe and accurate, high sensitivity.The invention provides a kind of detection simple to operate, cost is low, applied widely Human gastric cancer tumor susceptibility gene LNCRNA-ZNF33B-2:1 polymorphism rs579501 method, there is provided this easily and efficiently detects people's stomach Cancer susceptibility gene LNCRNA-ZNF33B-2:1 polymorphism rs579501 method is expected to predict the neurological susceptibility of stomach cancer, available for facing The early diagnosis of bed.

Brief description of the drawings

Fig. 1 is pcr amplification reaction program；

Fig. 2 is LNCRNA-ZNF33B-2:The electrophoresis pattern in 1rs579501 sites；

Fig. 3 is LNCRNA-ZNF33B-2:1rs579501 sites AA genotype Sequencing chromatogram (backward sequencing)；

Fig. 4 is LNCRNA-ZNF33B-2:1 rs579501 sites AC genotype Sequencing chromatogram (backward sequencing)；

Fig. 5 is LNCRNA-ZNF33B-2:1 rs579501 sites CC genotype Sequencing chromatogram (backward sequencing).

Embodiment

Below in conjunction with the accompanying drawings technical scheme is further illustrated with embodiment.

Sequence near SNP can be changed into and can be determined in advance by the base mismatch on primer by the method for the present invention Restriction enzyme identification sequence.Therefore, the needs present in traditional PCR-RFLP methods can be overcome using expensive The defects of restriction endonuclease, and then greatly reduce detection SNP cost.Specifically：Due to reciprocal in the upstream primer sequence First bit base is that (base is in people LNCRNA-ZNF33B-2 by base mismatch G:Relevant position in 1 gene order is A）, because Polymorphic sequence nearby is changed to GTGAGCCC by GTAAGCCC in PCR primer after this mispairing.Therefore C allele in amplified production Fragment can be identified the restriction enzyme identification of GRGCYC sequences（I.e. C allele fragment can be cut by restriction endonuclease）；And then Situation can be cut according to fragment to judge polymorphic gene type.More specifically, understood through sequence analysis, A/ in gene original series C is polymorphic to be identified by first two restriction endonuclease in table 1.Such as the 5th bit base A before pleomorphism site is changed by base mispairing PCR It is changed into G, then it is that C allele can be identified the restricted of GRGCYC sequences after PCR is expanded comprising GAGCCC sequences that this is polymorphic Restriction endonuclease BanII is identified, and A allele can not be cut.

Found through sequence analysis, detect three kinds of enzymes in the usable table 1 of the polymorphic methods of the A/C, wherein first two in table Enzyme is expensive, and digestion effect is undesirable.Using Created Restriction Site method (Created Restriction Site PCR, CRS-PCR) to bit base mispairing last in upstream primer sequence be G after, in PCR primer it is polymorphic nearby sequence life Into GTGAGCCC sequences, so as to be identified by restriction enzyme BanII.Due to identifying the restriction enzyme of specific site BanII is applied widely, and price is relatively inexpensive, and then reduces detection SNP cost.Therefore, simple operations are considered With economic and practical, restriction enzyme BanII is only selection.

The price of the restriction enzyme provided in table 1 is from NEB companies（http://www.neb-china.com）, it is restricted The selection of restriction endonuclease obtains from WatCut restriction endonuclease analysis softwares（http://watcut.uwaterloo.ca/）, In this, as the reference of restriction enzyme enzyme recognition site and price.

1 several restriction endonuclease recognition sequences of table and its price

Restriction endonuclease	Recognition sequence	Price
			Van91I	CCAN4^NTGG	Nothing is sold at present
Sau96I	G^GNCC	619 yuan/1000U
			Bsp1286I	GDGCH^C	639 yuan/500U
BanII	GRGCY^C	669 yuan/2000U
			ApoI	R^AATTY	719 yuan/1000U

In embodiments of the invention, the design of sense primer and anti-sense primer is carried out using Primer6.0 softwares, design Principle considers the influence of sensitivity, specificity and amplification efficiency that primer pair PCR is expanded.According to base pair complementarity Principle designs primer, primer length typically between 15 ~ 30 bases, it is long or it is short can cause poor specificity, it is long also to lead Cause its elongating temperature to be more than 74 DEG C, be unsuitable for Taq DNA polymerase and reacted.Primer G/C content is between 40% ~ 60%, Tm values Preferably close to 72 DEG C, G/C content is too high or too low to be all unfavorable for initiation reaction.Base wants random distribution, primer itself and primer it Between should not have complementary series, otherwise primer itself, which can be folded into hairpin structure, makes primer renaturation itself.Primer 5 ' is held and centre △ G values should be of a relatively high, and 3 ' end △ G values are relatively low.The single-stranded of amplified production can not form secondary structure.Primer should have spy The opposite sex, after design of primers is completed, BLAST detections should be carried out to it, to ensure it with other genes without complementarity.

Final sense primer selected from following nucleotide sequence by forming：CCTCAGTTTGGGAATTCAGTG.Anti-sense primer By being formed selected from following nucleotide sequence：AAGCAAGCAGGCGAAGAA.

The main sensitivity for considering primer pair PCR amplifications of design, specificity and the amplification effect of sense primer and anti-sense primer The influence of rate.Primer generally is designed according to base pair complementarity principle, the sequence of primer and template wants close complementary.Primer length For 15-30bp, it is too short or it is long cause poor specificity, it is long also to cause its elongating temperature to be more than 74 DEG C and be unfavorable for PCR Reaction.Anti-sense primer its 3^,End antepenulatimate contains base mismatch T, so as in amplified production with polymorphic C equipotentials base Because forming GTGAGCCC structures, so as to be identified by BanII restriction endonucleases.Amplified production total length be 264bp. amplified productions such as Under：CCTCAGTTTGGGAATTCAGTGAGCCMAATATTGTATCCTTATTATTAGTTATATAGAACTATGCCTTAGACTTT GTTAGAAACTTCTGCTTCAGCTTGACTGACTCATTTTCCATTTCTGGTTGTACAAAATGAACTGACACTTTAATGCT GTGGCCACCTTTAAATAAAGTACAATGTGACAAAAAAATACAAATGTTTTCAGAGATAAATGCATTCTTTGACATCT GAGGTTACAGCAAATCTATTCTTCGCCTGCTTGCTT

Underscore part is respectively sense primer and anti-sense primer, and the 26th bpM represents the polymorphic i.e. SNP site rs579501 of A/C. 21st bp is the bases G (being base A originally) after mispairing.The amplified production of a length of 264bp is through restriction enzyme BanII enzymes 264bp, 239bp can be produced after cutting（The fragment upstream sequence is compared to downstream sequence because cohesive end caused by BanII digestions increases Add 3 single-stranded bases）, 25bp（The fragment upstream sequence is compared to downstream sequence because cohesive end caused by BanII digestions is reduced 3 single-stranded bases）Totally three kinds of clip types.Genotype result of determination：AA wild-type genotypes, a length of bands of 264bp mono-；AC heterozygosis Genotype, a length of 25bp, 239bp and the bands of 264bp tri-；CC mutated-genotypes, 25bp and the bands of 239bp two.

Gel electrophoresis is divided into agarose gel electrophoresis and polyacrylamide gel electrophoresis, and agarose (Agarose) is A kind of linear polysaccharide polymer, it is to be extracted from Red seaweeds product agar.After agarose solution is heated to boiling point Cooled and solidified will form good electrophoretic medium, and its density is determined by the concentration of agarose, the electricity available for DNA fragmentation Swimming.Polyacrylamide gel mainly has two ways：First, the non denatured polypropylene for separating and purifying double chain DNA fragment Acrylamide gel, second, for separation and the denaturing polyacrylamide gel of purification of single stranded DNA fragmentation.But consider practicality, Convenience and economy, it can yet be regarded as a kind of optimal selection using agarose gel electrophoresis.In the present invention, primer amplification condition As shown in figure 1, purpose amplified production uses digestion 6-14h in restriction enzyme BanII3U water-baths.Digestion products use 3% Agarose enter row agarose gel electrophoresis, wild homozygous genotype is judged according to different bands under ultra violet lamp, it is miscellaneous Close genotype and mutant homozygous genotype.

In specific embodiments of the present invention, present invention detection human gastric cancer LNCRNA-ZNF33B-2:1 gene polymorphic Rs579501's comprises the following steps that：

（l）Human gene group DNA's template to be measured is extracted, human gene group DNA's template is the people's gene that human body any part obtains Group template.

（2）PCR amplifying genom DNAs, performing PCR amplification is entered to the templet gene group DNA of extraction, obtained containing polymorphic sequence nearby The PCR primer of row.

（3）Endonuclease reaction is carried out with restriction enzyme BanII to pcr amplification product, obtains digestion products；

（4）Digestion products carry out agarose and enter row agarose gel electrophoresis, are judged under ultra violet lamp according to different bands Wild homozygous genotype, heterozygous genotypes and mutant homozygous genotype.

Above-mentioned each key step is described in detail below：

（1）Design of primers and synthesis

Base sequence information obtains from NCBI dbSNP databases, is checked on CHIP websites, determines LNCRNA- ZNF33B-2:1 polymorphic site nucleotide variation data

Containing LNCRNA-ZNF33B-2:1rs579501 partial gene sequence is as follows：

CCAAGGTGGCAGCGCTGAGCTGACCACGCCACGGACCATAGAGTGGGAGCCTTTCCTGCCCCCTTAACCGCAG CTAACATCAAAAGCACTGGTATGGGCTGTCTAACTGGAACCTGAGTTGGTCTTTGTAATTACGATTCTTTTGGGTTT ATTTTGCCAGTTCATTATCCACCCCCCTGAAATCAGGCCTCCCAAATTTAGCAGGTGCTGGGGAGGACCCCAGGGAG TGGCTTGTGGGGGCTAGCTGGTGAAACTACCCTTTCCTTTCTGTTCTATGAGTGTGATGGTGTTTGAGAAATATGGG GCTATGGTTCAGGCGCACTTCACATGTGCAAAGATGGAGAAAGCACTCACCTGCACATTTAGGCTCAGAATATTGAT TGAAACATTTTGAAATATCAAAAATAAAATGTTATTTTTAAAGTTTCTCTGAGATTTCGCTTAAGTTTTGGTAGATA TTCTTAAATTTTAGTGACCTCAGTTTGGGAATTCAGTGAGCCMAATATTGTATCCTTATTATTAGTTATATAGAACT ATGCCTTAGACTTTGTTAGAAACTTCTGCTTCAGCTTGACTGACTCATTTTCCATTTCTGGTTGTACAAAATGAACT GACACTTTAATGCTGTGGCCACCTTTAAATAAAGTACAATGTGACAAAAAAATACAAATGTTTTCAGAGATAAATGC ATTCTTTGACATCTGAGGTTACAGCAAATCTATTCTTCGCCTGCTTGCTTGTTCAGAGTTGTAATATTTGCTTTGGT GTAGAGCTGAAGACACAAATTGGTAACCAGTGGAATTATATGGCCTCAGACTTATTTATTCTCATCATTTGTTTCGC TCATATGCAAATTTATTCTGTACCAGGAAATGTCAATTTAATTATATTCTACAGTACACAGTGAATCATGTAAAGTT AGTCAAGTTGTAAATACGCTAGAACCATATAAGCTCACAAAAATATATCAGCGCATGATGGGTAAGTGACCTTCCCC TGAG

501st base M of gene order represents that A/C is polymorphic, as rs579501 pleomorphism site.According to rs579501 Particular sequence and polymorphic base position designed using Primer Premier 6.0 it is optimal）Upstream and downstream primer is such as Under；

Upstream primer sequence：5’-CCTCAGTTTGGGAATTCAGTG-3’

Downstream primer sequence：5’-AAGCAAGCAGGCGAAGAA-3’.

Bit base last is base mismatch G wherein in upstream primer sequence（The base is in people LNCRNA-ZNF33B- 2:Relevant position in 1 gene order is A）, therefore after mispairing in PCR primer polymorphic sequence nearby by GTAAGCCC or GTAAGCCA is changed to GTGAGCCC or GTGAGCCA, and (wherein the 8th base A/C polymorphic site, the 3rd bases G are mispairing Base).Therefore C allele fragment can be identified the restriction enzyme BanII identifications of GRGCYC sequences in amplified production（I.e. C allele fragment can be cut by restriction endonuclease）.And then situation can be cut according to fragment to judge polymorphic gene type.

According to upstream primer sequence and downstream primer sequence synthetic primer, the synthesis of primer can use generally in the art Method（Such as solid-phase synthesis）, also biotech firm can be entrusted to synthesize and detect upstream and downstream primer.

（2）Prepare PCR amplification system：2 × Taq PCR Mix7.5 μ l, the μ l of distilled water 5.9, the μ l downstreams of sense primer 0.3 The μ l of the primer 0.3 and μ l of template DNA 1.0,15.0 μ lPCR amplification reaction systems are produced after fully mixing；According to the first stage：94 DEG C denaturation 5min, second stage altogether include 35 circulation three steps, 94 DEG C first denaturation 30s, 56.1 DEG C annealing 45s, finally 72 DEG C of extension 45s, phase III：72 DEG C of extension 5min, with standby, the PCR amplifications for producing a length of 264bp are produced for final 4 DEG C of storages Thing.Product Sequence after amplification is：

CCTCAGTTTGGGAATTCAGTGAGCCMAATATTGTATCCTTATTATTAGTTATATAGAACTATGCCTTAGACTT TGTTAGAAACTTCTGCTTCAGCTTGACTGACTCATTTTCCATTTCTGGTTGTACAAAATGAACTGACACTTTAATGC TGTGGCCACCTTTAAATAAAGTACAATGTGACAAAAAAATACAAATGTTTTCAGAGATAAATGCATTCTTTGACATC TGAGGTTACAGCAAATCTATTCTTCGCCTGCTTGCTT

Underscore part is respectively sense primer and anti-sense primer, and the 26th bpM represents the polymorphic i.e. SNP site rs579501 of A/C. 21st bp is the bases G (being base A originally) after mispairing.

（3）Digestion system：The μ l of PCR reaction products 5, μ l, Buffer1.0 the μ l of restriction enzyme 0.5 and nuclease free The μ l of pure water 8.5 amount to 15 μ l digestion systems, and 37 DEG C of digestion 6-14h, produce digestion products in water-bath.Consider economical real Digestion identification is carried out with property and simple operations final choice BanII.

（4）Agarose gel electrophoresis, determine gene pleiomorphism：By digestion products with 3% Ago-Gel in 4-10V/cm Under conditions of, electrophoresis 20-40min, to uviol lamp under can distinguish after obvious band and identification of taking pictures.For different genes Type, rs579501 sites different genotype show different bands（See Fig. 2）, AA wild-type genotypes, a length of 264bp mono- Band；AC heterozygous genotypes, a length of 264bp, 239bp and the bands of 25bp tri-；CC mutated-genotypes, 239bp and the bands of 25bp two.Respectively Genotype further identifies through being sequenced, sequencing result（See Fig. 3-5）Display is identical with the result that prior art measures.

Here is to implement some embodiments of the present invention：

The human peripheral whole blood sample of embodiment 1. measure people LNCRNA-ZNF33B-2:1 rs579501 polymorphisms

1 materials and methods

1.1 key instruments and reagent

Instrument：BCD-228CH refrigerators（Newly winged electrical equipment）, HH-2 digital display thermostat water baths（Magnificent peak instrument）, SmartGe gel imagings Instrument（Beijing match intelligence is started an undertaking）, GT9612 grads PCR instrument（Hundred Tykes biology）, WD900SL23-2 model micro-wave ovens（Glanz electricity Device）, DG-300C type electrophoresis apparatuses（The prosperous biology of ancient cooking vessel state）Deng.

Reagent：NEP004-1 DNA extraction kits（The prosperous biology of ancient cooking vessel state）, 50 bp DNA Ladder（Lay thing humorously）, 2×Taq PCR Mix（Lay thing humorously）, BanII（Thermo）, agarose（SIGMA）Deng.

1.2 design of primers

In NCBI dbSNP databases, LNCRNA-ZNF33B-2 is searched:1rs579501 nucleotide sequence, sets in primer Count in software PrimerPremier6.0, set the parameter such as primer length and amplification purpose fragment length to carry out design of primers, root Optimal upstream and downstream primer is selected according to G/C content and annealing temperature etc., bit base last is mispairing wherein in upstream primer sequence Bases G（The base is in people LNCRNA-ZNF33B-2:Relevant position in 1 gene order is A）, therefore after mispairing in PCR primer Polymorphic sequence nearby by GTAAGCCC or GTAAGCCA is changed to GTGAGCCC or GTGAGCCA, and (wherein the 8th base A/C is more State site, the 3rd bases G are base mismatch).Therefore C allele fragment can be identified GAGCCC sequences in amplified production Restriction enzyme BanII is identified（I.e. C allele fragment can be cut by restriction endonuclease）.Again by this primer and Pubmed Blast sequence alignment functions（http://blast.ncbi.nlm.nih.gov/Blast.cgi）Primer comparison is carried out, it is final true Fixed upstream and downstream primer is upstream primer sequence：5 '-CCTCAGTTTGGGAATTCAGTG-3 ', downstream primer sequence：5’- AAGCAAGCAGGCGAAGAA -3’。

The selection of 1.3 restriction enzymes

The base sequence in the first six rear eight site according to rs579501 in dbSNP, with the online restriction endonuclease analysis of WatCut Software, on-line search obtain the information of the restriction enzyme in recognizable mutational site, consider its digestion specificity and warp Ji is applicable the optimal restriction enzyme BanII of Sexual behavior mode.

1.4 extract the genomic DNA of sample to be tested from people's whole blood

In strict accordance with centrifugation column type DNA extraction kit operating procedure extraction human gene group DNA.

l）After 300 μ l human blood cells are added in 1.5 ml centrifuge tubes, add 900 μ l cell pyrolysis liquids and mix Even, after 10 min are placed on ice, 12000 rpm centrifuge 1 min in centrifuge, abandon supernatant, add 900 μ l cells again Lysate, blown afloat after precipitating and mixing, repeated the above steps with rifle；

2）600 μ l solution B solutions are added into sediment, after gently blowing afloat precipitation with liquid-transfering gun, add 10 μ l eggs White enzyme K is mixed, and after 10 min are placed in 70 °C of water-baths, 12000 rpm centrifuge 5 min.

3）Supernatant in centrifuge tube is transferred in the new centrifuge tube compiled number, then 500 μ l are added into new centrifuge tube Absolute ethyl alcohol, during which it is possible that flocky precipitate, the floccule are DNA；

4）The liquid of mixing is transferred in centrifugal column（If once turning endless, graded is transferred to）, it is stored at room temperature 2 min, then 12000 Rpm centrifuges 1 min, abandons waste liquid；

5）The solution C rinsing liquids that 700 μ l have added respective volume absolute ethyl alcohol are added, are stored at room temperature 2 min, 12000 Rpm centrifuges 1 min, abandons waste liquid；

6）The solution D rinsing liquids that 700 μ l have added respective volume absolute ethyl alcohol are added, are stored at room temperature 2 min, 12000 Rpm centrifuges 1 min, abandons waste liquid；

7）500 μ l solution D rinsing liquids are added, 12000 rpm centrifuge 1 min, abandon waste liquid；

8）2 min are centrifuged again, centrifugal column are placed in the new centrifuge tube compiled number, opening is put into 10 in 37 °C of insulating boxs Min is until without obvious ethanol flavor；

9）65 °C of the μ l of solution E 100 are had been preheated with the addition of silicon substrate plasma membrane center, room temperature places 5 min, 12000 rpm centrifuge 1 min, repeat the above steps once, and the liquid after centrifugation is the genomic DNA extracted eventually；

10）Draw DNA that 2 μ l extract and determine its concentration and pure with NanoPhotometer Pearl micro-spectrophotometers Degree.

2 results

2.1 PCR are expanded

（1）According to the concentration of extraction human gene group DNA, the DNA of research object is diluted, makes final concentration of 20 μ g/ μ l.

（2）PCR amplification system is μ l of 2 × Taq PCR Mix 7.5, sense primer and each 0.3 μ l of anti-sense primer, template The μ l of DNA 1.0, cumulative volume finally is supplemented to 15 μ l with distilled water.

（3）PCR reaction conditions：First stage is the pre-degeneration stage, 94 DEG C/5 min；Second stage includes 3 steps Suddenly totally 35 circulation, set gradually for 94 DEG C/35 s, 58 DEG C of s of annealing time 45,72 DEG C/30s；Three phases 72 DEG C/5 min。

2.2 endonuclease reaction

Digestion system is μ l of pcr amplification product 5, the μ l of restriction enzyme 0.5, Buffer 1.0 μ l, is finally mended with distilled water Cumulative volume is filled to 15 μ l.37 DEG C of water-bath 4-16 hours in water-bath are placed in after mixing.

The judgement of 2.3 genotype

The rs579501 loci gene types of table 2 judge

The Human Stomach Tissue sample of embodiment 2. measure people LNCRNA-ZNF33B-2:1rs579501 polymorphisms

The step of with embodiment 1, is essentially identical, simply adopts and extracts DNA from stomach organization sample in the following method as to be measured DNA。

Using surgery excision stomach organization, phenol-chloroform method extracts stomach organization genomic DNA as DNA to be measured.

1）Stomach organization block is thawed, the tissue that blood stains, clip 0.1g or so are washed away with physiological saline is milled, and adds 1ml Aqua sterilisa, overturn mix, 10000 leave heart 10min, abandon supernatant.Ttom of pipe should have precipitation.It is repeated twice

2）200ul DNA lysates are added, 5ul Proteinase K mixes, and 55 DEG C are digested overnight.

3）Isometric phenol chloroform mixed liquor is added after the completion of digestion（1:1）, acutely concussion, makes it become milk coffee color. 12000 leave the min of the heart 10.

4）Supernatant is taken, is careful not to wash intermediate medium and lower floor's liquid.Isometric chloroform is added, overturns and mixes. 12000 leave the min of the heart 10.

5）Supernatant is taken, is careful not to wash intermediate medium and lower floor's liquid.Add 1/10th sodium acetate and 2.5 Absolute ethyl alcohol again, overturn and mix.

6）12000 leave the min of the heart 10.Abandon supernatant.

7）The ethanol of 1ml 70% is added, its white precipitate is suspended, overturns and mixes for several times.12000 leave the min of the heart 10.

8）Supernatant is abandoned, then room temperature, which is uncapped, stands minute and make the volatilization of its ethanol clean.

9）Aqua sterilisa dissolving DNA is added, it is general to add the dissolving of 50ul aqua sterilisas

10）- 20 °C of preservations, produce stomach organization genomic DNA

As a result：By digestion products with 3% agarose gel electrophoresis 20-40min, to uviol lamp under can distinguish obvious band simultaneously Take pictures identification.For different genotype, rs579501 sites different genotype shows different bands（See Fig. 2）, AA open countries Raw genotype, a length of bands of 264bp two；AC heterozygous genotypes, a length of 264bp, 239bp and the bands of 25bp tri-；CC mutators Type, 239bp and the bands of 25bp two.Each genotype further identifies through being sequenced, sequencing result（See Fig. 3-5）Display with it is existing The result that technology measures is identical.

Described above, only best mode for carrying out the invention, any one skilled in the art is in the present invention In the technical scope of disclosure, the simple change or equivalence replacement of the technical scheme that can be become apparent to each fall within the present invention's In protection domain.

SEQUENCE LISTING

<110>Zhengzhou University

<120>With BanII identification human gastric cancers LNCRNA-ZNF33B-2:The method of 1 gene rs579501 polymorphisms

<130> 2017

<160> 2

<170> PatentIn version 3.3

<210> 1

<211> 21

<212> DNA

<213>Upstream primer sequence

<400> 1

cctcagtttg ggaattcagt g 21

<210> 2

<211> 18

<212> DNA

<213>Downstream primer sequence

<400> 2

aagcaagcag gcgaagaa 18

Claims (2)

1. identify human gastric cancer ZNF33B-2 with BanII:The method of 1 gene rs579501 polymorphisms, it is characterised in that including following Step：

（a）Human gene group DNA to be measured is provided；

（b）Amplification people LNCRNA-ZNF33B-2 is provided:The sense primer of 1 gene rs579501 location proximate sequences and downstream are drawn Thing, with step（a）The human gene group DNA to be measured is template, and pcr amplification reaction is carried out using sense primer and anti-sense primer, Obtain amplified production；

（c）Using restriction enzyme BanII to step（b）Gained amplified production carries out digestion, obtains corresponding digestion products；

（d）By step（c）Gained digestion products carry out electrophoresis using 3% Ago-Gel, to judge LNCRNA-ZNF33B-2: Each genotype in 1 gene pleiomorphism rs579501 sites；

Wherein, its 3 ' end bit base last of sense primer base adjacent with polymorphic rs579501 bases, fall The bit base of number the 3rd is base mismatch G, to form GRGCYC structures with polymorphic C allele in amplified production.

2. according to claim 1 identify human gastric cancer ZNF33B-2 with BanII:The method of 1 gene rs579501 polymorphisms, Characterized in that, step（b）The upstream primer sequence：5 '-CCTCAGTTTGGGAATTCAGTG-3 ', downstream primer sequence： 5’-AAGCAAGCAGGCGAAGAA-3’。