CN105925712A

CN105925712A - Method for identifying rs45549040 polymorphism of human esophageal cancer RAD51 gene by virtue of XmnI

Info

Publication number: CN105925712A
Application number: CN201610503057.2A
Authority: CN
Inventors: 夏宗江; 宋春花; 方泽民
Original assignee: First Affiliated Hospital of Zhengzhou University
Current assignee: First Affiliated Hospital of Zhengzhou University
Priority date: 2016-06-28
Filing date: 2016-06-28
Publication date: 2016-09-07

Abstract

The invention discloses a method for identifying rs45549040 polymorphism of human esophageal cancer gene RAD51 by virtue of XmnI. The method comprises the steps of amplifying target DNA segments by virtue of polymerase chain type reaction, carrying out enzyme digestion on to-be-detected DNA segments by virtue of restriction endonuclease, identifying and cutting a specific sequence by virtue of the restriction endonuclease, carrying out electrophoresis on an enzyme digestion product, analyzing specific enzyme digestion sites of the sequence by virtue of restriction enzyme atlases, and making comparison on gene sequences of different sources by virtue of the diversity of the segments. In brief, the target segments are firstly subjected to PCR amplification, restriction endonuclease reaction is then carried out, and finally the differences among the sequences are analyzed by virtue of observation and comparison on the restriction enzyme atlases. The method has the beneficial effects that the repeatability is good, the operation is relatively simple, the cost is low, and an enzyme digestion result is easily recognized. Therefore, the invention aims at providing a method and a detection kit for detecting the rs45549040 polymorphism of the human esophageal cancer predisposing gene RAD51. The method and the detection kit have the advantages that the operation is simple, the cost is low, and the application range is wide.

Description

A kind of method of XmnI surveyor's esophageal carcinoma RAD51 gene rs45549040 polymorphism

Technical field

The invention belongs to biological technical field, a kind of method relating to XmnI surveyor's esophageal carcinoma RAD51 gene rs45549040 polymorphism.

Background technology

Single nucleotide polymorphism (single nucleotide polymorphism, SNP), is primarily referred to as in genomic level the DNA sequence polymorphism caused by the variation by single core thuja acid.It is modal one in the heritable variation of the mankind.Account for more than the 90% of all known polymorphisms.SNP is widely present in human genome, just has 1 in the most every 500～1000 base pairs, estimates that its sum is the most up to 3,000,000.CAPs (cleaved amplification polymorphism sequence-tagged sites) CAPs technology is also called PCR-RFLP, restriction fragment length polymorphism polymerase chain reaction (PCR-RFLP) technology.The ultimate principle of PCR-RFLP is to expand target DNA with PCR, and amplified production cuts into different size fragment with specificity endonuclease digestion again, directly differentiates on gel electrophoresis.The most homoallelic restriction enzyme site distribution difference, produces the DNA fragmentation band of different length.Technique substantially increases content and the relative specificity of target DNA, and method is easy, and the typing time is short.This method, compared with RFLP, except for the difference that instead of enzyme action with amplification, it is to avoid the steps such as loaded down with trivial details for RFLP DNA enzymatic is cut, shifted, hybridization.

RAD51 gene (RAD51recombinase) is positioned at human chromosomal 15q15.1, and the protein of this gene code is a member of RAD51 protein family.Rad51 protein family member is similar to antibacterial RecA and saccharomyces cerevisiae Rad51 albumen height, generally acknowledges now that it participates in DNA homology recombination repair.This albumen matches at homologous chromosome by interacting with single-stranded DNA binding protein RPA and RAD52 and plays a significant role in DNA transfer process.Some research finds that this albumen and BRCA1 and BRCA2 gene there is also interaction, this interaction is in the DNA damage of cell is reacted most important (NIH's state-run medical library biology information technology center, http://www.ncbi.nlm.nih.gov).There are some researches show that RAD51 gene pleiomorphism exists with kinds of tumors to associate.

Rs45549040 is positioned at people RAD51mRNA3 ' untranslated region (3 ' untranslated region, 3 ' UTR) (NIH's state-run medical library biology information technology center, http://www.ncbi.nlm.nih.gov).Generally this polymorphic genotype that there are three kinds of RAD51 genes in crowd: AA type (two allele bases of human genome rs45549040 polymorphic site are A), AC type (two allele bases of human genome rs45549040 polymorphic site are respectively C and A) and CC type (two allele bases of human genome rs45549040 polymorphic site RAD51 are C).

The restricted enzyme that surveyor esophageal carcinoma RAD51 gene polymorphic rs45549040 uses often at present is expensive, and experimental cost is high, it is difficult to universal use in the lab.Therefore, this area exists simple to operate, low cost, the demand of the novel detection SNP method that range is wide.

Sequence specific primers PCR is also referred to as ApoE gene (AS-PCR), its principle be based on Taq DNA polymerase can not DNA plerosis primer at the single base mispairing of 3 ' ends.So, when 3 ' terminal nucleotides of primer are complementary with allelic variation site sequences, then template is amplified.But, when primer 3 ' terminal nucleotide and template mispairing, then template will not be amplified or amplification efficiency is extremely low.Each allelic detection, need to design two set primers, a set of for allele-specific primers, a set of for general primer.After PCR primer gel electrophoresis, the presence or absence of DNA is detected by ultraviolet (uv) transmission, and existence or the disappearance of DNA band i.e. can determine that genotype.Another pair of primers (generally expanding one section of human growth hormone gene) in same reaction always produces a DNA segment, unrelated with HPA genotype, as the control of PCR effectiveness.The shortcoming of gene specific PCR (AS-PCR) is that amplification efficiency is relatively low, and specific amplification is poor, and therefore the specificity of PCR primer cannot ensure with stability, and meanwhile, genotyping result is relatively easy to erroneous judgement, less stable.

TaqMan probe method refers to it is possible to additionally incorporate a specific fluorescent probe adding while pair of primers when PCR expands, this probe only with template specificity combine, its binding site is between two primers.5 ' ends of probe are marked with fluorescent reporter group (Reporter, R), and such as FAM, VIC etc., 3 ' ends are marked with fluorescent quenching group (Quencher, Q), such as TAMRA etc..When probe is complete when, the fluorescence that 5 ' end reporter groups excite through light source for instrument is just held fluorophor cancellation by in-plant 3 ', instrument can't detect the fluorescence signal (that is the transmitting wavelength of 5 ' fluorophors is exactly the absorbing wavelength of 3 ' fluorophors, thus energy is delivered to 3 ' fluorophors by absorption and sends other fluorescence) that 5 ' end reporter groups are excited.Carrying out along with PCR, Taq enzyme runs into the probe being combined with template during chain extension, (this activity is double-stranded specific to its 5 '-3 ' 5 prime excision enzyme activity, free single-stranded probe is unaffected) will will cut probe, release 5 ' end reporter group is free in reaction system, away from the shieldings of 3 ' end fluorescent quenching groups, 5 ' end reporter groups launched fluorescence signals that are stimulated just can be detected by probe.The most often one DNA of amplification, just has a fluorescence molecule to be formed, it is achieved that the accumulation of fluorescence signal forms Complete Synchronization with PCR primer.The intensity of report signal just represents the copy number of template DNA.Taqman fluorescence probe method needs expensive instrument and longer step, relatively costly, it is difficult to universal use in the lab.

The cardinal principle of dye method gene qualitative analysis (HRM) is the length according to DNA sequence, G/C content and base complementrity sex differernce, applying high-resolution melting curve to be analyzed sample, its high temperature uniformity and temperature resolution make resolving accuracy can reach the differentiation to single base difference.The shortcoming of dye method gene method for qualitative analysis is that as long as the DNA of double-strand can be in conjunction with luminescence, therefore, specificity is poor owing to dye method specificity is not strong.

Summary of the invention

In order to overcome defect present in prior art, the present invention provides a kind of simple to operate, low cost, the applied widely method using XmnI surveyor's esophageal carcinoma RAD51 gene rs45549040 polymorphism, the restricted enzyme used is cheap, and primer synthesizes and each reagent is the most relatively inexpensive, in addition PCR-RFLP is simple to operate, reproducible, the method is on the premise of saving experimental cost, by the improvement of PCR-RFLP technology, carry out the test kit of exploiting economy, quickly detection human esophagus cancer RAD51rs45549040 gene pleiomorphism.

Its technical scheme is as follows:

A kind of method of XmnI surveyor's esophageal carcinoma RAD51 gene rs45549040 polymorphism, comprises the following steps:

The genomic DNA of (a) extracting sample；

B () provides forward primer and the reverse primer of amplification human esophagus cancer RAD51 gene pleiomorphism rs45549040 location proximate sequence, rs45549040 forward primer: 5 '-GTCTGTCTGAATGATCTTGTG-3 ', rs45549040 downstream primer: 5 '-GGAAACCCTGTCTTGAAATAG-3 ', the human gene group DNA to be measured extracted with step (a) is as template, carry out PCR amplification, obtain amplified production；

C () uses restricted enzyme that the amplified production obtained in step (b) is carried out enzyme action, obtain corresponding digestion products；

D digestion products is used the agarose gel of 3% to carry out electrophoresis, to judge each genotype of RAD51 gene pleiomorphism rs45549040 by ().Wherein, having two band persons for AA genotype after electrophoresis, three band persons are AC genotype, and a band person is CC genotype.

Compared with prior art, beneficial effects of the present invention:

The present invention uses PCR machine (PCR-RFLP) method, it is to use polymerase chain reaction (PCR) amplification target DNA fragment, then by DNA fragmentation digestion with restriction enzyme to be detected, restricted enzyme identification also cuts special sequence, then the product after enzyme action is carried out electrophoresis, analyzed the special of this section of sequence by restriction endonuclease map (restriction map) again and cut site, carry out the diversity of comparison separate sources gene order by the multiformity of fragment.It is simply that first PCR expands corresponding purpose segment, then carry out restriction enzyme enzyme action reaction, observe after electrophoresis and compare the difference that restriction map comes between analytical sequence.The method is reproducible, and operation is relatively simple, and low cost, enzyme action result is easily discernible.The invention provides a kind of simple to operate, low cost, the method for detection human esophagus cancer tumor susceptibility gene RAD51 polymorphism rs45549040 applied widely and detection kit, the susceptibility of the measurable esophageal carcinoma, for clinical early diagnosis.

Accompanying drawing explanation

Fig. 1 is pcr amplification reaction program；

Fig. 2 is the electrophoresis pattern in RAD51rs45549040 site；

Fig. 3 is RAD51rs45549040 site CC genotype Sequencing chromatogram；

Fig. 4 is RAD51rs45549040 site AC genotype Sequencing chromatogram；

Fig. 5 is RAD51rs45549040 site AA genotype Sequencing chromatogram.

Detailed description of the invention

Technical scheme is further illustrated below in conjunction with the accompanying drawings with embodiment.

The invention provides a kind of method detecting esophageal carcinoma tumor susceptibility gene, applied widely owing to identifying the restricted enzyme XmnI of specific site, price is relatively inexpensive, and then greatly reduces the cost of detection SNP.Finding through sequence analysis, detecting method polymorphic for this G/A and can use 4 kinds of enzymes in table 1, wherein in table, first three enzyme is not common enzyme, does not all have the sale of these enzymes at present in Ji Jia Reagent Company.Considering simple operations and economic and practical, restricted enzyme XmnI is only selection.

The price of the restricted enzyme provided in table 1 is from NEB company (http://www.neb-china.com), and the selection of restricted enzyme obtains (http://watcut.uwaterloo.ca/template.php from WatCut restriction endonuclease analysis software？Act=snp_new), in this, as restriction enzyme enzyme recognition site and the reference of price.

Several restriction endonuclease recognition sequence of table 1 and price thereof

In an embodiment of the present invention, the Primer6.0 software that is designed with of forward primer and reverse primer is carried out, and the principle of design considers the impact of sensitivity, specificity and amplification efficiency that PCR is expanded by primer.According to the principle design primer that base is the most unpaired, primer length is typically between 15～30 bases, and the long or short poor specificity that all can cause, long its elongating temperature that also results in, more than 74 DEG C, is unsuitable for Taq DNA polymerase and reacts.Primer G/C content is between 40%～60%, and Tm value is preferably close to 72 DEG C, and G/C content is too high or too low is all unfavorable for initiation reaction.Base wants random distribution, should there is not complementary series between primer self and primer, and otherwise primer self can be folded into hairpin structure and make the renaturation of primer own.Primer 5 ' end and middle △ G-value should be of a relatively high, and 3 ' end △ G-value are relatively low.The strand of amplified production can not form secondary structure.Primer should have specificity, after design of primers completes, tackles it and carries out BLAST detection, to guarantee that itself and other gene do not have complementarity.On this basis, the forward primer finally chosen: 5 '-GTCTGTCTGAATGATCTTGTG-3 ', downstream primer: 5 '-GGAAACCCTGTCTTGAAATAG-3 '.Thus fragment 558bp in the face that primer amplification goes out, amplified production is as follows:

GTCTGTCTGAATGATCTTGTGTAAGGTTTTGGTTATGGAGTCTTGTGCCAAACCTACTAGGCCATTAGCCCTTCACCATCTACCTGCTTGGTCTTTCATTGCTAAGACTAACTCAAGATAATCCTAGAGTCTTAAAGCATTTCAGGCCAGTGTGGTGTCTTGCGCCTGTACTCCCAGCACTTTGGGAGGCCGAGGCAGGTGGATCGCTTGAGCCCAGGAGTTTTAAGTCCAGCTTGGCCAAGGTGGTGAAATCCCATCTCTACAAAAAATGCAGAACTTAATCTGGACACACTGTTACACGTGCCTGTAGTCCCAGCTACTCGATAGCCTGAGGTGGGAGAATCACTTAAGCCTGGAAGGTGGAAGTTGCAGTGAGTCGAGATTGCACTGCTGCATTCCAGCCAGGGTGACAGAGTGAGACCATGTTTCAAACAAGARACATTTCAGAGGGTAAGTAAACAGATTTGATTGTGAGGCTTCTAATAAAGTAGTTATTAGTAGTGAATGTGCTGTTTATAGCAATTATTGCAGTGCAAGCTATTTCAAGACAGGGTTTCC(558bp)

Underscore part is respectively forward primer and reverse primer, and the 438th bp R represents polymorphic i.e. SNP site rs45549040 of A/C.The amplified production of this length of 558bp can produce 178bp, 558bp, 440bp and 118bp totally three kinds of clip types after restricted enzyme XmnI enzyme action.Genotype result of determination: AA mutated-genotype, a length of 440bp, and 118bp tetra-band；CC wild-type genotype, a length of 558bp mono-band；CA heterozygous genotypes, a length of 558bp, 440bp and 118bp tri-band.

Gel electrophoresis is divided into agarose gel electrophoresis and polyacrylamide gel electrophoresis, agarose (Agarose) to be a kind of linear polysaccharide polymer, is to extract from Red seaweeds product agar and come.After agarose solution is heated to boiling point, cooled and solidified will form good electrophoretic medium, and its density is to be determined by the concentration of agarose, and can be used for DNA fragmentation prepares electrophoresis.Polyacrylamide gel mainly has two ways: one is for separating and the non-denaturing polyacrylamide gel of purification double chain DNA fragment, and two is for separating and the denaturing polyacrylamide gel of purification of single stranded DNA fragmentation.But consider practicality, convenience and economy, use agarose gel electrophoresis to can yet be regarded as a kind of optimum selection.In the present invention, primer amplification condition is as it is shown in figure 1, purpose amplified production uses enzyme action 6-14h in restriction endonuclease XmnI5U water-bath.Digestion products uses the agarose of 3% to carry out agarose gel electrophoresis, judges wild homozygous genotype, heterozygous genotypes and mutant homozygous genotype according to different bands under ultra violet lamp.

In the present invention, the reaction condition of PCR amplification system is not particularly limited, PCR-based principle three step and degeneration-annealing-extension three temperature spot is set.Using three temperature spot methods in standard reaction, double-stranded DNA is 90～95 DEG C of degeneration, then is rapidly cooled to 40～60 DEG C, and primer annealing is also attached on target sequence, is then rapidly heated to 70～75 DEG C, under the effect of Taq DNA polymerase, makes primer strand extend along template.Two temperature spot methods can be used for shorter target gene (when a length of 100～300bp), in addition to denaturation temperature, annealing can unite two into one with elongating temperature, 94 DEG C of degeneration of general employing, about 65 DEG C annealing and extension (this temperature TaqDNA enzyme still has higher catalysis activity).And higher concentration and purity requirement are not had yet for DNA to be measured, both can be the DNA extracted in human body fluid or tissue, it is also possible to be the genome through degradation treatment in advance.But implementing for convenience and reduce experimenter's misery, ordinary priority selects to carry out the extraction of genomic DNA from blood.

The present invention is through research, demonstrate RAD51 gene mononucleotide polymorphism site rs45549040 first to be positioned in 3 '-UTR, the invention provides a kind of method detecting esophageal cancer susceptibility gene on this basis, utilize the genotype of detection site of the present invention, method is simple, rapidly and efficiently, with low cost, the diagnosis for the esophageal carcinoma provides a simple and direct new way.

In specific embodiments of the present invention, the present invention detects specifically comprising the following steps that of human esophagus cancer RAD51 gene polymorphic rs45549040

L () extracts human gene group DNA's template to be measured, described human gene group DNA's template is the human genome template that human body any part obtains.

(2) PCR amplifying genom DNA, carries out PCR amplification to templet gene group DNA extracted, it is thus achieved that containing the PCR primer of polymorphic neighbouring sequence.

(3) pcr amplification product restriction endonuclease XmnI is carried out endonuclease reaction, obtain digestion products；

(4) digestion products carries out agarose and carries out agarose gel electrophoresis, judges wild homozygous genotype, heterozygous genotypes and mutant homozygous genotype according to different bands under ultra violet lamp.

Below each key step above-mentioned is described in detail:

1 materials and methods

1.1 key instruments and reagent

Instrument: BCD-228CH refrigerator (newly flies electrical equipment), HH-2 digital display thermostat water bath (China's peak instrument), SmartGel gel imaging instrument (Beijing match intelligence is started an undertaking), GT9612 grads PCR instrument (hundred Tykes are biological), WD900SL23-2 model microwave oven (Glanz electrical equipment), DG-300C type electrophresis apparatus (ancient cooking vessel state prosperity is biological) etc..

Reagent: NEP004-1DNA extracts test kit (ancient cooking vessel state prosperity is biological), 50bp DNA Ladder (Lay thing humorously), 2 × Taq PCR Mix (Lay thing humorously), XmnI (Thermo), agarose (SIGMA) etc..

1.2 design of primers

In the dbSNP data base of NCBI, the nucleotide sequence searching RAD51rs45549040 is as follows:

GGTCTGCACAGATTCTTTTTTTCTGTCAGTAAAACTCTCAAGCAGGTTTTTAAGTTGTCTGTCTGAATGATCTTGTGTAAGGTTTTGGTTATGGAGTCTTGTGCCAAACCTACTAGGCCATTAGCCCTTCACCATCTACCTGCTTGGTCTTTCATTGCTAAGACTAACTCAAGATAATCCTAGAGTCTTAAAGCATTTCAGGCCAGTGTGGTGTCTTGCGCCTGTACTCCCAGCACTTTGGGAGGCCGAGGCAGGTGGATCGCTTGAGCCCAGGAGTTTTAAGTCCAGCTTGGCCAAGGTGGTGAAATCCCATCTCTACAAAAAATGCAGAACTTAATCTGGACACAC TGTTACACGTGCCTGTAGTCCCAGCTACTCGATAGCCTGAGGTGGGAGAATCACTTAAGCCTGGAAGGTGGAAGTTGCAGTGAGTCGAGATTGCACTGCTGCATTCCAGCCAGGGTGACAGAGTGAGACCATGTTTCAAACAAGAAACATTTCAGAGGGTAAGTAAACAGATTTGATTGTGAGGCTTCTAATAAAGTAGTTATTAGTAGTGAATGTGCTGTTTATAGCAATTATTGCAGTGCAAGCTATTTCAAGACAGGGTTTCCATAATCTTTTTGGCACTGTATAGGGGTGATCAGTTTCTGTTGCTTCAAGATTTGAAACCAGAAAGGAAAGTCCCACTTGCA

It is polymorphic that 494th base R of gene order represents A/G, is the pleomorphism site of rs45549040.nullAbove sequence is affixed in primer-design software Primer Premier 6.0，The parameter such as primer length and amplification purpose fragment length is set and carries out design of primers，Optimum upstream and downstream primer is selected according to G/C content and annealing temperature etc.，Again this primer is carried out primer comparison with the Blast sequence alignment function (http://blast.ncbi.nlm.nih.gov/Blast.cgi) in Pubmed，The upstream and downstream primer finally determined is forward primer sequence: 5 '-GTCTGTCTGAATGATCTTGTG-3 '，Reverse sequence: 5 '-GGAAACCCTGTCTTGAAATAG-3 '，The synthesis of primer can use method (such as solid-phase synthesis) generally in the art，Also biotech firm can be entrusted to synthesize.

The selection of 1.3 restricted enzyme

Base sequence according in dbSNP five sites, with WatCut online restriction endonuclease analysis software, on-line search obtains the information of the restricted enzyme in recognizable mutational site, considers its enzyme action specificity and the optimal restricted enzyme XmnI of economic and practical Sexual behavior mode.

1.4 genomic DNAs extracting sample to be tested from whole blood

Genomic DNA is extracted in strict accordance with centrifugal column type DNA extraction kit operating procedure.

L) after adding 300 μ l hemocytees in 1.5ml centrifuge tube, add 900 μ l cell pyrolysis liquids to be mixed evenly, after placing 10min on ice, in centrifuge, 12000rpm is centrifuged 1min, abandon supernatant, again add 900 μ l cell pyrolysis liquids, after blowing afloat precipitation with rifle and mix, repeat the above steps；

2) adding 600 μ l solution B solution in precipitate, after blowing afloat precipitation gently with liquid-transfering gun, add 10 μ l E.C. 3.4.21.64 mixings, after placing 10min in 70 DEG C of water-baths, 12000rpm is centrifuged 5min；

3) in the new centrifuge tube proceeding to the supernatant in centrifuge tube to compile number, then adding 500 μ l dehydrated alcohol in new centrifuge tube, period, this floccule was DNA it is possible that flocky precipitate；

4) being proceeded to by the liquid of mixing (if once cannot not turn completely, graded proceeds to) in centrifugal column, room temperature stands 2min, then 12000rpm is centrifuged 1min, abandons waste liquid；

5) adding 700 μ l and added the solution C rinsing liquid of respective volume dehydrated alcohol, room temperature stands 2min, 12000rpm and is centrifuged 1min, abandons waste liquid；

6) adding 700 μ l and added the solution D rinsing liquid of respective volume dehydrated alcohol, room temperature stands 2min, 12000rpm and is centrifuged 1min, abandons waste liquid；

7) adding 500 μ l solution D rinsing liquids, 12000rpm is centrifuged 1min, abandons waste liquid；

8) recentrifuge 2min, is placed in centrifugal column in the new centrifuge tube compiled number, uncovered puts into 37 DEG C of calorstat 10min until without obvious ethanol taste；

9) have been preheated with the solution E 100 μ l of 65 DEG C in the addition of silica-based plasma membrane central authorities, room temperature is placed 5min, 12000rpm and is centrifuged 1min, and once, the liquid after being centrifuged eventually is the genomic DNA extracted to repeat the above steps；

10) draw the DNA NanoPhotometer Pearl micro-spectrophotometer that 2 μ l extract and measure its concentration and purity.

2 results

2.1PCR amplification

(1) according to the concentration of extraction genomic DNA, the DNA of object of study is diluted, makes final concentration of 20 μ g/ μ l.

(2) PCR amplification system is each 0.3 μ l of 2 × Taq PCR Mix 7.5 μ l, forward primer and downstream primer, template DNA 1.0 μ l, finally supplements cumulative volume to 15 μ l with distilled water.

(3) PCR reaction condition: first stage is the denaturation stage, 94 DEG C/5min；Second stage includes totally 35 circulations of three steps, to set gradually be 94 DEG C/30s, 57 DEG C of annealing time 45s, 72 DEG C/45s；72 DEG C/5min of three phases.Product Sequence after amplification is:

Underscore part is respectively forward primer and reverse primer, and the 438th bp R represents polymorphic i.e. SNP site rs45549040 of A/C.

2.2 endonuclease reaction

Enzyme action system is pcr amplification product 5 μ l, restricted enzyme 0.5 μ l, Buffer 1.0 μ l, finally supplements cumulative volume to 15 μ l with distilled water.Mixing is placed in water-bath 37 DEG C of water-baths 4-16 hour.

The judgement of 2.3 genotype

By digestion products with 3% agarose gel under conditions of 4-10V/cm, electrophoresis 20-40min, after distinguishing obvious band and qualification of taking pictures to uviol lamp.For different genotype, rs45549040 site different genotype shows different bands (see Fig. 2), AA mutated-genotype, a length of 440bp and 118bp two band；CC wild-type genotype, a length of 558bp mono-band；AC heterozygous genotypes, a length of 440bp, 118bp and 558bp tri-band.Each genotype is all identified with further through order-checking, and the result that sequencing result (see Fig. 3-5) display records with prior art is identical.

Be presented herein below implement the present invention some embodiments:

Embodiment 1. Human Esophageal Carcinoma specimen measures human esophagus cancer RAD51rs45549040 polymorphism.

In specific embodiments of the present invention, detection human esophagus cancer RAD51 gene polymorphic rs45549040 specifically comprises the following steps that

L () obtains the stomach organization that operation cuts, use the genomic DNA of phenol-chloroform method extraction stomach organization as DNA to be measured, and extraction step is as follows:

1) being thawed by stomach organization block, wash away blood stains with normal saline, the tissue of clip 0.1g is milled, and adds the aquesterilisa of 1ml, and reverse mixing, 10000rpm is centrifuged 10min, abandons supernatant, and above step is repeated twice

2) adding the DNA lysate of 200 μ l, the E.C. 3.4.21.64 mixing of 5 μ l, 55 DEG C of water-baths digest overnight.

3) add isopyknic phenol chloroform mixed liquor (1:1) after having digested, acutely shake so that it is become milk coffee color.12000rpm is centrifuged 10min.

4) avoid when taking supernatant touching intermediate medium and lower floor's liquid.Reverse mixing after adding isopyknic chloroform.12000rm is centrifuged 10min.

5) take supernatant, note avoiding touching intermediate medium and lower floor's liquid.The sodium acetate of addition 1/10 and the dehydrated alcohol of 2.5 times, reverse mixing, 12000rpm is centrifuged 10min, abandons supernatant.

6) adding 1ml 70% ethanol so that it is white precipitate suspends, and for several times, 12000rpm is centrifuged 10min in reverse mixing, abandon supernatant, room temperature stands 5-10min makes ethanol volatilization clean.

7) add 50 μ l aquesterilisa dissolving DNAs, obtain stomach organization genomic DNA.

null(2) base sequence information obtains from the dbSNP data base of NCBI，CHIP website is checked，Specify accurate rear employing Primer Premier 6.0 and design each site primer，In conjunction with annealing temperature、It is forward primer sequence: 5 '-GTCTGTCTGAATGATCTTGTG-3 ' that the information siftings such as the Blast sequence alignment result (http://blast.ncbi.nlm.nih.gov/Blast.cgi) in G/C content and Pubmed go out optimum primer，Reverse sequence: 5 '-GGAAACCCTGTCTTGAAATAG-3 '，Carry out PCR primer amplification，Preparation PCR amplification system: 2 × TaqPCRMix7.5 μ l，Distilled water 5.9 μ l，Forward primer 0.3 μ l，Downstream primer 0.3 μ l and template DNA 1.0 μ l，Fully i.e. obtain 15.0 μ lPCR amplification reaction systems after mixing；According to the first stage: 94 DEG C of degeneration 5min, second stage includes three steps of 35 circulations, first 94 DEG C degeneration 30s altogether, 57 DEG C of annealing 45s, last 72 DEG C extend 45s, the phase III: 72 DEG C extend 5min, final 4 DEG C store with standby, obtain the pcr amplification product of a length of 558bp；

(3) the SNP fragment enzyme action 6-14h in restriction endonuclease XmnI 5U water-bath after amplification, PCR product 5 μ l, restricted enzyme 0.5 μ l, Buffer1.0 μ l and nuclease free pure water 8.5 μ l amounts to 15 μ l enzyme action systems, in water-bath, 37 DEG C of enzyme action 6-14h, obtain digestion products.

(4) digestion products uses the agarose of 3% to carry out agarose gel electrophoresis, judges wild homozygous genotype, heterozygous genotypes and mutant homozygous genotype (being shown in Table 2) according to different bands under ultra violet lamp.

Table 2rs45549040 loci gene type judges

Embodiment 2. human peripheral whole blood sample measures human esophagus cancer RAD51rs45549040 polymorphism

Essentially identical with the step of embodiment 1, extract genomic DNA as DNA to be measured in simply using method below from human peripheral.

Carry out the extraction of blood sample genomic DNA to be measured according to the operating procedure of NEP004-1 Whole Blood Genomic DNA extraction test kit, specifically comprise the following steps that

2) adding 600 μ l solution B solution in precipitate, after blowing afloat precipitation gently with liquid-transfering gun, add 10 μ l E.C. 3.4.21.64 mixings, after placing 10min in 70 DEG C of water-baths, 12000rpm is centrifuged 5min.

9) have been preheated with the solution E 100 μ l of 65 DEG C in the addition of silica-based plasma membrane central authorities, room temperature is placed 5min, 12000rpm and is centrifuged 1min, and once, the liquid after being centrifuged eventually is the genomic DNA extracted to repeat the above steps.

Carry out the qualification of genotype after extracting complete genomic DNA according to the step of case one, qualification result is as follows: by digestion products qualification of taking pictures under uviol lamp after the agarose gel electrophoresis of 3%.For different genotype, rs45549040 site different genotype shows different bands (see Fig. 2), AA mutated-genotype, a length of 440bp and 118bp two band；CC wild-type genotype, a length of 558bp mono-band；AC heterozygous genotypes, a length of 440bp, 118bp and 558bp tri-band.Each genotype is all identified with further through order-checking, and the result that sequencing result (see Fig. 3 to 5) display records with prior art is identical.

The present invention can carry out the appraisal of genotype after PCR primer is carried out restriction enzyme digestion and electrophoresis, therefore has the biggest motility in practice, and detection method is simple in addition, is therefore a kind of good method carrying out single base mutation loci gene type qualification.Key problem in technology point is the upstream and downstream primer of RAD51 polymorphism rs45549040 designed, forward primer sequence: 5 '-GTCTGTCTGAATGATCTTGTG-3 ', reverse sequence: 5 '-GGAAACCCTGTCTTGAAATAG-3 ' and the use of restricted enzyme XmnI.The method of detection human esophagus cancer tumor susceptibility gene RAD51 polymorphism rs45549040 provided by the present invention is simple to operate, low cost, applied widely.

The above, only best mode for carrying out the invention, any those familiar with the art is in the technical scope of present disclosure, and the simple change of the technical scheme that can become apparent to or equivalence are replaced and each fallen within protection scope of the present invention.

Claims

1. the method by XmnI surveyor's esophageal carcinoma RAD51 gene rs45549040 polymorphism, it is characterised in that bag Include following steps:

The genomic DNA of (a) extracting sample；

B () provides the forward primer of amplification human esophagus cancer RAD51 gene pleiomorphism rs45549040 location proximate sequence and reversely draws Thing, rs45549040 forward primer: 5 '-GTCTGTCTGAATGATCTTGTG-3 ', rs45549040 downstream primer: 5 '- GGAAACCCTGTCTTGAAATAG-3 ', the human gene group DNA to be measured extracted with step (a), as template, is carried out PCR expands, and obtains amplified production；

D digestion products is used the agarose gel of 3% to carry out electrophoresis, to judge RAD51 gene pleiomorphism rs45549040's by () Each genotype, wherein, has two band persons for AA genotype after electrophoresis, and three band persons are AC genotype, a rule Band person is CC genotype.