CN105695613A - Method for detecting polymorphism of human gastric cancer susceptible genes IL17A rs3748067 by aid of ApoI - Google Patents

Abstract

The invention discloses a method for detecting the polymorphism of human gastric cancer susceptible genes IL17A rs3748067 by the aid of ApoI. The method includes amplifying target DNA (deoxyribonucleic acid) fragments by means of polymerase chain reaction; digesting to-be-detected DNA fragments by the aid of restriction incision enzymes; identifying and cutting specific sequences by the aid of the restriction incision enzymes; carrying out electrophoresis on digested products; analyzing cleavage sites of the sequences of the fragments by the aid of restriction maps; comparing the difference of gene sequences from different sources by the aid of the diversity of the fragments. The method has the advantages that briefly speaking, the corresponding target fragments are amplified by means of PCR (polymerase chain reaction) at first, then digestion reaction is carried out by the aid of the restriction incision enzymes, the restriction maps are observed and compared after electrophoresis is carried out, and accordingly the difference between the sequences can be analyzed; the method is good in repeatability, easy to implement and low in cost, and digestion results are easy to identify; the method and detection reagent kits which are easy to implement, low in cost and wide in application range can be provided for detecting the polymorphism of the human gastric cancer susceptible genes IL17A rs3748067.

Description

A kind of ApoI detects the method for people's stomach cancer susceptible genes IL17A rs3748067 polymorphism

Technical field

The invention belongs to biological technical field, relate to a kind of ApoI method detecting people's stomach cancer susceptible genes IL17Ars3748067 polymorphism。

Background technology

Single nucleotide polymorphism (singlenucleotidepolymorphism, SNP), the DNA sequence polymorphism being primarily referred to as in genomic level caused by the variation of single core thuja acid。It is modal one in the heritable variation of the mankind。Account for more than the 90% of all known polymorphisms。SNP is widely present in human genome, on average just has 1 in every 500～1000 base pairs, estimates that its sum is even more up to 3,000,000。CAPs (cleavedamplificationpolymorphismsequence-taggedsites) CAPs technology is also called PCR-RFLP, restriction fragment length polymorphism polymerase chain reaction (PCR-RFLP) technology。The ultimate principle of PCR-RFLP is to use pcr amplification target DNA, and amplified production cuts into different size fragment with specificity endonuclease digestion again, directly differentiates on gel electrophoresis。Not homoallelic restriction enzyme site distribution difference, produces the DNA fragmentation band of different length。Technique substantially increases content and the relative specificity of target DNA, and method is easy, and the typing time is short。This method is compared with RFLP, the difference is that instead of enzyme action with amplification, it is to avoid the steps such as loaded down with trivial details for RFLP DNA enzymatic is cut, shifted, hybridization。

In worldwide, gastric cancer remains one of the highest malignant tumor of M & M。Gastric cancer is a multi-step, multifactor, the multistage, and the coefficient result of number of mechanisms, including genetic factors, biological factor and multiple environmental risk factors。Although the existing significant decline of the mortality rate of gastric cancer in recent years, but the five year survival rate of gastric cancer remains unchanged very low。Inflammatory reaction is always up the focus of relevant focus of attention to the research of relation between tumor, and the experimental results shows that stomach helicobacter pylori infections and stomach chronic inflammatory disease are in close relations。Helicobacter pylori infections and immune cytokine especially interleukin family significant correlation。Increasing research finds multiple inflammatory cytokine in stomach organization and helicobacter pylori infections associated gastritis tissue, and the expression such as IL17A, IL23R etc. significantly raises。Therefore, research gastric cancer gene genetic multiformity is necessary。As the cytokine that a class is important, IL17 family gene may participate in physiological process widely, and one of them important role regulates acute and chronic inflammation disease。IL17 family plays a significant role in the immunoreation caused by helicobacter pylori field planting, also plays the very strong granulocytic effect in center of raising simultaneously, participates in multiple chronic inflammatory diseases, be the major reason causing the precancerous lesions such as gastric mucosa atrophy。Many researchs find that the gene pleiomorphism of IL17 gene family is relevant to gastric cancer susceptibility。IL17A achieves greater advance in the research of tumor area in recent years, but its research in gastric cancer field is carried out relatively fewer, therefore IL17A loci polymorphism relevant for certain function is combined with gastric cancer and can better inquire into its effect to gastric cancer forming process, disclose the relatedness of itself and gastric cancer generation and then inquire into concrete molecular mechanism therein。

Sequence specific primers PCR also referred to as ApoE gene (AS-PCR), its principle be based on TaqDNA polymerase can not DNA plerosis primer at the single base mispairing of 3 ' ends。So, when 3 ' terminal nucleotides of primer are complementary with allelic variation site sequences, then template is amplified。But, when primer 3 ' terminal nucleotide and template mispairing, then template will not be amplified or amplification efficiency is extremely low。Each allelic detection, need to design two set primers, a set of for allele-specific primers, a set of for general primer。After PCR primer gel electrophoresis, the presence or absence of DNA is detected by ultraviolet (uv) transmission, and namely existence or the disappearance of DNA band can determine that genotype。Another pair of primers (generally expanding one section of human growth hormone gene) in same reaction always produces a DNA segment, unrelated with HPA genotype, as the control of PCR effectiveness。

The shortcoming of gene specific PCR (AS-PCR) is that amplification efficiency is relatively low, and specific amplification is poor, and therefore the specificity of PCR primer and stability cannot ensure, meanwhile, genotyping result is relatively easy to erroneous judgement, less stable。

It is possible to additionally incorporate a specific fluorescent probe adding while pair of primers when TaqMan probe method refers to pcr amplification, this probe only with template specificity combine, its binding site is between two primers。5 ' ends of probe are marked with fluorescent reporter group (Reporter, R), and such as FAM, VIC etc., 3 ' ends are marked with fluorescent quenching group (Quencher, Q), such as TAMRA etc.。When probe is complete time, the fluorescence that 5 ' end reporter groups excite through light source for instrument is just held fluorophor cancellation by in-plant 3 ', instrument can't detect the fluorescence signal (that is the transmitting wavelength of 5 ' fluorophors is exactly the absorbing wavelength of 3 ' fluorophors, thus energy is delivered to 3 ' fluorophors by absorption and sends other fluorescence) that 5 ' end reporter groups excite。Carrying out along with PCR, Taq enzyme runs into the probe being combined with template in chain extension process, (this activity is double-stranded specific to its 5 '-3 ' 5 prime excision enzyme activity, free single-stranded probe is unaffected) will will cut probe, release 5 ' end reporter group is free in reaction system, away from the 3 ' shieldings holding fluorescent quenching groups, the 5 ' end reporter groups fluorescence signals launched that are stimulated just can be detected by probe。That is often expand a DNA, just have a fluorescence molecule to be formed, it is achieved that the accumulation of fluorescence signal forms Complete Synchronization with PCR primer。The intensity of report signal just represents the copy number of template DNA。

Taqman fluorescence probe method needs expensive instrument and longer step, relatively costly, it is difficult to universal use in the lab。

The cardinal principle of dye method gene qualitative analysis (HRM) is according to the length of DNA sequence, G/C content and base complementrity sex differernce, sample is analyzed by the melting curve of application of high resolution, and its high temperature uniformity and temperature resolution make resolving accuracy can reach the differentiation to single base difference。

The shortcoming of dye method gene method for qualitative analysis is in that as long as the DNA of double-strand can in conjunction with luminescence, therefore, specificity is poor owing to dye method specificity is not strong。

Summary of the invention

In order to overcome the defect existed in prior art, the present invention provides a kind of ApoI method detecting people's stomach cancer susceptible genes IL17Ars3748067 polymorphism, the method adopts polymerase chain reaction (PCR) to expand target DNA fragment, then by DNA fragmentation digestion with restriction enzyme to be detected, restricted enzyme identification also cuts special sequence, then the product after enzyme action is carried out electrophoresis, analyzed the special of this section of sequence by restriction endonuclease map (restrictionmap) again and cut site, the diversity of comparison separate sources gene order is carried out by the multiformity of fragment。It is simply that the first corresponding purpose segment of pcr amplification, then carry out restriction enzyme enzyme action reaction, observe after electrophoresis and compare the difference that restriction map comes between analytical sequence。The method is reproducible, and operation is relatively simple, and cost is low, and enzyme action result is easily discernible。Therefore, it is an object of the invention to provide the method for a kind of simple to operate, cost detection people stomach cancer susceptible genes IL17A polymorphism rs3748067 low, applied widely and detection kit。

Its technical scheme is as follows:

A kind of ApoI detects the method for people's stomach cancer susceptible genes IL17Ars3748067 polymorphism, comprises the following steps:

The genomic DNA of (a) extracting sample；

B () provides forward primer and the reverse primer of amplification people's IL17A gene pleiomorphism rs3748067 location proximate sequence, rs3748067 forward primer: 5 '-AGGATGGAGTGAAGAGGAA-3 ', rs3748067 downstream primer: 5 '-AGAGATCAACAGACCAACAT-3 ', the human gene group DNA to be measured extracted with step (a) is for template, carry out pcr amplification, obtain amplified production；

C () uses restricted enzyme that the amplified production obtained in step (b) is carried out enzyme action, obtain corresponding digestion products；

D digestion products is adopted the agarose gel of 3% to carry out electrophoresis by (), to judge each genotype of IL17A gene pleiomorphism rs3748067。Wherein, having a band person for GG genotype after electrophoresis, two band persons are AG genotype, and three band persons are AA genotype。

Compared with prior art, beneficial effects of the present invention:

The method that the invention provides a kind of simple to operate, cost detection people stomach cancer susceptible genes IL17A polymorphism rs3748067 low, applied widely。This seminar early-stage Study finds that rs3748067 is substantially less than with GG genotype individuals with the onset risk of the individual gastric cancer of A allele (especially AG genotype)。There is provided this method detecting people stomach cancer susceptible genes IL17A polymorphism rs3748067 to be easily and efficiently expected to the susceptibility of prediction gastric cancer in this context, can be used for the early diagnosis of clinic。

Accompanying drawing explanation

Fig. 1 is the electrophoresis pattern in L17Ars3748067 site；

Fig. 2 is IL17Ars3748067 site GG genotype Sequencing chromatogram (backward sequencing)；

Fig. 3 is IL17Ars3748067 site AA genotype Sequencing chromatogram (backward sequencing)；

Fig. 4 is IL17Ars3748067 site AG genotype Sequencing chromatogram (backward sequencing)。

Detailed description of the invention

Technical scheme is further illustrated below in conjunction with drawings and Examples。

The invention provides a kind of method detecting stomach cancer susceptible genes, the restriction enzyme A poI owing to identifying specific site is applied widely, and price is relatively inexpensive, and then greatly reduces the cost of detection SNP。Finding through sequence analysis, detecting method polymorphic for this A/G and can use 3 kinds of enzymes in table one, consider simple operations and economic and practical, restriction enzyme A poI is only selection。

The price of the restricted enzyme provided in table 1 is from NEB company (http://www.neb-china.com), and the selection of restricted enzyme obtains (http://watcut.uwaterloo.ca/template.php from WatCut restriction endonuclease analysis software？Act=snp_new), in this, as the reference of restriction enzyme enzyme recognition site and price。

Several restriction endonuclease recognition sequence of table 1 and price thereof

In the enforcement of the present invention, the Primer6.0 software that is designed with of forward primer and reverse primer carries out, and the principle of design considers the impact of the sensitivity of primer pair pcr amplification, specificity and amplification efficiency。According to the principle design primer that base is unpaired mutually, primer length is typically between 15～30 bases, and the long or short poor specificity that all can cause, long its elongating temperature that also results in, more than 74 DEG C, is unsuitable for Taq DNA polymerase and reacts。Primer G/C content is between 40%～60%, and Tm value is preferably close to 72 DEG C, and G/C content is too high or too low is all unfavorable for initiation reaction。Base wants random distribution, should there is not complementary series between primer self and primer, and otherwise primer self can be folded into hairpin structure and make the renaturation of primer own。Primer 5 ' end and middle △ G-value should be of a relatively high, and 3 ' end △ G-value are relatively low。The strand of amplified production can not form secondary structure。Primer should have specificity, after design of primers completes, tackles it and carries out BLAST detection, to guarantee that itself and other gene do not have complementarity。On this basis, the forward primer sequence finally chosen is 5 '-AGGATGGAGTGAAGAGGAA-3 ', and downstream primer sequence is 5 '-AGAGATCAACAGACCAACAT-3 '。The thus fragment 317bp in the face that primer amplification goes out, amplified production is as follows:AGGATGGAGTGAAGAGGAAGGTCTTTCAAGAAGCAGGGAGCCTGCAGAGTGGCCTGAGAATATCTAGAGGCCTTCAGAAGTAGGGCAAGACAGCACATGGGCCATGGGGGCGAAAATGGTTACGATGTGAAACTTGAAACTACTCTGGAATTGAATGTG ATTGAGTTTTTATTTTACTTGGGCTGAACTTTTCTCATACTTAAARTTCGTTCTGCCCCATCAGCTCCTTTCTGGGTTGTGTGGTGCCTTGATCAGACAGAAGCCAGGCCCTAGGAGTGTTGCTTGAGGAAGAGAAAAATGTTGGTCTGTTGATCTCT(317bp)。

Underscore part respectively forward primer and reverse primer, the R of the 205th bp represents the polymorphic i.e. SNP site rs3748067 of A/G。This length is that the amplified production of 317bp can produce 317bp after restriction enzyme A poI enzyme action, 203bp (this fragment downstream sequence compares sticky end four strand bases of increase that upstream sequence produces due to ApoI enzyme action), 114bp (this fragment downstream sequence compares sticky end four strand bases of minimizing that upstream sequence produces due to ApoI enzyme action) totally three kinds of clip types。Genotype result of determination: AA mutated-genotype is long for 203bp and 114bp two band；GG wild-type genotype, long for 317bp；AG heterozygous genotypes, long for 317bp, 203bp and 114bp tri-band。

Gel electrophoresis is divided into agarose gel electrophoresis and polyacrylamide gel electrophoresis, agarose (Agarose) to be a kind of linear polysaccharide polymer, is extract from Red seaweeds product agar and come。After agarose solution is heated to boiling point, cooled and solidified will form good electrophoretic medium, and its density is to be determined by the concentration of agarose, and what can be used for DNA fragmentation prepares electrophoresis。Polyacrylamide gel mainly has two ways: one is for separating and the non-denaturing polyacrylamide gel of purification double chain DNA fragment, and two is for separating and the denaturing polyacrylamide gel of purification of single stranded DNA fragmentation。But consider practicality, convenience and economy, use agarose gel electrophoresis to can yet be regarded as a kind of optimum selection。Purpose fragment amplification product uses enzyme action 6-14h in restriction endonuclease ApoI5U water-bath in the present invention。Digestion products adopts the agarose of 3% to carry out agarose gel electrophoresis, judges wild homozygous genotype, heterozygous genotypes and mutant homozygous genotype according to different bands under ultra violet lamp。

In the present invention, the reaction condition of PCR amplification system is not particularly limited, PCR-based principle three step and degeneration-annealing-extension three temperature spot is set。Adopting three temperature spot methods in standard reaction, double-stranded DNA is 90～95 DEG C of degeneration, then is rapidly cooled to 40～60 DEG C, and primer annealing is also attached on target sequence, is then rapidly heated to 70～75 DEG C, under the effect of Taq DNA polymerase, makes primer strand extend along template。Two temperature spot methods can be adopted for shorter target gene (when length is 100～300bp), except denaturation temperature, annealing and elongating temperature can unite two into one, it is generally adopted 94 DEG C of degeneration, anneals and extend (this temperature TaqDNA enzyme still has higher catalysis activity) for about 65 DEG C。And for DNA to be measured also without higher concentration and purity requirement, both can be the DNA extracted in human body fluid or tissue, it is also possible to it is the genome through degradation treatment in advance。But implementing in order to convenient and reduce experimenter's misery, ordinary priority selects to carry out the extraction of genomic DNA from blood。

The present invention studies through for many years, demonstrate IL17A gene mononucleotide polymorphism site rs3748067 first and be arranged in introne 3 '-UTR, it was found that there is significant difference (P < 0.05) in IL17A gene rs3748067G → A distribution in gastric cancer cases group and normal health matched group。The invention provides a kind of method detecting gastric cancer susceptibility gene on this basis, also disclose corresponding detection kit, this test kit contains the primer in amplification site。Utilizing the genotype of detection site of the present invention, method is simple, rapidly and efficiently, with low cost, and the diagnosis for gastric cancer provides a simple and direct new way。

In specific embodiments of the present invention, the present invention detects specifically comprising the following steps that of people IL17A gene polymorphic rs3748067

(1) extracting human gene group DNA's template to be measured, described human gene group DNA's template is the human genome template that human body any part obtains。

(2) pcr amplification genomic DNA, carries out pcr amplification to the templet gene group DNA extracted, it is thus achieved that containing the PCR primer of polymorphic neighbouring sequence。

(3) pcr amplification product restriction endonuclease ApoI is carried out endonuclease reaction, obtain digestion products；

(4) digestion products carries out agarose and carries out agarose gel electrophoresis, judges wild homozygous genotype, heterozygous genotypes and mutant homozygous genotype according to different bands under ultra violet lamp。

Below each key step above-mentioned is described in detail:

1 materials and methods

1.1 key instruments and reagent

Instrument: BCD-228CH refrigerator (newly flies electrical equipment), HH-2 digital display thermostat water bath (China's peak instrument), SmartGel gel imaging instrument (Beijing match intelligence is started an undertaking), GT9612 grads PCR instrument (hundred Tykes are biological), WD900SL23-2 model microwave oven (Glanz electrical equipment), DG-300C type electrophresis apparatus (ancient cooking vessel state prosperity is biological) etc.。

Reagent: NEP004-1DNA extracts test kit (ancient cooking vessel state prosperity is biological), 50bpDNALadder (Lay is thing humorously), 2 × TaqPCRMix (Lay is thing humorously), ApoI (Thermo), agarose (SIGMA) etc.。

1.2 design of primers

In the dbSNP data base of NCBI, the nucleotide sequence searching IL17Ars3748067 is as follows:

CAAAAACAAAAACAATTTTTTCTTTTCATCATCACCGTTCAGAGAAAGCTTGAAAACGAGCAGCAGGTTTTTAGTGAGAAGCTTGAAAGCGTAAAGGCTGTGAGGAACTGTCCCTGGAAGCTGCCTGGGGATTTCCTGTAGGAAAATGGTGACAGGGATGGTCACAGGAATCAAGATGTGAGCACAAAATGACTGAGAGGAGGTGGCTGGAGAGGCCAACCCCTGGATTTGGAATAGGGAAAGAAGCCTAGAAAAGCCATGGGCCTCTGGGTGGGCTGGAGCACACTGGATGGAGCAGGATGGAGTGAAGAGGAAGGTCTTTCAAGAAGCAGGGAGCCTGCAGAGTGGCCTGAGAATATCTAGAGGCCTTCAGAAGTAGGGCAAGACAGCACATGGGCCATGGGGGCGAAAATGGTTACGATGTGAAACTTGAAACTACTCTGGAATTGAATGTGATTGAGTTTTTATTTTACTTGGGCTGAACTTTTCTCATACTTAAARTTCGTTCTGCCCCATCAGCTCCTTTCTGGGTTGTGTGGTGCCTTGATCAGACAGAAGCCAGGCCCTAGGAGTGTTGCTTG AGGAAGAGAAAAATGTTGGTCTGTTGATCTCTGAGGGGCCTTAATCTCCAAAGGAAGCCTGAGTCTAGGGGAGAAACTGGACATTGTAGTCTGAAGACAATGTCTCCTCCCAGAACTTCTTGTATTTTGGGGAGGGTTTCATTTTCCCCATATGATCTTTAATAATGACATGCCATTCCTCAGGGCCATTATCTTATTTGCTCTATTCCTATCAAAATGCTTCTGTCTACAGCATTGGCTAATAGTATGAAAACCTTAGTCGGTGTTCAGTCTTGAAGGCATGTGAAATCGAGAACTTGGAATTTTGGGTATTTCCAGGTCATTGTTACTCAAAGACATGCTTTGTTTTGCTTATAGGAGAATTTGCATAACTCTTCCCAATAGGGAAGAGCTGAGTTTGCTAAAATACATTTAATGAGA

It is polymorphic that 501st base R of gene order represents A/G, is the pleomorphism site of rs3748067。Above sequence is affixed in primer-design software PrimerPremier6.0, the parameter such as primer length and amplification purpose fragment length is set and carries out design of primers, optimum upstream and downstream primer is selected according to G/C content and annealing temperature etc., again this primer is carried out primer comparison with the Blast sequence alignment function (http://blast.ncbi.nlm.nih.gov/Blast.cgi) in Pubmed, the upstream and downstream primer finally determined is forward primer sequence: 5 '-AGGATGGAGTGAAGAGGAA-3 ', downstream primer sequence is 5 '-AGAGATCAACAGACCAACAT-3 ', the synthesis of primer can adopt method (such as solid-phase synthesis) generally in the art, also biotech firm can be entrusted to synthesize。

The selection of 1.3 restricted enzyme

DbSNP finds the base sequence of location proximate, with the online restriction endonuclease analysis software of WatCut, on-line search obtains the information of the restricted enzyme in recognizable mutational site, considers its enzyme action specificity and the restriction enzyme A poI of economic and practical Sexual behavior mode the best。

1.4 genomic DNAs extracting sample to be tested from whole blood

Genomic DNA is extracted in strict accordance with centrifugal column type DNA extraction kit operating procedure。

L) after adding 300 μ l hemocytees in 1.5ml centrifuge tube, add 900 μ l cell pyrolysis liquids to be mixed evenly, after placing 10min on ice, the centrifugal 1min of 12000rpm in centrifuges, abandon supernatant, again add 900 μ l cell pyrolysis liquids, after blowing afloat precipitation with rifle and mix, repeat the above steps；

2) adding 600 μ lsolutionB solution in precipitate, after blowing afloat precipitation gently with liquid-transfering gun, add 10 μ l E.C. 3.4.21.64 mixings, after placing 10min in 70 DEG C of water-baths, 12000rpm is centrifuged 5min；

3) being proceeded to by the supernatant in centrifuge tube in the new centrifuge tube compiled number, then add 500 μ l dehydrated alcohol in new centrifuge tube, period, this floccule was DNA it is possible that flocky precipitate；

4) being proceeded to by the liquid of mixing (if once cannot not turning completely, graded proceeds to) in centrifugal column, room temperature stands 2min the more centrifugal 1min of 12000rpm, abandons waste liquid；

5) adding 700 μ l and added the solutionC rinsing liquid of respective volume dehydrated alcohol, room temperature stands the centrifugal 1min of 2min, 12000rpm, abandons waste liquid；

6) adding 700 μ l and added the solutionD rinsing liquid of respective volume dehydrated alcohol, room temperature stands the centrifugal 1min of 2min, 12000rpm, abandons waste liquid；

7) adding 500 μ lsolutionD rinsing liquids, 12000rpm is centrifuged 1min, abandons waste liquid；

8) recentrifuge 2min, is placed in the new centrifuge tube compiled number by centrifugal column, uncovered puts into 37 DEG C of calorstat 10min until without obvious ethanol taste；

9) add the solutionE100 μ l having been preheated with 65 DEG C in silica-based plasma membrane central authorities, room temperature places the centrifugal 1min of 5min, 12000rpm, and once, the liquid after being centrifuged eventually is the genomic DNA extracted to repeat the above steps；

10) draw the 2 μ l DNA NanoPhotometerPearl micro-spectrophotometer extracted and measure its concentration and purity。

2 results

2.1PCR expands

(1) according to the concentration extracting genomic DNA, the DNA of object of study is diluted, makes final concentration of 20 μ g/ μ l。(2) PCR amplification system is each 0.3 μ l of 2 × TaqPCRMix7.5 μ l, forward primer and downstream primer, template DNA 1.0 μ l, finally with the supplementary cumulative volume of distilled water to 15 μ l。

(3) the PCR reaction condition in site: first stage is the denaturation stage, 94 DEG C/5min；Second stage includes totally 35 circulations of three steps, set gradually be 94 DEG C/30s, 58.2 DEG C of annealing time 45s, 72 DEG C/45s；72 DEG C/5min of three phases。Product Sequence after amplification is:

AGGATGGAGTGAAGAGGAAGGTCTTTCAAGAAGCAGGGAGCCTGCAGAGTGGCCTGAGAATATCTAGAGGCCTTCAGAAGTAGGGCAAGACAGCACATGGGCCATGGGGGCGAAAATGGTTACGATGTGAAACTTGAAACTACTCTGGAATTGAATGTGATTGAGTTTTTATTTTACTTGGGCTGAACTTTTCTCATACTTAAARTTCGTTCTGCCCCATCAGCTCCTTTCTGGGTTGTGTGGTGCCTTGATCAGACAGAAGCCAGGCCCTAGGAGTGTTGCTTGAGGAAGAGAAAAATGTTGGTCTGTTGATCTCT。

Underscore part respectively forward primer and reverse primer, the R of the 205th bp represents the polymorphic i.e. SNP site rs3748067 of A/G。

2.2 endonuclease reactions

Enzyme action system is pcr amplification product 5 μ l, restricted enzyme 0.5 μ l, Buffer1.0 μ l, finally with the supplementary cumulative volume of distilled water to 15 μ l。Mixing is placed in water-bath 37 DEG C of water-baths 4-16 hour。

2.3 genotypic judgements

By digestion products with 3% agarose gel when 4-10V/cm, electrophoresis 20-40min, after distinguishing obvious band and qualification of taking pictures to uviol lamp。For different genotype, rs3748067 site different genotype shows different bands (see Fig. 1), and GG genotype is a fragment of 317bp；AA genotype is two fragments of 203bp and 114bp；GA genotype is three fragments of 317bp, 203bp and 114bp。Each genotype is all through checking order with further qualification, and the result that sequencing result (see Fig. 2-4) display records with prior art is identical。

Embodiment 1. Human Stomach Tissue specimen measures people's IL17Ars3748067 polymorphism

In specific embodiments of the present invention, detection people IL17A gene polymorphic rs3748067 specifically comprises the following steps that

(1) obtaining the stomach organization that operation cuts, adopt phenol-chloroform method to extract the genomic DNA of stomach organization as DNA to be measured, extraction step is as follows:

1) being thawed by stomach organization block, wash away blood stains with normal saline, the tissue of clip 0.1g is milled, and adds the aquesterilisa of 1ml, reverse mixing, and 10000rpm is centrifuged 10min, abandons supernatant, and above step repeats twice

2) adding the DNA cleavage liquid of 200 μ l, the E.C. 3.4.21.64 mixing of 5 μ l, 55 DEG C of water-baths digest overnight。

3) add isopyknic phenol chloroform mixed liquor (1:1) after having digested, acutely shake so that it is become milk coffee color。12000rpm is centrifuged 10min。

4) avoid when taking supernatant touching intermediate medium and lower floor's liquid。Reverse mixing after adding isopyknic chloroform。12000rm is centrifuged 10min。

5) take supernatant, note avoiding touching intermediate medium and lower floor's liquid。Adding the sodium acetate of 1/10 and the dehydrated alcohol of 2.5 times, reverse mixing, 12000rpm is centrifuged 10min, abandons supernatant。

6) adding 1ml70% ethanol so that it is white precipitate suspends, and for several times, 12000rpm is centrifuged 10min in reverse mixing, abandons supernatant, room temperature stands 5-10min makes ethanol volatilization clean。

7) add 50 μ l aquesterilisa dissolving DNAs, obtain stomach organization genomic DNA。

(2) base sequence information obtains from the dbSNP data base of NCBI, CHIP website is checked, specify the accurate rear PrimerPremier6.0 of employing and design each site primer, in conjunction with annealing temperature, it is forward primer sequence: 5 '-AGGATGGAGTGAAGAGGAA-3 ' that the information siftings such as the Blast sequence alignment result (http://blast.ncbi.nlm.nih.gov/Blast.cgi) in G/C content and Pubmed go out optimum primer, downstream primer sequence is 5 '-AGAGATCAACAGACCAACAT-3 ', carry out PCR primer amplification, preparation PCR amplification system: 2 × TaqPCRMix7.5 μ l, distilled water 5.9 μ l, forward primer 0.3 μ l, downstream primer 0.3 μ l and template DNA 1.0 μ l, fully namely obtain 15.0 μ lPCR amplification reaction systems after mixing；According to the first stage: 94 DEG C of degeneration 5min, second stage includes 35 circulations three steps, first 94 DEG C of degeneration 30s altogether, 58.2 DEG C annealing 45s, last 72 DEG C extend 45s, the phase III: 72 DEG C extend 5min, final 4 DEG C store with standby, must grow the pcr amplification product for 317bp；

(3) the SNP fragment enzyme action 6-14h in restriction endonuclease ApoI5U water-bath after amplification, PCR product 5 μ l, restricted enzyme 0.5 μ l, Buffer1.0 μ l and nuclease free pure water 8.5 μ l amounts to 15 μ l enzyme action systems, in water-bath, 37 DEG C of enzyme action 6-14h, obtain digestion products。The described restricted enzyme identifying AAATTC sequence is restriction endonuclease ApoI and isoschizomers thereof；The described restricted enzyme identifying AATT sequence is restriction endonuclease Sse9I, MluCI and isoschizomers thereof, considers economic and practical and simple operations finally selects ApoI to carry out enzyme action qualification；

(4) digestion products adopts the agarose of 3% to carry out agarose gel electrophoresis, judges wild homozygous genotype, heterozygous genotypes and mutant homozygous genotype (see table 2) according to different bands under ultra violet lamp。

Table 2rs3748067 loci gene type judges

Embodiment 2. human peripheral whole blood sample measures people's IL17Ars3748067 polymorphism

Essentially identical with the step of embodiment 1, extract genomic DNA as DNA to be measured in simply adopting method below from human peripheral。

Carry out the extraction of blood sample genomic DNA to be measured according to the operating procedure of NEP004-1 Whole Blood Genomic DNA extraction test kit, specifically comprise the following steps that

1) after adding 300 μ l hemocytees in 1.5ml centrifuge tube, add 900 μ l cell pyrolysis liquids to be mixed evenly, after placing 10min on ice, the centrifugal 1min of 12000rpm in centrifuges, abandon supernatant, again add 900 μ l cell pyrolysis liquids, after blowing afloat precipitation with rifle and mix, repeat the above steps；

2) adding 600 μ lsolutionB solution in precipitate, after blowing afloat precipitation gently with liquid-transfering gun, add 10 μ l E.C. 3.4.21.64 mixings, after placing 10min in 70 DEG C of water-baths, 12000rpm is centrifuged 5min。

3) being proceeded to by the supernatant in centrifuge tube in the new centrifuge tube compiled number, then add 500 μ l dehydrated alcohol in new centrifuge tube, period, this floccule was DNA it is possible that flocky precipitate；

4) being proceeded to by the liquid of mixing (if once cannot not turning completely, graded proceeds to) in centrifugal column, room temperature stands 2min the more centrifugal 1min of 12000rpm, abandons waste liquid；

5) adding 700 μ l and added the solutionC rinsing liquid of respective volume dehydrated alcohol, room temperature stands the centrifugal 1min of 2min, 12000rpm, abandons waste liquid；

6) adding 700 μ l and added the solutionD rinsing liquid of respective volume dehydrated alcohol, room temperature stands the centrifugal 1min of 2min, 12000rpm, abandons waste liquid；

7) adding 500 μ lsolutionD rinsing liquids, 12000rpm is centrifuged 1min, abandons waste liquid；

8) recentrifuge 2min, is placed in the new centrifuge tube compiled number by centrifugal column, uncovered puts into 37 DEG C of calorstat 10min until without obvious ethanol taste；

9) add the solutionE100 μ l having been preheated with 65 DEG C in silica-based plasma membrane central authorities, room temperature places the centrifugal 1min of 5min, 12000rpm, and once, the liquid after being centrifuged eventually is the genomic DNA extracted to repeat the above steps。

After extracting complete genomic DNA, the step according to case one carries out genotypic qualification, and qualification result is as follows: by digestion products qualification of taking pictures under uviol lamp after the agarose gel electrophoresis of 3%。For different genotype, rs3748067 site different genotype shows different bands (see Fig. 1), and GG isozygotys wild-type genotype, 317bp mono-band；AG heterozygous genotypes, long for 317bp, 203bp and 114bp tri-band；AA homozygous mutant genotypes, long for 203bp and 114bp two band。Each genotype is all through checking order with further qualification, and the result that sequencing result (see Fig. 3-4) display records with prior art is identical。

The present invention can carry out genotypic qualification work after PCR primer is carried out restriction enzyme digestion and electrophoresis, therefore has very big motility in practice, and detection method is simple in addition, is therefore a kind of good method carrying out single base mutation loci gene type qualification。Key problem in technology point is the upstream and downstream primer of the IL17A polymorphism rs3748067 designed, forward primer sequence: 5 '-AGGATGGAGTGAAGAGGAA-3 ', downstream primer sequence is the use of 5 '-AGAGATCAACAGACCAACAT-3 ' and restriction enzyme A poI。The method that must detect people stomach cancer susceptible genes IL17A polymorphism rs3748067 provided by the present invention is simple to operate, cost is low, applied widely。

The above, be only best mode for carrying out the invention, and any those familiar with the art is in the technical scope of present disclosure, and the simple change of the technical scheme that can become apparent to or equivalence are replaced and each fallen within protection scope of the present invention。

Claims (1)

1. the method by ApoI detection people's stomach cancer susceptible genes IL17Ars3748067 polymorphism, it is characterised in that comprise the following steps:

The genomic DNA of (a) extracting sample；

B () provides forward primer and the reverse primer of amplification people's IL17A gene pleiomorphism rs3748067 location proximate sequence, rs3748067 forward primer: 5 '-AGGATGGAGTGAAGAGGAA-3 ', rs3748067 downstream primer: 5 '-AGAGATCAACAGACCAACAT-3 ', the human gene group DNA to be measured extracted with step (a) is for template, carry out pcr amplification, obtain amplified production；

C () uses restricted enzyme that the amplified production obtained in step (b) is carried out enzyme action, obtain corresponding digestion products；

D digestion products is adopted the agarose gel of 3% to carry out electrophoresis by (), to judge each genotype of IL17A gene pleiomorphism rs3748067；Wherein, having a band person for GG genotype after electrophoresis, two band persons are AG genotype, and three band persons are AA genotype。