CN108642138B

CN108642138B - Method and kit for detecting genetic information of folate metabolism related gene

Info

Publication number: CN108642138B
Application number: CN201810409261.7A
Authority: CN
Inventors: 何震宇; 王润杰; 谭秋倩
Original assignee: Guangdong Pharmaceutical University
Current assignee: Guangdong Pharmaceutical University
Priority date: 2018-05-02
Filing date: 2018-05-02
Publication date: 2021-11-30
Anticipated expiration: 2038-05-02
Also published as: CN108642138A

Abstract

The invention discloses a method and a kit for detecting genetic information of folate metabolism related genes, and relates to an rs1801133 site, an rs1801131 site and an rs1801394 site of an MTHFR gene. The invention comprehensively uses the technologies of direct PCR, nested PCR, multiplex PCR, enzyme cutting site method PCR, PCR-RFLP and the like, directly uses cells to carry out 2-round PCR amplification under the condition of not extracting DNA, can use cheap restriction endonuclease HinfI to carry out rapid enzyme cutting typing on the 2 nd round PCR product of each site, can detect three sites at one time in the same tube according to the actual requirement, can detect two sites at one time in the same tube, and can detect any one site independently. All PCR products have the internal restriction sequence of restriction enzyme as quality control of restriction enzyme so as to ensure the accuracy of result judgment. The whole process is simple and convenient to operate, low in cost and extremely guaranteed in accuracy.

Description

Method and kit for detecting genetic information of folate metabolism related gene

Technical Field

The invention belongs to the field of molecular detection, and particularly relates to a method and a kit for detecting genotypes of a folate metabolism pathway MTHFR gene rs1801133 locus [ C677T ], an rs1801131 locus [ A1298C ] and an MTRR gene rs1801394 locus [ A66G ].

Background

Folic acid is an essential element for nucleic acid synthesis, is an essential substance for cell growth and tissue repair, and is an essential nutrient in the process of embryonic development. 5, 10-methylenetetrahydrofolate reductase (MTHFR) and methionine synthase reductase (MTRR) are the two most important enzymes involved in folate metabolism,

extensive studies in recent years have demonstrated that folate deficiency is the leading cause of birth defects such as down's syndrome, cleft lip and palate, neural tube defects, and the like. The clinical function of folic acid can prevent the fetal neural tube defect, and reduce the incidence of pregnant woman gestational hypertension, spontaneous abortion, intrauterine fetal development retardation, premature birth, low birth weight of newborn and the like.

Hyperhomocysteinemia caused by folic acid metabolism disorder is an independent risk factor of cardiovascular and cerebrovascular diseases, and is directly related to cardiovascular and cerebrovascular diseases, senile dementia, Parkinson's disease, diabetic complications, cancers and more than 50 chronic diseases. Since homocysteine interferes with the anticoagulant function of endothelial cells, resulting in an increased propensity to clot blood, the risk of stroke, coronary heart disease and venous thrombosis is increased.

The gene loci related to folic acid metabolism genetic defect mainly comprise 3 gene loci, namely rs1801133 locus [ C677T ] of MTHFR gene, rs1801131 locus [ A1298C ] and rs1801394 locus [ A66G ] of MTRR gene. Their background is as follows:

the rs1801133 polymorphic site of the MTHFR gene is commonly referred to as C677T, and is a C → T mutation at base 665 of the open reading frame [ corresponding to base 894 of mRNA sequence NM _005957.4 or base 14783 of genomic sequence NG _013351.1 in GenBank ], resulting in the alanine at position 222 of the polypeptide chain being changed to valine [ NP _005948.3: ala222val ].

The rs1801131 polymorphic site of MTHFR gene is generally called A1298C, and the mutation of A → C occurs at 1286 th base of open reading frame [ corresponding to 1515 th base of mRNA sequence NM-005957.4 or 16685 th base of genome sequence NG-013351.1 in GenBank ], which results in that the glutamic acid at 429 th position of polypeptide chain is changed into alanine [ NP-005948.3: p.Glu429Ala ], and the enzymatic activity of mutant C allele is about 68% of that of wild type A allele.

The rs1801394 polymorphic site of MTRR gene is generally called A66G, and is the 66 th base A → G of open reading frame [ corresponding to 203 th base of mRNA sequence NM-002454.2 or 6757 th base of genome sequence NG-008856.1 in GenBank ], so that the 22 nd amino acid of the encoded zymoprotein is changed from Ile to Met [ Ile22Met, I22M ].

At present, methods for detecting the genotype of 3 sites include PCR-RFLP, Sanger dideoxy chain termination method sequencing, pyrosequencing, fluorescence PCR, gene chips, high resolution melting curve method (HRM), matrix-assisted laser desorption ionization time-of-flight mass spectrometry, PCR-gold magnetic particle chromatography and the like, and besides the PCR-RFLP method, other methods all need expensive equipment or reagents, so that the operation is relatively complicated, the detection period is long, the detection cost is high, and part of methods have the defects of unstable results, poor repeatability and the like. However, at present, 3 sites are detected, and 3 different enzymes are generally used in 3 different systems, so that the detection efficiency needs to be improved. The literature "Associations of variants in MTHFR and MTRR genes with large affinity in the Jordanian publication [ J ] Gene, 2014, 536 (1): 40-44 ", 3 different enzymes HinfI, MboII, NdeI were used, respectively, as shown in Table 1 below.

Table 1 shows the case of detecting 3 gene polymorphism sites by HinfI, MboII, NdeI restriction enzymes respectively in the prior art

Among the 3 enzymes mentioned above, HinfI is inexpensive, 437 yuan/400 times of reaction, and the latter two are expensive, wherein MboII is 427 yuan/50 times of reaction, and NdeI is 300 yuan/100 times of reaction. In addition, the primer design of the above documents has certain disadvantages, wherein the PCR products obtained by amplification of the primers at sites MTHFR C677T and MTRR a66G may cause genotype misjudgment when enzyme is not cleaved by enzyme, see the analysis in the above table. The restriction endonuclease MboII selected from the MTHFR A1298C site can not be correctly typed at all because when the allele is A, the GAAGA [ FIG. 2, 16681-16685 base ] is the recognition site of the MboII, and the TCTTC [ FIG. 2, 16700-16704 base ] which is not far downstream of the polymorphic site is also the recognition site of the MboII, and the two cleavage sites are only separated by one base, so that whether the cleavage is initiated by the GAAGA or the TCTTC can not be judged at all, namely the judgment of the result can be seriously interfered by the TCTTC sequence. Nevertheless, there are many researchers who have chosen MboII to type MTHFR A1298C site, and even though the PCR products are somewhat different, interference of TCTTC sequences near the polymorphic site is always unavoidable.

Disclosure of Invention

In order to improve the defects, the invention aims to establish a simple and quick gene typing method which is based on a PCR-RFLP method and can identify 3 related gene sites by using the same restriction endonuclease and has high accuracy.

The invention aims to provide a method and a kit for simultaneously detecting 3 gene polymorphism sites related to folic acid metabolism, wherein the 3 sites are an rs1801133 site, an rs1801131 site and an rs1801394 site of an MTHFR gene.

The technical scheme adopted by the invention is as follows:

a method for simultaneously detecting 3 gene polymorphic sites related to folate metabolism is characterized by comprising the following steps: 1) amplifying a target site of a sample by nested PCR, wherein primers of the nested PCR comprise

primer pairs

1, 2, 3, 4, 5 and 6, wherein the

primer pairs

1, 3 and 5 are outer primer pairs, and the

primer pairs

2, 4 and 6 are inner primer pairs; or the primers of the nested PCR consist of

primer pairs

1, 2, 3, 4, 7 and 8, wherein the

primer pairs

1, 3 and 7 are outer primer pairs, and the

primer pairs

2, 4 and 8 are inner primer pairs; 2) carrying out enzyme digestion on the nested PCR product by using restriction endonuclease; 3) carrying out agarose gel electrophoresis on the enzyme digestion product, and determining the genotypes of 3 gene polymorphism sites according to characteristic bands of an electrophoresis pattern;

the specific sequences of all the primer pairs are as follows: primer pair 1 consists of SEQ ID NO: 1 and SEQ ID NO:2, preparing a composition; primer pair 2 consists of SEQ ID NO: 3 and SEQ ID NO: 4, preparing a composition; primer pair 3 consists of SEQ ID NO: 5 and SEQ ID NO: 6, preparing a mixture; primer pair 4 consists of SEQ ID NO: 7 and SEQ ID NO: 8, preparing a mixture; primer pair 5 consists of SEQ ID NO: 9 and SEQ ID NO: 10; primer pair 6 consists of SEQ ID NO: 11 and SEQ ID NO: 12; primer pair 7 consists of SEQ ID NO: 13 and SEQ ID NO: 14, the composition is as follows; primer pair 8 consists of SEQ ID NO: 15 and SEQ ID NO: 16.

Further, the sample is a cell sample or an extracted DNA sample.

Further, the restriction endonuclease is restriction endonuclease HinfI or isoschizomer thereof.

Furthermore, the 3 gene polymorphism sites related to folate metabolism are rs1801133 site, rs1801131 site of MTHFR gene and rs1801394 site of MTRR gene respectively.

Further, the nested PCR is operated by performing the 1 st round of PCR amplification by using the

outer primer pairs

1, 3 and 5, and performing the 2 nd round of PCR amplification on the amplification product by using the

inner primer pairs

2, 4 and 6;

or the nested PCR operation comprises the steps of firstly carrying out 1 st round PCR amplification by using the

outer primer pairs

1, 3 and 7, and then carrying out 2 nd round PCR amplification on the amplification products by using the

inner primer pairs

2, 4 and 8.

Further, the specific method for determining the genotypes of the 3 gene polymorphism sites according to the characteristic bands of the electropherogram comprises the following steps:

if the primers of the nested PCR consist of

primer pairs

1, 2, 3, 4, 5 and 6, the genotype of each gene polymorphic site is determined as follows:

1.1, an electrophoretogram has 468.5bp bands and does not have 368bp bands, and the genotype of the polymorphic site rs1801133 of the sample is a wild homozygote CC;

1.2, no 468.5bp band but 368bp band exists in an electrophoretogram, and the genotype of the polymorphic site rs1801133 of the sample is mutant homozygote TT;

1.3, an electrophoretogram has 468.5bp bands and 368bp bands, if the brightness of the 468.5bp bands is higher than that of the 368bp bands, the genotype of the rs1801133 polymorphic site of the sample is heterozygote CT; if the brightness of the 468.5bp strip is lighter than that of the 368bp strip, the genotype of the polymorphic site rs1801133 of the sample is mutant homozygote TT;

2.1 an electrophoretogram has 324.5bp bands and no 280bp bands, and the genotype of the polymorphic site rs1801131 of the sample is a wild homozygote AA;

2.2, an electrophoretogram does not have 324.5bp bands but has 280bp bands, and the genotype of the polymorphic site rs1801131 of the sample is mutant homozygote CC;

2.3 the electrophoretogram has 324.5bp bands and 280bp bands, if the brightness of the 324.5bp bands is higher than that of the 280bp bands, the genotype of the rs1801131 polymorphic site of the sample is heterozygote AC; if the 324.5bp strip is lighter than the 280bp strip, the genotype of the polymorphic site rs1801131 in the sample is a mutant homozygote CC;

3.1 an electrophoretogram has 193.5bp bands and does not have 155bp bands, and the genotype of the polymorphic site rs1801394 of the sample is a wild homozygote AA;

3.2, no 193.5bp band but 155bp band exists in the electropherogram, and the genotype of the polymorphic site rs1801394 of the sample is mutant homozygote GG;

3.3 the electrophoretogram has 193.5bp bands and 155bp bands, if the brightness of the 193.5bp bands is higher than that of the 155bp bands, the genotype of the rs1801394 polymorphic site of the sample is heterozygote AG; if the brightness of the 193.5bp strip is lighter than that of the 155bp strip, the genotype of the polymorphic site rs1801394 of the sample is a mutant homozygote GG;

if the primers of the nested PCR consist of

primer pairs

1, 2, 3, 4, 7 and 8, the genotype of each gene polymorphic site is determined as follows:

3.1 an electrophoretogram has 206.5bp bands and does not have 155bp bands, and the genotype of the polymorphic site rs1801394 of the sample is a wild homozygote AA;

3.2, an electrophoretogram does not have 206.5bp bands but has 155bp bands, and the genotype of the polymorphic site rs1801394 of the sample is mutant homozygote GG;

3.3 the electrophoretogram has 206.5bp bands and 155bp bands, if the brightness of the 206.5bp bands is higher than that of the 155bp bands, the genotype of the rs1801394 polymorphic site of the sample is heterozygote AG; if the 206.5bp band is lighter than the 155bp band, the genotype of the rs1801394 polymorphic site of the sample is the mutant homozygote GG.

A primer group for simultaneously detecting 3 gene polymorphic sites related to folate metabolism comprises

primer pairs

1, 2, 3, 4, 5 and 6, or

primer pairs

1, 2, 3, 4, 7 and 8.

A kit for simultaneously detecting 3 gene polymorphic sites related to folate metabolism comprises the primer group.

Further, the kit contains the restriction endonuclease HinfI or its isoschizomer.

The kit of any one of the above in detecting the genotype of the rs1801133 locus, rs1801131 locus and the rs1801394 locus of the MTHFR gene.

The invention has the beneficial effects that:

the invention detects the rs1801133 site [ C677T ], rs1801131 site [ A1298C ] and the rs1801394 site [ A66G ] of the MTHFR gene based on the nested PCR-RFLP method, directly uses the oral epithelial cell as a template to amplify a target sequence, does not need to carry out time-consuming DNA extraction, and can save time and cost; in the past, 3 different restriction endonucleases are usually needed to identify 3 sites in 3 systems respectively, the invention adopts the same enzyme, namely HinfI, to identify 3 sites in the same system, the HinfI is low in price, the detection cost can be reduced, and the detection efficiency can be improved by detecting 3 sites in the same system at one time; all PCR products have enzyme digestion internal control sequences, and the result can be judged according to characteristic bands of an enzyme digestion map, so that the accuracy is powerfully guaranteed; in addition, according to the actual requirement, a certain site can be detected independently or 2 sites of the MTHFR gene can be detected at one time. In a word, the kit has the advantages of low detection cost, high accuracy and simple and convenient operation, and is suitable for large-scale production of the kit.

Drawings

FIG. 1: the locus rs1801133 genotyping primer of MTHFR gene is corresponding to the template. The template sequence is referred to GenBank data https:// www.ncbi.nlm.nih.gov/nuccore/NG _013351.1, wherein position 14783 is a polymorphic site, and the original sequence only shows wild type allele C. F1 and R1 are outer primers of the nested PCR, F2 and R2 are inner primers of the nested PCR, and the outer primers and the inner primers are matched with the template enzyme. Aiming at the nested 2 nd round PCR product, a polymorphic site related sequence GAGYC (Y is a polymorphic site base, and Y is C or T) can be screened by enzyme digestion of HinfI or isoschizomer thereof, and GATTC at 15148-15152 is an enzyme digestion internal control sequence of HinfI or isoschizomer thereof.

FIG. 2: the MTHFR gene rs1801131 site gene typing primer and template corresponding relation chart. The template sequence is referred to GenBank data https:// www.ncbi.nlm.nih.gov/nuccore/NG _013351.1, wherein position 16685 is a polymorphic site, and the original sequence only shows a wild type allele A. F3 and R3 are outer primers of the nested PCR, and are matched with the template enzyme; f4 and R4 are inner primers of nested PCR, wherein R4 is in enzyme pairing with a template enzyme, and the 1 st base T from the last of the 3' end of F4 is mismatched with the template, so that the original sequence gaagM is changed into gaatM through PCR, and the aim of screening the polymorphic site by HinfI or isoschizomer thereof is achieved. The PCR product contains the sequence gactc at the downstream of the polymorphic site, and can be recognized by HinfI or isoschizomer thereof to be used as an enzyme digestion internal control sequence. In addition, a sequence CTAATACGACTG ACTATAGGGAGA which is independent of a template is added to the 5' end of the F4, and the aim is to increase the length difference between fragments which are subjected to enzyme cutting and fragments which are not subjected to enzyme cutting at a polymorphic site and improve the resolution of subsequent electrophoresis.

FIG. 3: the first group of genotyping primers (F5, R5; F6, R6) at the rs1801394 site of the MTRR gene corresponds to the template. The template sequence is referred to https:// www.ncbi.nlm.nih.gov/nuccore/NG _008856.1, wherein position 6757 is a polymorphic site, and the original sequence only shows the wild type allele A. F5 and R5 are outer primers of nested PCR, and are matched with a template enzyme. F6 and R6 are inner primers of nested PCR. The mismatch of the penultimate 3 base C at the 3' end of F6 will render the sequence gaatt a gaatc by PCR, an endorestriction site for HinfI or its isoschizomer; f6(SEQ ID NO: 11) was appended at the 5' end with a template-independent sequence AAGCGGTCTTCGCATTTACG. The 1 st base T and the 4 th base G from the last of the 3' end of R6 are respectively mismatched with the template, so that the original sequence Rtgtg becomes Ragtc in the PCR product, and the aim of screening the polymorphic site by HinfI or isoschizomer thereof is fulfilled; the 5' end of R6(SEQ ID NO: 12) was added a template-independent sequence TGTGGACCGATGGGCTTACC.

FIG. 4: the second group of genotyping primers (F7, R7; F8, R8) of the polymorphic site rs1801394 of the MTRR gene corresponds to the template. The template sequence is referred to https:// www.ncbi.nlm.nih.gov/nuccore/NG _008856.1, wherein position 6757 is a polymorphic site, and the original sequence only shows the wild type allele A. F7 and R7 are outer primers of nested PCR, and are matched with a template enzyme. F8 and R8 are inner primers of nested PCR. A mismatch of the penultimate 3 base C at the 3' end of F8(SEQ ID NO: 15) would render the sequence gaatt a gatc by PCR, an endorestriction site for HinfI or its isoschizomer; the 5' end of F8 was appended with a template-independent sequence CCCACGAGGAGC. The 1 st base T and the 4 th base G from the last of the 3' end of R8(SEQ ID NO: 16) are respectively mismatched with the template, so that the original sequence Rtgtg is changed into Ragtc in the PCR product, and the aim of screening the polymorphic site by HinfI is fulfilled; the 5' end of R8(SEQ ID NO: 16) was added with a template-independent sequence AGCTCGTTTAGTGAACCGTCAGATCG.

FIG. 5: and (3) performing double PCR amplification on rs1801133 locus and rs1801131 locus of MTHFR gene and obtaining an electrophoretogram of a single PCR amplification product. M is a DNA molecular weight marker (2000, 1000, 750, 500, 250, 100 bp); 1-6 are double PCR products of two sites, including target bands of 569bp and 402bp respectively; 7-12 is a single PCR product of rs1801133 locus, and the target band is 569 bp; 13-18 is a single PCR product of rs1801131 locus, and the target band is 402 bp.

FIG. 6: and (3) performing an electrophoretogram of double PCR products of rs1801133 site and rs1801131 site of the MTHFR gene and a HinfI enzyme digestion on corresponding single PCR products. The A picture is an original electrophoresis picture, and the B picture frame shows the feature bands of the enzyme digestion products at all the sites, wherein the feature band of the enzyme digestion product at the rs1801133 site is framed by a rectangle with round corners, and the feature band of the enzyme digestion product at the rs1801131 site is framed by a rectangle. M is a DNA molecular weight marker (700, 600, 500, 400, 300, 200, 100 bp); p is a double PCR product, and the 2 entry marks are 569bp and 402bp respectively; 1-6 is a double-site PCR product enzyme cutting map of an rs1801133 site and an rs1801131 site, the genotype of each sample can be clearly judged through characteristic bands of 2 sites, namely the rs1801133 site/the rs1801131 site is CC/AA, CC/AC, CC/CC, CT/AA, CT/AC and TT/AA, 7-12 is the rs1801133 site PCR product enzyme cutting map corresponding to the 1-6 sample, the genotype is CC, CT and TT in sequence, 13-18 is the rs1801131 site PCR product enzyme cutting map corresponding to the 1-6 sample, and the genotype is AA, AC, CC, AA, AC and AA in sequence. The result of double-site genotyping is matched with the result of single-site genotyping by enzyme, thus demonstrating the accuracy of the method of the invention. Some PCR products, the cleavage intermediate product bands, can be seen implicitly in the figure, but they do not interfere with the judgment of the results because the characteristic bands are very clear.

FIG. 7: using a first group of genotyping primers [ F5 and R5 ] of an rs1801394 polymorphic site of an MTRR gene as outer primers of the nested PCR; f6 and R6 are inner primers of nested PCR ] and the electrophoresis pattern of the amplified 2 nd round PCR product after HinfI enzyme digestion. M is a DNA molecular weight marker (700, 600, 500, 400, 300, 200, 100 bp); p is the 2 nd round PCR product, and the large substance is 236 bp; sample No. 1 is wild type homozygote AA, sample No. 2 is mutant homozygote GG, and sample No. 3 is heterozygote AG. At first glance,

samples

2 and 3 both have 193.5 and 155bp bands, and seem to be of the same genotype, and actually, the two bands are substantially different, the sample 3 is a true heterozygote AG, and the sample 2 is a mutant homozygote GG, because the brightness of the 193.5bp band is theoretically higher than 155bp for heterozygote AG, because the molar ratio is 1:1, the nucleic acid dye combined by the fragment with the large molecular weight is more, the color development is brighter, the brightness of the 193.5bp band of the sample No. 2 in the figure is obviously weaker than 155bp, and the sample belongs to the enzyme digestion intermediate product production band, so the sample is the mutant homozygote GG.

FIG. 8: the nested multiplex PCR product of the triple site of the rs1801133 site, rs1801131 site and the rs1801394 site of the MTHFR gene [ 1

st primer pair

1, 3, 5 → 2

nd primer pair

2, 4, 6 ] has an electropherogram. M is a DNA molecular weight Marker (DL 2000DNA Marker of Beijing Jiang intergenic Biotechnology Limited company DL 2000: 2000, 1500, 1000, 750, 500, 250, 100bp), 1-16 are PCR products of 16 different samples, and the target bands corresponding to 3 sites of each sample are 569bp, 402bp, 236bp respectively.

FIG. 9: the electrophoresis pattern of 2 nd round PCR products (569bp, 402bp and 236bp) of nested multiplex PCR of rs1801133 site, rs1801131 site of MTHFR gene and rs1801394 site of MTRR gene after HinfI digestion. The diagram A is an original electrophoresis diagram, the diagram B is a drawing frame which shows the corresponding characteristic bands of all the sites, the uppermost rectangle in the drawing is the characteristic band of the enzyme digestion product of the site rs1801133 framed by a rounded corner, the middle rectangle is the characteristic band of the enzyme digestion product of the site rs1801131 framed by a rectangle, and the lowermost rectangle is the characteristic band of the enzyme digestion product of the site rs1801394 framed by a rectangle. M is a DNA molecular weight Marker (DNA Marker I: 700, 600, 500, 400, 300, 200, 100bp) of the Beijing Zhuang Union internationally biological Gene technology Limited company; p is a three-site PCR product contrast, contains three target bands of 569bp, 402bp and 236bp, 1-16 are three-site PCR product enzyme digestion maps of 16 different samples, the combined genotype of rs1801133 site/rs 1801131 site/rs 1801394 site of the 1-16 samples can be very clearly judged according to characteristic bands, and the sequence is as follows: CC/AA/AA, CC/AA/AA, CT/AC/AG, CC/AA/AG, CC/AC/AA, CC/AC/AA, CC/AA/AG, CC/AC/AG, CC/AC/AA, CC/AA/AA, CT/AC/AA, CT/AA/AA, CC/AA/AG, CC/AC/AG, CC/AA/AG.

FIG. 10: sequencing peak images of nested PCR products at rs1801133 locus of MTHFR gene [ obtained by amplification of primer pair 2, namely F2 and R2 ]. a. b, c are polymorphic sites and front and back related sequences of CC, CT and TT genotype samples in sequence, wherein an arrow indicates the base of the polymorphic site, and the sequence in a frame can be screened by HinfI or isoschizomer thereof; d shows that the PCR product contains GATTC sequence, which is HinfI or the restriction enzyme cutting internal control sequence of isoschizomer.

FIG. 11: sequencing peak images of nested PCR products at rs1801131 locus of MTHFR gene (obtained by amplification of primer pair 4, namely F4 and R4) in round 2. a. b and C are AA, AC and CC genotype sample polymorphic sites and front and back related sequences in sequence, wherein an arrow indicates polymorphic site base, a sequence GAATM (M ═ A/C) in a frame is formed by an original template sequence GAAGM through mismatch PCR, and HinfI or isoschizomer thereof can be used for discrimination; d shows that the PCR product contains GACTC sequence, which is HinfI or the restriction enzyme cutting internal control sequence of isoschizomer.

FIG. 12: using a first group of genotyping primers [ F5 and R5 ] of an rs1801394 polymorphic site of an MTRR gene as outer primers of the nested PCR; f6 and R6 are inner primers of nested PCR, and sequencing peak images of 2 nd round PCR products are obtained by amplification, wherein a shows the restriction enzyme digestion internal control sequence GAATC, b, c and d are AA, AG and GG genotype sample polymorphic sites and related sequences in sequence, wherein an arrow indicates polymorphic site bases, and PCR successfully changes the original template sequence from RTGTG to RAGTC (R ═ A/G) which can be screened by HinfI or isoschizomer thereof.

FIG. 13: using a second group of genotyping primers [ F7 and R7 ] of the rs1801394 polymorphic site of the MTRR gene as outer primers of the nested PCR; f8 and R8 are inner primers of nested PCR, and sequencing peak images of 2 nd round PCR products obtained by amplification are shown, wherein a shows the restriction enzyme digestion internal control sequence GATTC, b, c and d are AA, AG and GG genotype sample polymorphic sites and related sequences before and after, wherein arrows indicate polymorphic site bases, and PCR has successfully changed the original template sequence from RTGTG to RAGTC (R ═ A/G) which can be screened by HinfI or isoschizomer thereof.

FIG. 14 is a schematic diagram of the restriction enzyme digestion after the rs1801133 site of MTHFR gene is amplified by PCR and an internal restriction enzyme digestion control sequence is introduced.

FIG. 15: and (3) carrying out joint typing on the rs1801133 site, the rs1801131 site and the rs1801394 site of the MTHFR gene and comparing the typing on each site independently. Panel A is a three-site-associated typing map, M is a DNA molecular weight marker (700, 600, 500, 400, 300, 200, 100 bp); p is a three-site PCR product control, and comprises three target bands of 569bp, 402bp and 237bp (which respectively correspond to the primer pairs 2, 4 and 8), wherein the uppermost frame in the figure is a feature band of the enzyme digestion product at the rs1801133 site, the middle frame is a feature band of the enzyme digestion product at the rs1801131 site, and the lowermost frame is a feature band of the enzyme digestion product at the rs1801394 site. 1-16 are three-site PCR product enzyme cutting maps of 16 different samples, the three-site combined genotypes of the 16 samples are different, the combined genotypes of the rs1801133 site/rs 1801131 site/rs 1801394 site of the 1-16 samples can be very clearly judged according to the characteristic strip, and the three-site PCR product enzyme cutting maps sequentially comprise: CC/AA/AA, CC/AA/AG, CC/AA/GG, CC/AC/AA, CC/AC/AG, CC/AC/GG, CC/CC/AA, CC/CC/AG, CC/CC/GG, CT/AA/AA, CT/AA/AG, CT/AA/GG, CT/AC/AA, CT/AC/AG, TT/AA/AA, TT/AA/AG. And the picture B is an rs1801133 locus individual typing picture, M is a DNA molecular weight marker, P is a PCR product, 569bp, 1-16 are 16 samples 569bp PCR product enzyme digestion maps corresponding to the enzyme in the picture A, and the genotypes are CC, CT, TT and TT in sequence. And the graph C is an rs1801131 site individual typing graph, M is a DNA molecular weight marker, P is a PCR product, 402bp, 1-16 are enzyme cutting maps of 16 sample 402bp PCR products corresponding to the enzyme in the graph A, and the genotypes are AA, AC, CC, AA, AC, AA and AA in sequence. And the diagram D is an rs1801394 locus single typing diagram, M is a DNA molecular weight marker, P is a PCR product, 237bp, 1-16 are 237bp PCR product enzyme cutting maps of 16 samples corresponding to the enzyme in the diagram A, and the genotypes are AA, AG, GG, AA, AG, AA and AG in sequence. The genotype jointly typed by the three sites is matched with the enzyme of the genotype enzyme independently typed by each site, thereby indicating the accuracy of the method.

Detailed Description

The invention establishes a genotyping method which is high in accuracy, simple and rapid and can identify 3 related gene sites by using the same restriction endonuclease based on a PCR-RFLP method, and relates to the following technologies:

PCR-RFLP: in the invention, the inherent sequence GAGYC [ Y ] of the rs1801133 locus of the MTHFR gene is a polymorphic locus base, and when the allele is T, the sequence GAGTC can recognize and cut HinfI or isoschizomer thereof; when the allele is C, the sequence is GAGCC, and HinfI or the isoschizomer thereof cannot recognize and cut, so that the polymorphic site can be screened by HinfI or the isoschizomer thereof. And (3) incubating the PCR product containing the site with corresponding restriction endonuclease, carrying out electrophoresis on the product after enzyme digestion, and carrying out genotyping according to the large substance of the fragment of the enzyme digestion product. The method does not need any probe or special instrument and equipment, and has the advantages of low cost, simple experimental process and strong operability.

Creating enzyme cutting sites: the invention designs PCR primers according to the base substitution condition of the polymorphic sites, wherein one primer is designed according to the adjacent sequence of the polymorphic sites, and the mismatched bases are artificially introduced, so that the 3' end of the primer and one allelic gene base of the polymorphic sites form a certain enzyme cutting site after PCR amplification, and the PCR product can be analyzed by a method similar to PCR-RFLP. As the method applies the primer 3' end mismatching technology, the genotype identification can be carried out after the enzyme digestion electrophoresis of the PCR product, and the detection method is simple and easy to implement. Specifically, the related sequence of the polymorphic site of rs1801394 of the MTRR gene is Rtgtg, wherein the polymorphic site R is A/G, the polymorphic site R is changed into Ragtc in a PCR product through the mismatching of the base at the 3' end of a primer, and when the allele is G, gagtc can recognize and cut HinfI or isoschizomer thereof; on the contrary, when the allele is A, the corresponding sequence of the PCR product is aagtc, and HinfI or its isoschizomer cannot recognize the cleavage, so that HinfI or its isoschizomer can be used for screening. Similar strategy is adopted in rs1801131 site of MTHFR gene, and the polymorphic site related sequence is changed from gaagM (M ═ A or C) to gaatM in PCR product by creating enzyme cutting site PCR, which can be screened by HinfI or isoschizomer thereof. Thus, the purpose of identifying 3 sites by using the same restriction endonuclease, namely HinfI, is achieved, and a foundation is laid for identifying 3 sites at one time in the same tube, which is shown in the following table 2.

TABLE 2 identification of polymorphic sites in 3 genes by the same restriction endonuclease

Modified primer PCR: when the invention aims at MTHFR gene rs1801131 site and MTRR gene rs1801394 site, a sequence irrelevant to a template is added at the 5' end when enzyme digestion site PCR is created so as to increase the length of a primer, thereby increasing the length of a PCR product, such as F4:CTAATACGACTGACTATAGGGAGAGGGGAGGAGCTGACCAGTGAAT(SEQ ID NO：7)；R6：TGTGGACCGATGGGCTTACCTGTACCACAGCTTGCTGACT(SEQ ID NO：12)。

direct PCR and nested PCR: the 1 st round of PCR of the invention adopts direct PCR, the system has more impurities and low PCR yield, and the impurities can interfere enzyme digestion reaction, so the nested PCR strategy is adopted, and enough specific DNA fragments are obtained for typing through the 2 nd round of PCR.

Multiplex PCR: the invention can simultaneously amplify MTHFR gene rs1801133 site [ C677T ], rs1801131 site [ A1298C ] and MTRR gene rs1801394 site [ A66G ] in the same system by using 3 pairs of primers, and can also simultaneously amplify MTHFR gene rs1801133 site [ C677T ] and rs1801131 site [ A1298C ] in the same system by using 2 pairs of primers. However, the multiplex PCR involves multiple pairs of primers, belongs to a complex reaction system, the interaction between the primers easily causes the self-inhibition of amplification, and the difference of the parameters of different primers can cause the inconsistent amplification efficiency of each target DNA to generate competitive amplification. The method of the invention greatly saves time, reagent and expenditure, and has the characteristics of economy, simplicity, convenience, high efficiency and the like.

Introducing an enzyme digestion internal control sequence into a PCR product: in the present invention, rs1801133 site [ C677T ] of MTHFR gene is taken as an example, wherein the polymorphic site recognition sequence GAGTC of T allele can be cut by HinfI, and the polymorphic site recognition sequence GAGCC of C allele can not be cut by HinfI, so that the polymorphic site base can be screened by HinfI, and the restriction enzyme cutting control sequence in PCR products of both C allele and T allele can be cut by HinfI.

The design can monitor the enzyme digestion degree, if the enzyme is not digested, the PCR product is difficult to perceive, because the enzyme digestion internal control sequence is provided, all real enzyme digestion bands are all the products of the original PCR product according to the principle of local objects in the whole, in addition, even if the PCR product or other enzyme digestion intermediate bands are produced, the result can be judged according to the enzyme digestion characteristic bands in the enzyme digestion product electrophoresis pattern, and the specific analysis is as shown in the following table 3 and figure 14.

Table 3 shows the digestion conditions after the introduction of the internal control sequence of the enzyme digestion, taking the rs1801133 site of MTHFR gene as an example

The present invention will be further described with reference to the following examples.

The invention directly uses oral epithelial cells as a template to amplify target segments of folate metabolism pathway MTHFR gene rs1801133 site [ C677T ], rs1801131 site [ A129 1298C ] and MTRR gene rs1801394 site [ A66G ], and PCR products of each site can be quickly digested by using the same cheap restriction endonuclease, namely HinfI, and then enzyme digestion map is made to distinguish genotypes. The PCR product of each site is provided with a HinfI enzyme digestion internal control sequence for monitoring whether enzyme digestion is carried out or not, and even under the condition that enzyme digestion is not carried out, the result can be judged according to the condition of a characteristic strip in an enzyme digestion map, so that the typing accuracy is ensured. The invention can detect any one of the three sites independently, can detect two sites of MTHFR gene at one time by the same tube, and can detect all three sites at one time by the same tube, thereby being convenient to select flexibly according to actual conditions.

Example 1

This example aims to identify two polymorphic sites of MTHFR gene, namely rs1801133 site [ see the relevant sequence data in FIG. 1 ] and rs1801131 site [ see the relevant sequence data in FIG. 2 ], in the same system by using the same enzyme, namely HinfI. The rs1801133 locus and related sequences before and after the MTHFR gene in GenBank dbSNP database are shown in SEQ ID NO:23, Y is polymorphic locus base, and Y is C or T, wherein C is wild allele and T is mutant allele, and https:// www.ncbi.nlm.nih.gov/projects/SNP/SNP _ ref.cgirs ═ 1801133. The rs1801131 site and the related sequences before and after the MTHFR gene are shown in SEQ ID NO:24, M is polymorphic site base, M is A or C, A is wild allele, C is mutant allele, and https:// www.ncbi.nlm.nih.gov/projects/SNP/SNP _ ref.cgirs 1801131.

The oral epithelial cells are used as a template, 2 pairs of primers (outer primers F1 and R1 aiming at the rs1801133 site) and (outer primers F3 and R3 aiming at the rs1801131 site) are used in the same system to carry out 1 st round PCR, and then 2 pairs of primers (inner primers F2 and R2 aiming at the rs1801133 site) and (inner primers F4 and R4 aiming at the rs1801131 site) are used in the same system to carry out 2 nd round PCR by using the PCR product of the 1 st round as a template. The 2 nd round PCR products of the two sites both have polymorphic site recognition sequences and restriction enzyme internal control sequences, and the genotype is judged by electrophoresis after restriction enzyme digestion by HinfI. The specific sequences of the primers F1, R1, F2, R2, F3, R3, F4 and R4 are shown as SEQ ID NO: 1 to 8.

The specific scheme of this example is as follows:

1. preparation of the template

Rinsing with clear water, stretching a sterilized cotton swab into the wall of the mouth cavity, wiping the sterilized cotton swab for 30-40 times up and down close to the inner side of the cheek, rinsing the cells with 1mL of TE, centrifuging at 4000 r/min for 5min, removing the supernatant, and resuspending the precipitate with 50 mu L of TE to obtain the template.

2. Nested PCR amplification and identification of target fragment

Round 1 PCR system:

dd H₂O 7.4μL、

PCR SuperMix (+ dye) 10. mu.L, oral epithelial cells 1. mu. L, F1(10 pmol/. mu.L) 0.4. mu. L, R1(10 pmol/. mu.L) 0.4. mu. L, F3(10 pmol/. mu.L) 0.4. mu. L, R3(10 pmol/. mu.L) 0.4. mu.L.

Round 1 PCR amplification procedure: 94 ℃ for 8 min; 94 ℃, 30s, 55 ℃, 30s, 72 ℃, 30s, 35 cycles; 72 ℃ for 5 min; storing at 4 ℃.

Round 2 PCR system:

ddH₂o10. mu.L, 2 × EasyTaqSupermix 12.5. mu. L, F2(10 pmol/. mu.L), 0.5. mu. L, R2(10 pmol/. mu.L), 0.5. mu. L, F4(10 pmol/. mu.L), 0.5. mu.L of 0.5. mu. L, R4(10 pmol/. mu.L), 0.5. mu.L of 1 st round PCR product, and a total volume of 25. mu.L.

Round 2 PCR amplification procedure: 94 ℃ for 4 min; 94 ℃, 30s, 57 ℃, 30s, 72 ℃, 25s, 30 cycles; 72 ℃ for 5 min; storing at 4 ℃.

In addition, this example sets up a control experiment, i.e. only rs1801133 site or rs1801131 site is amplified separately in round 2, and the amplification systems are: dd H₂O11. mu.L, 2 × Easy Taq superMix 12.5. mu. L, F2(10 pmol/. mu.L) 0.5. mu. L, R2(10 pmol/. mu.L) 0.5. mu.L, 1 st round PCR product 0.5. mu.L, total volume 25. mu.L; or dd H₂O11. mu.L, 2 × Easy Taq superMix 12.5. mu. L, F4(10 pmol/. mu.L) 0.5. mu. L, R4(10 pmol/. mu.L) 0.5. mu.L, 1 st round PCR product 0.5. mu.L, total volume 25. mu.L. The PCR amplification procedures for both were the same as the aforementioned two-site 2 nd round PCR amplification procedure.

When a multi-sample experiment is carried out, the 1 st round PCR and the 2 nd round PCR except the template can be mixed together in advance and then subpackaged so as to improve the working efficiency. The same strategy is adopted in the subsequent multi-sample experiments. All PCR products were identified by electrophoresis on a 1.5% agarose gel.

Enzyme digestion typing of PCR products

The enzyme digestion system is as follows:

ddH₂o21. mu.L, 10 XFastDigestGreenBuffer 2. mu.L, two-site PCR product 5. mu.L, FastDigest HinfI 2. mu.L.

ddH₂O22. mu.L, 10 XFastDigestGreenBuffer 2. mu.L, single-site PCR product 5. mu.L, FastDigest HinfI 1. mu.L.

Enzyme digestion is carried out in a water bath kettle at 37 ℃ for 10 min; then the temperature of the water bath is kept for 20min at 65 ℃ to inactivate the endonuclease. The digested product was subjected to 2.5% agarose gel electrophoresis, and the genotype was determined by observing the electrophoretogram.

The primers F2 and R2 in the embodiment are directed to the rs1801133 locus; the primers F4 and R4 are directed at the rs1801131 locus, and the theoretical major products of the corresponding PCR products are 569bp and 402bp respectively. FIG. 5 shows that in the 2 nd round PCR, the target band of the expected large product can be obtained by using 2 pairs of primers simultaneously or 1 pair of primers independently.

After the PCR product of 569bp at rs1801133 site is completely digested by HinfI enzyme, the bands of 3 genotype samples are as follows:

wild type homozygote CC: 468.5bp and 100.5bp

Heterozygote CT: 468.5bp, 368bp, 100.5bp

Mutant homozygote TT: 368bp, 100.5bp (if enzyme is not digested, 468.5bp bands may exist, but 468.5bp bands have lighter brightness than 368bp bands);

in fact, 3 genotypes can be distinguished only according to the combination of 468.5bp and 368bp characteristic fragments. The two characteristic fragments are compared with PCR products (569bp), the PCR products can be detected even if the PCR products are produced, and the judgment of genotypes is not interfered.

After the PCR product of 402bp at the rs1801131 site is completely digested by HinfI enzyme, the bands of 3 genotype samples are as follows:

wild type homozygous AA: 324.5bp 77.5bp

Heterozygote AC: 324.5bp, 280bp, 77.5bp and 44.5bp

Mutant homozygote CC: 280bp, 77.5bp and 44.5bp (if enzyme is not digested, 324.5bp bands may exist, but 324.5bp bands have lighter brightness than 280bp bands);

in fact, 3 genotypes can be distinguished only according to the combination of 324.5bp and 280bp characteristic fragments. The two characteristic fragments are both compared with a PCR product (402bp), the PCR product can be detected even if the PCR product is produced, and the judgment of the genotype is not interfered.

FIG. 6B is a graph clearly showing the genotype judgment using the characteristic bands at the rs1801133 and rs1801131 loci of MTHFR genes in each sample. Although some PCR products, the cleavage intermediate product bands, can be seen implicitly in the figure, they do not interfere with the judgment of the results because the characteristic bands are very clear. 1-6 is a double-site PCR product enzyme cutting map of an rs1801133 site and an rs1801131 site, and the genotype of the PCR product can be judged to be an rs1801133 site/an rs1801131 site which is CC/AA, CC/AC, CC/CC, CT/AA, CT/AC and TT/AA in sequence. 7-12 is the enzyme cutting map of the rs1801133 site PCR product corresponding to the above 1-6 samples, and the genotypes of the two are CC, CT and TT in sequence. 13-18 is the enzyme cutting map of the rs1801131 site PCR product corresponding to the aforementioned 1-6 samples, and the genotypes thereof are AA, AC, CC, AA, AC and AA in sequence. The result of double-site genotyping is matched with the result of single-site genotyping by enzyme, thus demonstrating the accuracy of the method of the invention.

In addition, the accuracy of the method is verified by sequencing. FIG. 10 is the sequencing peak diagram of 3 genotype samples at rs1801133 site of MTHFR gene. FIG. 11 is the sequencing peak diagram of 3 genotype samples at rs1801131 site of MTHFR gene.

Example 2

This example aims to establish a method for identifying rs1801394 site of MTRR gene (see FIG. 3 for related sequence data) by using HinfI, and PCR products for enzyme digestion typing not only have polymorphic site recognition sequences, but also have enzyme digestion internal control sequences (introduced by creating enzyme digestion site PCR). The rs1801394 locus and the related sequences of the MTRR gene in the GenBank dbSNP database are shown in SEQ ID NO:25, R is a polymorphic locus base, M is A or G, wherein A is a wild allele, G is a mutant allele, and https:// www.ncbi.nlm.nih.gov/projects/SNP/SNP _ ref. cgirs is 1801394.

Oral epithelial cells are used as a template, outer primers F5(SEQ ID NO: 9) and R5(SEQ ID NO: 10) are used for carrying out 1 st round of PCR in the same system, then the PCR products of the 1 st round are used as a template, inner primers F6(SEQ ID NO: 11) and R6(SEQ ID NO: 12) are used for carrying out 2 nd round of PCR in the same system, the PCR products of the 2 nd round are cut by HinfI, and the genotype is judged after electrophoresis of the cut products. The specific scheme is as follows:

1. preparation of the template

2. Nested PCR amplification of fragments of interest

Round 1 PCR system:

ddH₂O 8.2μL、

10 μ L of PCRUpermix (+ dye), 0.4 μ L of oral epithelial cells 1 μ L, F5(10 pmol/. mu.L) 0.4 μ L, R5(10 pmol/. mu.L) 0.4 μ L, and a total volume of 20 μ L.

Round 1 PCR amplification procedure: 94 ℃ for 8 min; 94 ℃, 30s, 53 ℃, 30s, 72 ℃, 30s, 35 cycles; 72 ℃ for 5 min; storing at 4 ℃.

Round 2 PCR system:

ddH₂o11. mu.L, 2 × EasyTaqSupermix 12.5. mu. L, F6(10 pmol/. mu.L), 0.5. mu. L, R6(10 pmol/. mu.L), 0.5. mu.L of the 1 st round PCR product, and a total volume of 25. mu.L.

Round 2 PCR amplification procedure: 94 ℃ for 4 min; 94 ℃, 30s, 57 ℃, 30s, 72 ℃, 20s, 30 cycles; 72 ℃ for 5 min; storing at 4 ℃.

Enzyme digestion typing of PCR products

The enzyme digestion system is as follows:

ddH₂o22. mu.L, 10 XFastDigestGreenBuffer 2. mu. L, PCR product 5. mu.L, FastDigest HinfI 1. mu.L.

The target band of the PCR product in this example is 236bp, and after the whole enzyme digestion with HinfI enzyme, 3 genotype bands at the rs1801394 site of MTRR gene are as follows:

wild type homozygous AA: 193.5bp, 42.5bp

Heterozygote AG: 193.5bp, 155bp, 42.5bp, 38.5bp

Mutant homozygote GG: 155bp, 42.5bp and 38.5bp (if enzyme is not digested, a 193.5bp band may exist, but the brightness of the 193.5bp band is lighter than that of the 155bp band);

in fact, 3 genotypes can be distinguished only according to the combination of two characteristic fragments of 193.5bp and 155 bp.

FIG. 7 is an electrophoretogram of the 2 nd round PCR product amplified in this example after HinfI cleavage. M is a DNA molecular weight Marker (DNA Marker I: 700, 600, 500, 400, 300, 200, 100bp) of the Beijing Zhuang Union internationally biological Gene technology Limited company; p is the 2 nd round PCR product, and the large substance is 236 bp; sample No. 1 is wild type homozygote AA, sample No. 2 is mutant homozygote GG, and sample No. 3 is heterozygote AG. The sample No. 2 also has a weaker 193.5bp, and is obviously an enzyme-digested intermediate product (transition band), because the brightness of a 193.5bp band in a real heterozygote is higher than 155bp, because the molar ratio of the two is 1:1, fragments with large molecular weight are combined with more nucleic acid dyes, and the color development is supposed to be brighter.

FIG. 12 is a sequence diagram of 3 genotype samples tested in this example, consistent with the enzyme detection results of the present invention.

Example 3

In this embodiment, a method for simultaneously identifying three loci of rs1801133 site [ C677T ], rs1801131 site [ a1298C ] and MTRR gene rs1801394 site [ a66G ] of an MTHFR gene by using HinfI is established on the basis of

embodiments

1 and 2, and a PCR product of each locus not only carries a polymorphic site recognition sequence, but also carries an intra-enzyme digestion control sequence. It uses oral cavity epithelial cell as template, uses 3 pairs of outer side primer (F1, R1), aiming at rs1801133 site) + (F3, R3, aiming at rs1801131 site) + (F5, R5, aiming at rs1801394 site) to carry out 1 st round PCR, then uses 1 st round PCR product as template, uses inner side primer (F2, R2, aiming at rs1801133 site) + (F4, R4, aiming at rs1801131 site) + (F6, R6, aiming at rs1801394 site) to carry out 2 nd round PCR, uses HinfI to cut the 2 nd round PCR product, and judges genotype after electrophoresis of cut enzyme product. The specific scheme is as follows:

1. preparation of the template

2. Nested PCR amplification and identification of target fragment

Round 1 PCR system:

ddH₂O 7.4μL、

10 μ L of PCRUpermix (+ dye), 1 μ L, F1(10 pmol/. mu.L) of oral epithelial cells 0.2 μ L, R1(10 pmol/. mu.L) 0.2 μ L, F3(10 pmol/. mu.L) 0.2 μ L, R3(10 pmol/. mu.L) 0.2 μ L, F5(10 pmol/. mu.L) 0.4 μ L, R5(10 pmol/. mu.L) 0.4 μ L, in a total volume of 20 μ L.

Round 2 PCR system:

ddH₂o21. mu.L, 2 × EasyTaqSupermix 25. mu. L, F2(10 pmol/. mu.L) 0.5. mu. L, R2(10 pmol/. mu.L) 0.5. mu. L, F4(10 pmol/. mu.L) 0.5. mu. L, R4(10 pmol/. mu.L) 0.5. mu. L, F6(10 pmol/. mu.L) 0.5. mu. L, R6(10 pmol/. mu.L) 0.5. mu.L, 1.0. mu.L of the 1 st round PCR product, and 50. mu.L of total volume.

Round 2 PCR amplification procedure: 94 ℃ for 4 min; 94 ℃, 30s, 57 ℃, 30s, 72 ℃, 25s, 30 cycles; 72 ℃ for 5 min; storing at 4 ℃. All PCR products were identified by electrophoresis on a 1.5% agarose gel.

Enzyme digestion typing of PCR products

The enzyme digestion system is as follows:

ddH₂o21. mu.L, 5. mu.L of the product 10 XFastDigestGreenBuffer 2. mu. L, PCR, 2. mu.L of FastDigest HinfI.

Enzyme digestion is carried out in a water bath kettle at 37 ℃ for 15 min; then the temperature of the water bath is kept for 20min at 65 ℃ to inactivate the endonuclease. The digested product was subjected to 2.5% agarose gel electrophoresis, and the genotype was determined by observing the electrophoretogram.

The primers F2 and R2 in the embodiment are directed to the rs1801133 locus; primers F4 and R4 aim at the rs1801131 site, F6 and R6 aim at the rs1801394 site, and the theoretical large substances of corresponding PCR products are 569bp, 402bp and 236bp respectively. FIG. 8 shows that 3 pairs of primers were amplified in the same system to obtain corresponding target fragments.

After the 569bp PCR product at the rs1801133 site is completely digested by HinfI enzyme, the bands of 3 genotype samples are as follows:

wild type homozygote CC: 468.5bp and 100.5bp

Heterozygote CT: 468.5bp, 368bp, 100.5bp

Mutant homozygote TT: 368bp, 100.5bp

In fact, 3 genotypes can be distinguished only according to the combination of 468.5bp and 368bp characteristic fragments. Namely:

1) an 468.5bp strip and a 368bp strip are not contained in the electrophoretogram, and the genotype of the polymorphic site rs1801133 of the sample is a wild homozygote CC;

2) an electrophoretogram does not have 468.5bp bands but has 368bp bands, and the genotype of the polymorphic site rs1801133 of the sample is mutant homozygote TT;

3) the electrophoretogram has 468.5bp bands and 368bp bands, if the brightness of the 468.5bp bands is higher than that of the 368bp bands, the genotype of the rs1801133 polymorphic site of the sample is heterozygote CT; if the brightness of the 468.5bp band is lighter than that of the 368bp band, the genotype of the polymorphic site rs1801133 in the sample is mutant homozygote TT.

wild type homozygous AA: 324.5bp 77.5bp

Heterozygote AC: 324.5bp, 280bp, 77.5bp and 44.5bp

Mutant homozygote CC: 280bp, 77.5bp and 44.5bp

In fact, 3 genotypes can be distinguished only according to the combination of 324.5bp and 280bp characteristic fragments. Namely:

1) an 324.5bp strip and no 280bp strip are contained in the electrophoretogram, and the genotype of the polymorphic site rs1801131 of the sample is a wild homozygote AA;

2) an electrophoretogram does not have 324.5bp bands but has 280bp bands, and the genotype of the rs1801131 polymorphic site of the sample is mutant homozygote CC;

3) the electrophoretogram has 324.5bp bands and 280bp bands, if the brightness of the 324.5bp bands is higher than that of the 280bp bands, the genotype of the rs1801131 polymorphic site of the sample is heterozygote AC; if the 324.5bp band is lighter than the 280bp band, the genotype of the polymorphic site rs1801131 in the sample is the mutant homozygote CC.

After the PCR product of 236bp at the rs1801394 site is completely digested by HinfI enzyme, the bands of 3 genotype samples are as follows:

wild type homozygous AA: 193.5bp, 42.5bp

Heterozygote AG: 193.5bp, 155bp, 42.5bp, 38.5bp

Mutant homozygote GG: 155bp, 42.5bp, 38.5bp

In fact, 3 genotypes can be distinguished only according to the combination of two characteristic fragments of 193.5bp and 155 bp. Namely:

1) the electrophoretic map has 193.5bp bands and no 155bp bands, and the genotype of the polymorphic site rs1801394 of the sample is a wild homozygote AA;

2) no 193.5bp band but 155bp band exists in the electropherogram, and the genotype of the polymorphic site rs1801394 of the sample is mutant homozygote GG;

3) the electrophoretogram has 193.5bp bands and 155bp bands, if the brightness of the 193.5bp bands is higher than that of the 155bp bands, the genotype of the rs1801394 polymorphic site of the sample is heterozygote AG; if the brightness of the 193.5bp strip is lighter than that of the 155bp strip, the genotype of the rs1801394 polymorphic site of the sample is the mutant homozygote GG.

FIG. 9 shows the electrophoresis pattern of the HinfI enzyme digestion of the PCR products of 3 sites in a group of samples in the same system, which can find the characteristic band corresponding to each site in each lane very clearly and judge the genotype.

Example 4

In this embodiment, similar to embodiment 3, a method for simultaneously identifying three loci of rs1801133 site [ C677T ], rs1801131 site [ a1298C ] and MTRR gene rs1801394 site [ a66G ] by using HinfI is also established, and a PCR product at each locus not only carries a polymorphic site recognition sequence, but also carries an intra-enzyme digestion control sequence. It uses oral cavity epithelial cell as template, uses 3 pairs of outer side primer (F1, R1), aiming at rs1801133 site) + (F3, R3, aiming at rs1801131 site) + (F7, R7, aiming at rs1801394 site) to carry out 1 st round PCR, then uses 1 st round PCR product as template, uses inner side primer (F2, R2, aiming at rs1801133 site) + (F4, R4, aiming at rs1801131 site) + (F8, R8, aiming at rs1801394 site) to carry out 2 nd round PCR, uses HinfI to cut the 2 nd round PCR product, and judges genotype after electrophoresis of cut enzyme product. The primers in this embodiment are consistent with the enzyme in embodiment 3 for the outer and inner primer pairs of rs1801133 locus [ C677T ] and rs1801131 locus [ a1298C ] of the MTHFR gene, but the outer and inner primer pairs of rs1801394 locus [ a66G ] of the MTHFR gene are adjusted [ see fig. 4 ], and a strict comparison experiment is performed at this time, i.e., samples of 16 different combination genotypes collected by a laboratory are subjected to three-locus combined typing and each unit locus is respectively typed, and whether the results of the two are matched is observed, which specifically comprises the following steps:

1. preparation of the template

2. Nested PCR amplification and identification of target fragment

Round 1 PCR system:

ddH₂O 7.4μL、

10 μ L of PCRUpermix (+ dye), 1 μ L, F1(10 pmol/. mu.L) of oral epithelial cells 0.2 μ L, R1(10 pmol/. mu.L) 0.2 μ L, F3(10 pmol/. mu.L) 0.2 μ L, R3(10 pmol/. mu.L) 0.2 μ L, F7(10 pmol/. mu.L) 0.5 μ L, R7(10 pmol/. mu.L) 0.5 μ L, and a total volume of 20 μ L.

Round 1 PCR amplification procedure: 94 ℃ for 8 min; 94 ℃, 30s, 55 ℃, 30s, 72 ℃, 45s, 35 cycles; 72 ℃ for 5 min; storing at 4 ℃.

Round 2 PCR system:

joint amplification against three sites:

ddH₂O 21μL、2×EasyTaqsuperMix 25μL、f2(10 pmol/. mu.L) 0.3. mu. L, R2(10 pmol/. mu.L) 0.3. mu. L, F4(10 pmol/. mu.L) 0.3. mu. L, R4(10 pmol/. mu.L) 0.3. mu. L, F8(10 pmol/. mu.L) 0.9. mu. L, R8(10 pmol/. mu.L) 0.9. mu.L, 1.0. mu.L of the 1 st round PCR product, and a total volume of 50. mu.L.

Amplification for each single site:

ddH₂o23.9. mu.L, 2 × EasyTaqSupermix 25. mu. L, F2(10 pmol/. mu.L), 0.3. mu. L, R2(10 pmol/. mu.L), 0.5. mu.L of the 1 st round PCR product, and a total volume of 50. mu.L. [ rs1801133 locus ]

ddH₂O23.9. mu.L, 2 × EasyTaqSupermix 25. mu. L, F4(10 pmol/. mu.L), 0.3. mu. L, R4(10 pmol/. mu.L), 0.5. mu.L of the 1 st round PCR product, and a total volume of 50. mu.L. [ rs1801131 locus ]

ddH₂O23.5. mu.L, 2 × EasyTaqSupermix 25. mu. L, F8(10 pmol/. mu.L) 0.5. mu. L, R8(10 pmol/. mu.L) 0.5. mu.L, 1 st round PCR product 0.5. mu.L, total volume 50. mu.L. [ rs1801394 locus ]

Enzyme digestion typing of PCR products

The enzyme digestion system is as follows:

ddH₂o18. mu.L, 10. mu.L of FastDigestGreenBuffer 2. mu.L, 8. mu.L of the three-site PCR product, FastDigest HinfI 2. mu.L or ddH₂O19. mu.L, 10 XFastDigestGreenBuffer 2. mu.L, single-site PCR product 8. mu.L, FastDigest HinfI 1. mu.L.

The primers F2 and R2 in the embodiment are directed to the rs1801133 locus; primers F4 and R4 aim at the site rs1801131, F8 and R8 aim at the site rs1801394, and the theoretical large substances of corresponding PCR products are 569bp, 402bp and 237bp respectively. P in A of FIG. 15 shows that 3 pairs of primers were amplified in the same system, and the corresponding target fragments were obtained, respectively. P in B, C, D of FIG. 15 shows that each pair of primers amplified separately also yielded the corresponding target fragment.

wild type homozygote CC: 468.5bp and 100.5bp

Heterozygote CT: 468.5bp, 368bp, 100.5bp

Mutant homozygote TT: 368bp, 100.5bp

Actually, 3 genotypes at the site rs1801133 can be distinguished only according to the combination condition of 468.5bp and 368bp characteristic fragments. Namely:

wild type homozygous AA: 324.5bp 77.5bp

Heterozygote AC: 324.5bp, 280bp, 77.5bp and 44.5bp

Mutant homozygote CC: 280bp, 77.5bp and 44.5bp

Actually, 3 genotypes of the rs1801131 locus can be distinguished only according to the combination condition of 324.5bp and 280bp characteristic fragments. Namely:

After the 237bp PCR product at the rs1801394 site is completely digested by HinfI enzyme, the bands of 3 genotype samples are as follows:

wild type homozygous AA: 206.5bp and 30.5bp

Heterozygote AG: 206.5bp, 155bp, 51.5bp and 30.5bp

Mutant homozygote GG: 155bp, 51.5bp and 30.5bp

Actually, 3 genotypes of the rs1801394 locus can be distinguished only according to the combination of 206.5bp and 155bp characteristic fragments. Namely:

1) an electrophoretogram has 206.5bp bands and does not have 155bp bands, and the genotype of the rs1801394 polymorphic site of the sample is a wild homozygote AA;

2) an electrophoretogram does not have 206.5bp bands, but has 155bp bands, and the genotype of the rs1801394 polymorphic site of the sample is mutant homozygote GG;

3) the electrophoretogram has 206.5bp bands and 155bp bands, if the brightness of the 206.5bp bands is higher than that of the 155bp bands, the genotype of the rs1801394 polymorphic site of the sample is heterozygote AG; if the 206.5bp band is lighter than the 155bp band, the genotype of the rs1801394 polymorphic site of the sample is the mutant homozygote GG.

Comparing the three-site combination genotypes of 16 different samples in A of FIG. 15 with the single-site genotype of B, C, D, the results were consistent with enzyme, indicating the accuracy of the method. This accuracy was also verified by sequencing, see fig. 10 (site rs 1801133), fig. 11 (site rs 1801131), fig. 13 (site rs 1801394).

SEQUENCE LISTING

<110> university of Guangdong department of pharmacy

<120> method and kit for detecting genetic information of folate metabolism related gene

<130>

<160> 25

<170> PatentIn version 3.5

<210> 1

<211> 22

<212> DNA

<213> Artificial sequence

<400> 1

ttgaacaggt ggaggccagc ct 22

<210> 2

<211> 24

<212> DNA

<213> Artificial sequence

<400> 2

actgagtgag aacctccagg ggtg 24

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence

<400> 3

ctgactgtca tccctattgg 20

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence

<400> 4

gacctggaga tccacttttt g 21

<210> 5

<211> 23

<212> DNA

<213> Artificial sequence

<400> 5

acatctttgt tcttgggagc ggg 23

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence

<400> 6

aggatgccct ggcggttcac 20

<210> 7

<211> 46

<212> DNA

<213> Artificial sequence

<400> 7

ctaatacgac tgactatagg gagaggggag gagctgacca gtgaat 46

<210> 8

<211> 23

<212> DNA

<213> Artificial sequence

<400> 8

tcatcgttcc agggcaggca agt 23

<210> 9

<211> 25

<212> DNA

<213> Artificial sequence

<400> 9

ggagcttgtc tacagggttg cactt 25

<210> 10

<211> 27

<212> DNA

<213> Artificial sequence

<400> 10

acggctctaa ccttatcgga ttcacta 27

<210> 11

<211> 47

<212> DNA

<213> Artificial sequence

<400> 11

aagcggtctt cgcatttacg gtttcttaaa gattgaggga gaatcaa 47

<210> 12

<211> 40

<212> DNA

<213> Artificial sequence

<400> 12

tgtggaccga tgggcttacc tgtaccacag cttgctgact 40

<210> 13

<211> 23

<212> DNA

<213> Artificial sequence

<400> 13

ctgttgtgaa tgatactgtg gct 23

<210> 14

<211> 21

<212> DNA

<213> Artificial sequence

<400> 14

cacaaaagaa tctaggcggt c 21

<210> 15

<211> 35

<212> DNA

<213> Artificial sequence

<400> 15

cccacgagga gccttaaaga ttgagggaga atcaa 35

<210> 16

<211> 53

<212> DNA

<213> Artificial sequence

<400> 16

agctcgttta gtgaaccgtc agatcgaaat ccatgtacca cagcttgctg act 53

<210> 17

<211> 23

<212> DNA

<213> Artificial sequence

<400> 17

tgaaggagaa ggtgtctgcg gga 23

<210> 18

<211> 20

<212> DNA

<213> Artificial sequence

<400> 18

aggacggtgc ggtgagagtg 20

<210> 19

<211> 20

<212> DNA

<213> Artificial sequence

<400> 19

caaggaggag ctgctgaaga 20

<210> 20

<211> 20

<212> DNA

<213> Artificial sequence

<400> 20

ccactccagc atcactcact 20

<210> 21

<211> 23

<212> DNA

<213> Artificial sequence

<400> 21

gcaaaggcca tcgcagaaga cat 23

<210> 22

<211> 25

<212> DNA

<213> Artificial sequence

<400> 22

aaacggtaaa atccactgta acggc 25

<210> 23

<211> 1001

<212> DNA

<213> Artificial sequence

<400> 23

ttcagtgtta cattaaaaac aatgtttaat ccggtgccta gagaaaagtc aagcttacta 60

ccccagatgc tgcccagcca gtgctaactg tagcattttc tcttttctat ggccaccaag 120

tgcaggcctg atttgcttgg ctgctcaagg caggacagtg tgggagtttg gagcaatcca 180

cccccactct tggaactggg ctctgagcca cctcccctga gagtcatctc tggggtcaga 240

agcatatcag tcatgagccc agccactcac tgttttagtt caggctgtgc tgtgctgttg 300

gaaggtgcaa gatcagagcc cccaaagcag aggactctct ctgcccagtc cctgtggtct 360

cttcatccct cgccttgaac aggtggaggc cagcctctcc tgactgtcat ccctattggc 420

aggttacccc aaaggccacc ccgaagcagg gagctttgag gctgacctga agcacttgaa 480

ggagaaggtg tctgcgggag ycgatttcat catcacgcag cttttctttg aggctgacac 540

attcttccgc tttgtgaagg catgcaccga catgggcatc acttgcccca tcgtccccgg 600

gatctttccc atccaggtga ggggcccagg agagcccata agctccctcc accccactct 660

caccgcaccg tcctcgcaca ggctgggggc tctgggtgga gtgctgagtt cgctgagttc 720

ttcccagatc tcctctcagg tccagaactt gcacagcgtt gcttggccac cccattttgg 780

ttacctctaa ttttcccccc aaaacccagc aacagtgtct gttgaggggt ttgttgtact 840

ttggccaaca agcatcacca aaagggattc taattctcat tacaaatcct gcttaaatca 900

gtgtttccca aaggtggctg tcatcagaac cacttgataa gctttttcaa aaagtggatc 960

tccaggtccc acccctggag gttctcactc agtaaatctg a 1001

<210> 24

<211> 1001

<212> DNA

<213> Artificial sequence

<400> 24

tccggctccc tctagccaat cccttgtctc aattctctgt ccccatcctc acccaggcgt 60

cccctaccct gggctctcag cgcccacccc aagcgccgag aggaagatgt acgtcccatc 120

ttctgggcct ccagaccaaa gagttacatc taccgtaccc aggagtggga cgagttccct 180

aacggccgct ggtgagggcc tgcagacctt ccttgcaaat acatctttgt tcttgggagc 240

gggagggcag aagaagtttg catgcttgtg gttgacctgg gaggagtcag gggcagaatt 300

tacaggaatg gcctcctggg catgtggtgg cactgccctc tgtcaggagt gtgccctgac 360

ctctgggcac ccctctgcca ggggcaattc ctcttcccct gcctttgggg agctgaagga 420

ctactacctc ttctacctga agagcaagtc ccccaaggag gagctgctga agatgtgggg 480

ggaggagctg accagtgaag maagtgtctt tgaagtcttc gttctttacc tctcgggaga 540

accaaaccgg aatggtcaca aagtgagtga tgctggagtg gggaccctgg ttcatcccct 600

gcccctggcc tgaccccagc tgcaggccag gctgcggggc tgtgacttcc ccatcctgtg 660

ccctcccctc catgctgtgg acatggcaaa gggagaaggg taagttggga gacctccacc 720

tggaagggct tagggaggca aagacaggct gggtctttgt tgggggccgt gagagggact 780

cagggtgcca aacctgatgg tcgccccagc cagctcaccg tctctcccag gtgacttgcc 840

tgccctggaa cgatgagccc ctggcggctg agaccagcct gctgaaggag gagctgctgc 900

gggtgaaccg ccagggcatc ctcaccatca actcacagcc caacatcaac gggaagccgt 960

cctccgaccc catcgtgggc tggggcccca gcgggggcta t 1001

<210> 25

<211> 1112

<212> DNA

<213> Artificial sequence

<400> 25

tgggaagtga tagaaatttt agctgtagta aggttttcat tatcgtttcc accgttttct 60

gtgagctgtc aatgtgtagt gttttcatat tgtttattca ctcattcaga taacttatcg 120

agtaccagtt tcatgccagg tgccgttctg ggcggttcat tcaccgaaag ccaagmtttt 180

ggtttggrtt tcagtttaaa tctgtctctg caaattgaca gcccaccaat tttagccgtt 240

agatgagtat ggaaaaaaat ctgtgagtgt cgtttgtttt actactgctt atctcttgcg 300

gaaaaacgtg ttagtaaaat gtttaagtgg attggaaata ttttttcgtt atatgcaccc 360

gtttgtatat atgcccatac actcacatat ttttgatttg cattaaataa tgaaggagag 420

tatgtgcttc agttaccttt agtactatga ttagtttgtt tagcgttagg atcaaataag 480

aaccaagaat cctatcattt taatatagtt tttactttta tcttttttta aaaagaggaa 540

accaaaagct atttaagact gttgtgaatg atactgtggc tcaagttttg ttcaggttct 600

tggcttgtgc cacatcgttt ttcaggtagg tggtaatact ctcattttta ggataaagga 660

gctgtggtac ggatcatttg gggagcttgt ctacagggtt gcacttagga aacacagatt 720

caagcccaag tagtttcgag ccgatcatct gatttctgag ccatggaatt agagtttcat 780

tcgtacactc tccttaattt gatgaattct tatttaggct catttgagat tagtgctgaa 840

aacaaattta gaaaaggcca tttcatatta tgtgtgggta ttgttgcatt gtttcttaaa 900

gattgaggga gaattaatat ctttaggttg ttactgcttc attaaaaaga ggatcttttt 960

tcccccattt ttcagtttca ctgttacatg ccttgaagtg atgaggaggt ttctgttact 1020

atatgctaca cagcagggac aggcaaaggc catcgcagaa gaaatrtgtg agcaagctgt 1080

ggtacatgga ttttctgcag atcttcactg ta 1112

Claims

1. The application of the nested PCR primer group in the preparation of a kit for simultaneously detecting 3 gene polymorphic sites related to folate metabolism is characterized in that,

the primer group of the nested PCR consists of primer pairs 1, 2, 3, 4, 5 and 6, wherein the primer pairs 1, 3 and 5 are outer primer pairs, and the primer pairs 2, 4 and 6 are inner primer pairs;

or the primer group of the nested PCR consists of primer pairs 1, 2, 3, 4, 7 and 8, wherein the primer pairs 1, 3 and 7 are outer primer pairs, and the primer pairs 2, 4 and 8 are inner primer pairs;

the specific sequences of all the primer pairs are as follows:

primer pair 1:

F1：TTGAACAGGTGGAGGCCAGCCT，

R1：ACTGAGTGAGAACCTCCAGGGGTG；

and (3) primer pair 2:

F2：CTGACTGTCATCCCTATTGG，

R2：GACCTGGAGATCCACTTTTTG；

and (3) primer pair:

F3：ACATCTTTGTTCTTGGGAGCGGG，

R3：AGGATGCCCTGGCGGTTCAC；

and (3) primer pair 4:

F4：CTAATACGACTGACTATAGGGAGAGGGGAGGAGCTGACCAGTGAAT，

R4：TCATCGTTCCAGGGCAGGCAAGT；

and (3) primer pair 5:

F5：GGAGCTTGTCTACAGGGTTGCACTT，

R5：ACGGCTCTAACCTTATCGGATTCACTA；

and (3) primer pair 6:

F6：AAGCGGTCTTCGCATTTACGGTTTCTTAAAGATTGAGGGAGAATCAA，

R6：TGTGGACCGATGGGCTTACCTGTACCACAGCTTGCTGACT；

and (3) primer pair 7:

F7：CTGTTGTGAATGATACTGTGGCT，

R7：CACAAAAGAATCTAGGCGGTC；

and (3) primer pair 8:

F8：CCCACGAGGAGCCTTAAAGATTGAGGGAGAATCAA，

R8：AGCTCGTTTAGTGAACCGTCAGATCGAAATCCATGTACCACAGCTTGCTGACT；

carrying out enzyme digestion on the nested PCR product by using restriction endonuclease HinfI;

the 3 gene polymorphism sites related to folate metabolism are rs1801133 site, rs1801131 site of MTHFR gene and rs1801394 site of MTRR gene respectively.

2. The use according to claim 1, wherein the method for simultaneously detecting 3 gene polymorphic sites associated with folate metabolism comprises the following steps:

1) amplifying the target site of the sample by nested PCR;

2) carrying out enzyme digestion on the nested PCR product by using restriction endonuclease HinfI;

3) and (3) carrying out agarose gel electrophoresis on the enzyme digestion product, and determining the genotypes of the 3 gene polymorphism sites according to the characteristic bands of the electrophoresis pattern.

3. The use according to claim 2, wherein the sample is a cell sample or an extracted DNA sample.

4. Use according to claim 2, wherein the nested PCR is operated as: carrying out 1 st round PCR amplification by using the outer primer pairs 1, 3 and 5, and carrying out 2 nd round PCR amplification on the amplification product by using the inner primer pairs 2, 4 and 6;

or the operation of the nested PCR is as follows: the 1 st round of PCR amplification is carried out by using the outer primer pairs 1, 3 and 7, and the 2 nd round of PCR amplification is carried out by using the amplification products and the inner primer pairs 2, 4 and 8.

5. The use according to any one of claims 2 to 4, wherein the specific method for determining the genotype of 3 gene polymorphism sites according to the characteristic bands of the electropherogram is as follows:

if the primers of the nested PCR consist of primer pairs 1, 2, 3, 4, 5 and 6, the genotype of each gene polymorphic site is determined as follows:

if the primers of the nested PCR consist of primer pairs 1, 2, 3, 4, 7 and 8, the genotype of each gene polymorphic site is determined as follows:

6. A nested PCR primer group for simultaneously detecting 3 gene polymorphic sites related to folate metabolism is characterized in that the primer group consists of primer pairs 1, 2, 3, 4, 5 and 6 or primer pairs 1, 2, 3, 4, 7 and 8, and the specific sequences of the primer pairs are as defined in claim 1; the 3 gene polymorphism sites related to folic acid metabolism are rs1801133 site, rs1801131 site of MTHFR gene and rs1801394 site of MTRR gene respectively; the nested PCR product was digested with restriction endonuclease HinfI.

7. A nested PCR kit for simultaneously detecting 3 gene polymorphism sites related to folate metabolism, which comprises the primer set of claim 6; the 3 gene polymorphism sites related to folic acid metabolism are rs1801133 site, rs1801131 site of MTHFR gene and rs1801394 site of MTRR gene respectively; the nested PCR product was digested with restriction endonuclease HinfI.

8. The kit of claim 7, wherein the kit comprises the restriction endonuclease HinfI.