CN110184333A - A kind of GSTM1 gene delection detection method based on melting curve analysis - Google Patents
A kind of GSTM1 gene delection detection method based on melting curve analysis Download PDFInfo
- Publication number
- CN110184333A CN110184333A CN201910485738.4A CN201910485738A CN110184333A CN 110184333 A CN110184333 A CN 110184333A CN 201910485738 A CN201910485738 A CN 201910485738A CN 110184333 A CN110184333 A CN 110184333A
- Authority
- CN
- China
- Prior art keywords
- melting curve
- detection method
- method based
- curve analysis
- template
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The GSTM1 gene delection detection method based on melting curve analysis that the invention discloses a kind of, including step 1, the preparation of template；Step 2, the synthesis and preparation of primer；Step 3, judgement as a result；After the preparation of template with clear water the following steps are included: gargled, mouth desquamated cells are acquired, mouth desquamated cells acquisition swab is put in into oral cavity wall when acquisition, is wiped 30~40 times up and down on the inside of cheek；Cell is rinsed with 1mL TE, carries out centrifugation layering；Supernatant is abandoned, precipitating is resuspended with 50 μ L TE, can be used as template；Prepare PCR primer sequence: setting PCR system and PCR program are according to the peak type of melting curve judgement genotype；The GSTM1 gene delection detection method based on melting curve analysis, using single step analysis method, it is directly analyzed after cell collection, without nucleic acid extraction, step is simple, and compares in the analysis single tube with target gene it is achieved that reducing experimental procedure and cost, as long as and fluorescence channel one, it is low for equipment requirements.
Description
Technical field
The present invention relates to gene delection detection method technical field, specially a kind of GSTM1 based on melting curve analysis
Gene delection detection method.
Background technique
Glutathione transferase (GSTs) is a kind of important enzyme family, it is catalyzed the removing toxic substances of a variety of exogenous materials, packet
Include environmental carcinogen, chemotherapeutics and active oxygen.They participate in second stage removing toxic substances, mediate reduced glutathione with it is electrophilic
The coupling of compound, to eliminate toxic compounds.Therefore, GSTs is sent out in protecting cells from environmental exposure and oxidative stress
Important function is waved, and related with drug resistance of the cell to drug.
The characteristics of GSTM1 is a member important in GSTs family, it has a common polymorphism is complete missing gene.
2 homozygous deletions (no genotype) lead to the missing of enzyme and its catalytic activity, this has been demonstrated to reduce cell to certain toxicity
The detoxification ability of substance.The deletion Genotype of GSTM1, it is considered to be some keys with exogenous material related disease neurological susceptibility
Factor, such as lung cancer, nasopharyngeal carcinoma.In addition, the deletion Genotype of GSTM1 is recognized as and the medicines such as platinum class, nevirapine, Clozapine
The effects and side effects of object are related.
Current most widely used gene delection classifying method is that traditional multiplex PCR adds gel electrophoresis analysis, taqman
Sonde method and chip method.Traditional multiplex PCR adds gel electrophoresis analysis, and complex steps are not suitable for middle high-throughput sample analysis.
Taqman sonde method generally requires the real time PCR instrument of two fluorescence channels or more, higher to instrument requirements, and probe synthesis compared with
It is expensive.Chip method needs special instrument and consumptive material, and complex steps are expensive, and the parting to a few gene is simultaneously improper.
Therefore design a kind of GSTM1 gene delection detection method based on melting curve analysis be very it is necessary to.
Summary of the invention
The GSTM1 gene delection detection method based on melting curve analysis that the purpose of the present invention is to provide a kind of, with solution
Certainly the problems mentioned above in the background art.
In order to solve the above technical problem, the present invention provides following technical solutions: a kind of based on melting curve analysis
GSTM1 gene delection detection method, including step 1, the preparation of template；Step 2, the synthesis and preparation of primer；Step 3, knot
The judgement of fruit；
Wherein in the above step 1, template preparation the following steps are included:
1) after being gargled with clear water, mouth desquamated cells are acquired；
2) cell is rinsed with 1mL TE, carries out centrifugation layering；
3) supernatant is abandoned, precipitating is resuspended with 50 μ L TE, can be used as template；
Wherein in above-mentioned steps two, the synthesis of primer and prepare the following steps are included:
1) PCR primer sequence:
①GSTM1-F GAACTCCCTGAAAAGCTAAAGC；
②GSTM1-R GTTGGGCTCAAATATACGGTGG；
③BCL2-F GCAATTCCGCATTTAATTCATGG；
④BCL2-R GAAACAGGCCACGTAAAGCAAC；
2) PCR system:
1. the Talent qPCR Premix of 5ul reaction solution 2；
2. the primer mixed liquor of 2ul；
3. the template of 1ul；
4. the water of 2ul；
3) PCR program:
1. 95 DEG C, 10min；
2. 95 DEG C, 5s, 63 DEG C, 25s, 72 DEG C, 20s, 38 circulations；
3. 95 DEG C, 10s；65 DEG C, 60s；Temperature slowly and at the uniform velocity rise to 98 DEG C, five data points of every degree Celsius of acquisition；
Wherein in above-mentioned steps three, genotype is determined according to the peak type of melting curve.
According to the above technical scheme, the step 1 1) in, mouth desquamated cells acquisition swab is put in into oral cavity when acquisition
Wall wipes 30~40 times up and down on the inside of cheek.
According to the above technical scheme, the step 1 2) in, centrifugal speed 4000r/min is centrifuged 5min.
According to the above technical scheme, the step 2 2) in, the model of Talent qPCR Premix reaction solution
FP209。
According to the above technical scheme, the step 2 3) in, heating rate is 0.2 DEG C/s.
According to the above technical scheme, in the step 3, peak type judgement includes:
1) only there is peak, deletion form in position 1；
2) there is peak, normal type in position 1 and 2；
3) do not occur peak in position 1, experiment error needs to check.
Compared with prior art, the beneficial effects obtained by the present invention are as follows being: should the GSTM1 gene based on melting curve analysis
Missing detection method is directly analyzed after cell collection using single step analysis method, is not necessarily to nucleic acid extraction, and step is simple, and
Control in the analysis single tube of target gene it is achieved that reduce experimental procedure and cost, as long as and fluorescence channel one, it is right
Equipment requirement is low.
Detailed description of the invention
Attached drawing is used to provide further understanding of the present invention, and constitutes part of specification, with reality of the invention
It applies example to be used to explain the present invention together, not be construed as limiting the invention.In the accompanying drawings:
Fig. 1 is vertical flow chart of the invention；
Fig. 2 is normal type melting curve schematic diagram of the invention；
Fig. 3 is deletion form melting curve schematic diagram of the invention；
In figure: 1, position 1；2, position 2.
Specific embodiment
Following will be combined with the drawings in the embodiments of the present invention, and technical solution in the embodiment of the present invention carries out clear, complete
Site preparation description, it is clear that described embodiments are only a part of the embodiments of the present invention, instead of all the embodiments.It is based on
Embodiment in the present invention, it is obtained by those of ordinary skill in the art without making creative efforts every other
Embodiment shall fall within the protection scope of the present invention.
Please refer to Fig. 1-3, the present invention provides a kind of technical solution: a kind of GSTM1 gene based on melting curve analysis is scarce
Lose detection method, comprising the following steps:
1) preparation of template: after being gargled with clear water, acquiring mouth desquamated cells, wipes mouth desquamated cells acquisition when acquisition
Son puts in oral cavity wall, wipes 30~40 times up and down on the inside of cheek；Cell is rinsed with 1mL TE, carries out centrifugation point
Layer, centrifugal speed 4000r/min are centrifuged 5min；Supernatant is abandoned, precipitating is resuspended with 50 μ L TE, can be used as template；
2) synthesis and preparation of primer: PCR primer sequence:
GSTM1-F GAACTCCCTGAAAAGCTAAAGC；
GSTM1-R GTTGGGCTCAAATATACGGTGG；
BCL2-F GCAATTCCGCATTTAATTCATGG；
BCL2-R GAAACAGGCCACGTAAAGCAAC；
PCR system: the type of the Talent qPCR Premix of 5ul reaction solution 2, Talent qPCR Premix reaction solution
Number be FP209；The primer mixed liquor of 2ul；The template of 1ul；The water of 2ul；
PCR program: 95 DEG C, 10min；95 DEG C, 5s, 63 DEG C, 25s, 72 DEG C, 20s, 38 circulations；95 DEG C, 10s；65 DEG C,
60s；Temperature slowly and at the uniform velocity rise to 98 DEG C, heating rate is 0.2 DEG C/s, five data points of every degree Celsius of acquisition；
3) judgement of result: genotype is determined according to the peak type of melting curve, peak type judgement includes:
1. only there is peak, deletion form in position 1；
2. there is peak, normal type in position 1 and 2；
3. not occurring peak in position 1, experiment error needs to check.
The present invention is compared with conventional method (PCR+ agarose gel electrophoresis):
The analysis of the invention that GSTM1 is carried out with Standard PCR gel electrophoresis respectively of 205 samples, comparison result such as following table.
Note: it is deletion form that this 2 samples of * are analyzed with the third method；
It is normal type that this 5 samples are analyzed with the third method.
Only the 1% of the failure of an experiment of the present invention, and conventional method is up to 5.9%.The failure of an experiment rate can be made significantly to drop using the present invention
Low (value < 0.01 P).
Verifying analysis shows, 92 conventional analysis results are normal type, and it is 90 that the present invention, which analyzes normal type number of cases, kiss
Conjunction rate 97.8%, discrepant 2 with the third method validation, be also deletion form.Show the present invention for the accurate of normal type
Rate is 100%, conventional method 97.8%.
Verifying analysis shows, 101 conventional analysis results are deletion form, and it is 95 that the present invention, which analyzes deletion form number of cases,
Coincide rate 94%, discrepant 5 with the third method validation, be also normal type.Show the present invention for the accurate of deletion form
Rate is 100%, conventional method 94%, and false positive rate significantly reduces (value < 0.01 P)
It is to sum up told, the present invention is since operating procedure is few, and detection fluorescence is sensitiveer, and compare conventional method, the failure of an experiment
Rate significantly reduces, and increases to the Detection accuracy of deletion form, false positive rate decline.
It should be noted that, in this document, relational terms such as first and second and the like are used merely to a reality
Body or operation are distinguished with another entity or operation, are deposited without necessarily requiring or implying between these entities or operation
In any actual relationship or order or sequence.Moreover, the terms "include", "comprise" or its any other variant are intended to
Non-exclusive inclusion, so that the process, method, article or equipment including a series of elements is not only wanted including those
Element, but also including other elements that are not explicitly listed, or further include for this process, method, article or equipment
Intrinsic element.
Finally, it should be noted that the foregoing is only a preferred embodiment of the present invention, it is not intended to restrict the invention,
Although the present invention is described in detail referring to the foregoing embodiments, for those skilled in the art, still may be used
To modify the technical solutions described in the foregoing embodiments or equivalent replacement of some of the technical features.
All within the spirits and principles of the present invention, any modification, equivalent replacement, improvement and so on should be included in of the invention
Within protection scope.
Claims (6)
1. a kind of GSTM1 gene delection detection method based on melting curve analysis, including step 1, the preparation of template；Step
Two, the synthesis and preparation of primer；Step 3, judgement as a result；It is characterized by:
Wherein in the above step 1, template preparation the following steps are included:
1) after being gargled with clear water, mouth desquamated cells are acquired；
2) cell is rinsed with 1mL TE, carries out centrifugation layering；
3) supernatant is abandoned, precipitating is resuspended with 50 μ L TE, can be used as template；
Wherein in above-mentioned steps two, the synthesis of primer and prepare the following steps are included:
1) PCR primer sequence:
①GSTM1-F GAACTCCCTGAAAAGCTAAAGC；
②GSTM1-R GTTGGGCTCAAATATACGGTGG；
③BCL2-F GCAATTCCGCATTTAATTCATGG；
④BCL2-R GAAACAGGCCACGTAAAGCAAC；
2) PCR system:
1. the Talent qPCR Premix of 5ul reaction solution 2；
2. the primer mixed liquor of 2ul；
3. the template of 1ul；
4. the water of 2ul；
3) PCR program:
1. 95 DEG C, 10min；
2. 95 DEG C, 5s, 63 DEG C, 25s, 72 DEG C, 20s, 38 circulations；
3. 95 DEG C, 10s；65 DEG C, 60s；Temperature slowly and at the uniform velocity rise to 98 DEG C, five data points of every degree Celsius of acquisition；
Wherein in above-mentioned steps three, genotype is determined according to the peak type of melting curve.
2. a kind of GSTM1 gene delection detection method based on melting curve analysis according to claim 1, feature exist
In the step 1 1) in, mouth desquamated cells acquisition swab is put in into oral cavity wall when acquisition, is wiped up and down on the inside of cheek
30~40 times.
3. a kind of GSTM1 gene delection detection method based on melting curve analysis according to claim 1, feature exist
In: the step 1 2) in, centrifugal speed 4000r/min is centrifuged 5min.
4. a kind of GSTM1 gene delection detection method based on melting curve analysis according to claim 1, feature exist
In: the step 2 2) in, the model FP209 of Talent qPCR Premix reaction solution.
5. a kind of GSTM1 gene delection detection method based on melting curve analysis according to claim 1, feature exist
In: the step 2 3) in, heating rate is 0.2 DEG C/s.
6. a kind of GSTM1 gene delection detection method based on melting curve analysis according to claim 1, feature exist
In: in the step 3, peak type judgement includes:
1) only there is peak, deletion form in position 1；
2) there is peak, normal type in position 1 and 2；
3) do not occur peak in position 1, experiment error needs to check.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910485738.4A CN110184333A (en) | 2019-06-05 | 2019-06-05 | A kind of GSTM1 gene delection detection method based on melting curve analysis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910485738.4A CN110184333A (en) | 2019-06-05 | 2019-06-05 | A kind of GSTM1 gene delection detection method based on melting curve analysis |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110184333A true CN110184333A (en) | 2019-08-30 |
Family
ID=67720504
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910485738.4A Pending CN110184333A (en) | 2019-06-05 | 2019-06-05 | A kind of GSTM1 gene delection detection method based on melting curve analysis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110184333A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108642138A (en) * | 2018-05-02 | 2018-10-12 | 广东药科大学 | A kind of method and kit of detection folic acid metabolism related gene hereditary information |
-
2019
- 2019-06-05 CN CN201910485738.4A patent/CN110184333A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108642138A (en) * | 2018-05-02 | 2018-10-12 | 广东药科大学 | A kind of method and kit of detection folic acid metabolism related gene hereditary information |
Non-Patent Citations (3)
| Title |
|---|
| DANAI TIWAWECH ET AL.: "Real-Time PCR Assay for Rapid Detection of GSTM1 Polymorphism in Nasopharyngeal Carcinoma Patients", 《ASIAN PACIFIC JOURNAL OF CANCER PREVENTION》 * |
| 王小飞等: "SYBR green I结合熔解曲线分析快速检测GSTM1基因多态性", 《临床检验杂志》 * |
| 郑德杰等: "应用SYBR green I荧光PCR研究GSTM1基因多态性与肺癌遗传易感性之间的相关性", 《中国肺癌杂志》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109609647B (en) | Detection Panel for pan-cancer-species targeting, chemotherapy and immune drugs based on next-generation sequencing, detection kit and application thereof | |
| Zhou et al. | Association between two genetic variants in miRNA and primary liver cancer risk in the Chinese population | |
| CN110283908B (en) | Colorectal cancer auxiliary diagnosis SNP marker and application thereof | |
| Tanaka | Omics-based medicine and systems pathology | |
| CN106939350A (en) | Detection kit, detection method and its application of thalassemia associated gene mutation | |
| Shi et al. | Transcriptomic analyses for identification and prioritization of genes associated with Alzheimer’s disease in humans | |
| CN113832243A (en) | Core SNP marker for tea tree variety identification based on KASP technology development | |
| CN110689925A (en) | High-temperature-resistant corn gene mining method based on transcriptome sequencing | |
| CN108796075A (en) | Detect application and the kit of circRNF13 and LOC284454 reagents | |
| CN106755293B (en) | Lung cancer auxiliary diagnosis related lncRNA marker and application thereof | |
| CN110184333A (en) | A kind of GSTM1 gene delection detection method based on melting curve analysis | |
| CN107475398A (en) | Detect the primer and method of IKZF1 gene mutation typings | |
| CN101392291A (en) | Method and apparatus for judging the presence or absence of cancer cell | |
| Rao et al. | Laser capture microdissection: a gear for pancreatic cancer research | |
| Huang et al. | Expression profiles of tRNA-derived fragments and their potential roles in lung adenocarcinoma | |
| CN109355377B (en) | Warfarin individualized medication related gene polymorphism detection kit and preparation method and application thereof | |
| CN110982895A (en) | Primer group and kit for detecting human erythrocyte ABO blood type genotyping and application | |
| CN105861661B (en) | -α21.9Deletion form gene of alpha thalassemia detection kit | |
| CN109477244A (en) | Bladder cancer detection is carried out using microsatellite analysis in the buccal swab of pairing and urine specimen | |
| CN106755330B (en) | Cancer-related gene expression difference detection kit and application thereof | |
| CN105343896B (en) | The new diagnosis and treatment target spot of nasopharyngeal carcinoma and its application | |
| CN108660213A (en) | The application of three kinds of non-coding RNA reagents of detection and kit | |
| CN107475442A (en) | A kind of method of microsatellite instability detection | |
| CN112501305B (en) | Primer probe combination for quantitative methylation detection of TFPI2 gene, application, kit and method thereof | |
| CN108531579A (en) | Primer composition and kit for detecting sulfonylureas related gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190830 |
|
| RJ01 | Rejection of invention patent application after publication |