CN108165568A

CN108165568A - A kind of culture CD19CAR-iNKT cellular processes and purposes

Info

Publication number: CN108165568A
Application number: CN201611116333.6A
Authority: CN
Inventors: 黄飞; 何凤; 赵晓楠; 金涛; 王海鹰; 史子啸
Original assignee: Shanghai Hrain Biotechnology Co Ltd
Current assignee: Shanghai Hengrun Dasheng Biotechnology Co.,Ltd.
Priority date: 2016-12-07
Filing date: 2016-12-07
Publication date: 2018-06-15
Anticipated expiration: 2036-12-07
Also published as: CN108165568B

Abstract

The present invention relates to targeting CD19CAR iNKT cells and application thereof.Specifically, the present invention provides a kind of polynucleotide sequence and its activation culture and application thereof, it is selected from：(1) coded sequence of coded sequence, people's CD8 α hinge areas containing sequentially connected anti-CD19 single-chain antibodies, the coded sequence of people's CD8 transmembrane regions, the coded sequence of people's 41BB intracellular regions, people's CD3 ζ intracellular regions coded sequence；(2) complementary series of (1) described polynucleotide sequence.The present invention also provides relevant fusion protein, the carrier containing the coded sequence and the fusion protein, coded sequence, carrier purposes.Activation and its cultural method and application range the present invention also provides iNKT cells.

Description

A kind of culture CD19CAR-iNKT cellular processes and purposes

Technical field

The invention belongs to Chimeric antigen receptor fields, and in particular to targeting CD19CAR-iNKT cells and application thereof.

Background technology

Chimeric antigen receptor (Chimeric Antigen Receptor-T cell, CAR-T) T cell refers to repair through gene After decorations, specific purpose antigen, and the T cell of continuous activation amplification can be identified with MHC non-limiting ways.It is 2012 international thin Born of the same parents, which treat association annual meeting middle finger and go out biological immune cell therapy, has become operation, radiotherapy, the 4th kind for the treatment of tumour outside chemotherapy Means, and future tumors will be become and treat essential means.CAR-T cell adoptive therapies are that most clearly have in current cancer therapies The immunotherapeutic form of effect.Numerous studies show that CAR-T cells can effectively identify tumour antigen, cause the anti-of specificity Tumor immune response significantly improves the survival state of patient.

Chimeric antigen receptor (CAR) is the core component of CAR-T, assigns the non-dependent modes of T cell HLA and identifies that tumour resists Former ability, this enables identifies wider mesh by the T cell that CAR is transformed compared to nave T cell surface receptor TCR Mark.It is (logical that the basic engineering of CAR includes a tumor associated antigen (tumor-associated antigen, TAA) combined area Often derive from the scFV sections of monoclonal antibody antigen calmodulin binding domain CaM), an extracellular hinge area, a transmembrane region and an intracellular are believed Number area.The selection of target antigen for the specificity of CAR, validity and the genetic modification T cell safety of itself all It is crucial determinant.

With Chimeric antigen receptor T cell (Chimeric Antigen Receptor-T cell, CAR-T), technology is not Disconnected development, CAR-T can mainly be divided into for four generations at present.

First generation CAR-T cells by extracellular combined area-single-chain antibody (single chain fragment variable, ScFV), transmembrane region (transmembrane region, TM) and intracellular signal area-immunoreceptor tyrosine activating motif (immunoreceptor tyrosine based activation motif, ITAM) is formed, and wherein Chimeric antigen receptor is each Part is connected by following form：scFv-TM-CD3ζ.Although first generation CAR it can be seen that some specificity cytotoxicities, Have been found that curative effect is barely satisfactory when carrying out clinical test summary to it within 2006.Trace it to its cause is because of first generation CAR-T Cell will soon exhaust that persistence is very poor in patient body, so that CAR-T cells have enough time touching largely not yet Tumour cell when just this kind of CAR-T cell of apoptosis can excite antitumoral cytotoxic effect, but cell because Son secretion it is fewer, but its survival period in vivo it is shorter cannot excite lasting anti-tumor effect [Cancer Res 2007, 67(22)：11029-11036].

T cell activation signaling zone is still the hot spot of research in the optimization CAR designs of second generation CAR-T cells.T cell it is complete Full activation depends on the effect of dual signal and cell factor.Wherein the first signal is specific signals, and antigen submission is identified by TCR Antigenic Peptide-MHC the compounds of cell surface are started；Second signal is costimulatory signal.Early in 1998, there have been Two generation CAR [J Immunol.1998；161(6)：2791-7].2nd generation CAR is added to a collaboration thorn in intracellular signal peptide area Swash molecule, i.e., costimulatory signal is assembled into inside CAR, preferably can provide activation signals for CAR-T cells, in this way Costimulatory molecules and intracellular signal can be activated after CAR tumor cells simultaneously, realize dual activation, T can be significantly improved Cell Proliferation secretion capacity and anti-tumor effect.First T cell costimulatory signal receptor studied in detail is CD28, its energy It is enough to be combined with the B7 family members of target cell surface.The costimulation of CD28 can promote the proliferation of T cell, the synthesis of IL-2 and table Reach and enhance the ability that T cell resists apoptosis.Then occur the costimulations such as CD134 (OX40) and 41BB (4-1BB) point again Son to improve the cytotoxicity of T cell, proliferation activity, maintains t cell response, extends T cell time-to-live etc..Such Two generation CAR produce unexpected effect in subsequent clinical test, the clinical report based on second generation CAR from 2010 Road repeatedly causes vibrations, and especially for recurrent, intractable patient ALL, complete remission rate is up to more than 90%.

Third generation CAR signal peptides area integrates the costimulatory molecules of 2 or more, can be proliferated T cell continuous activation, cell Factor continuous release, the ability of T cell killing tumor cell is more notable, i.e., CAR of new generation can be obtained stronger antitumor Response [Mol Ther., 2005,12 (5)：933-941].Most typical is exactly U Pen Carl June in CD28 stimulating factors Under the action of added the stimulating factor of a 41BB again.

The CAR-T cells of forth generation then add cell factor or costimulation ligand, such as four generation CAR can generate IL- 12, the activation of immune microenvironment-increase T cell can be adjusted, while activate inherent immunity cell that it is made to play a role and come clearly Except the cancer cell of target antigen feminine gender, so as to have the function that bidirectional modulation [Expert Opin Biol Ther., 2015；15 (8)：1145-54].

At present, CAR-T immunization therapies are pessimistic in the clinical study results of solid tumor.First, exempt from due to tumor microenvironment Epidemic disease inhibition is unfavorable for the migration, field planting and Function of T cell；Second is that T cell heterozygosity is big, the CAR-T thus prepared The heterogeneous big and function of cell differs, and not only anti-tumor effect is impacted, also increases the risk for inducing toxicity.Although existing grind Study carefully and propose the composition by restricted T cells subgroup to promote the anti-tumor function of CAR-T cells, but these CAR-T cells exist Internal survival and the ability of infiltration tumor tissues are still limited.

Natural killer T (natural killer T, NKT) cell is a kind of mediation congenital immunity and acquired immunity Special lymphocyte, it is considered to be and the 4th quasi-lymphocyte [Nat Rev Immunol., 2010；10:272-277].It simultaneously table Up to T cell and NK cell surface molecule marks, biological characteristics of both T cell and NK cells are shown.According to connecing at present The systematic nomenclature received can be divided into I types, II types and type III NKT cells, each has different functional characters.I types NKT is thin Born of the same parents, i.e. iNKT (invariant natural killer T, iNKT) cell is considered as classical NKT cells.INKT cells Express constant TCR α chains (mouse is TCRV 14~J of α α 18,24~J of artificial TCRV α α 18), constant TCR α chains and TCR β chains Pairing be multifarious, but compared with the TCR β chains of the restricted T cells of traditional MHC, changeability is limited.INKT cells are known Not by the lipid antigen of the CD1d molecule submissions of non-polymorphism, wherein α GalCer are the classical antigen for activating iNKT cells.iNKT A large amount of cell factor can be secreted rapidly after cells by antigen stimulation, inherent immunity and adaptive immunity are adjusted, in the anti-sense of body It plays a significant role in terms of dye, tumour and autoimmunity disease.

Research shows that it is moved under the chemotactic factor (CF) induction that iNKT cells can be generated in tumour cell and tumor-associated macrophage Tumor tissues are moved to, tumour cell can not only be killed, tumor-associated macrophage can be also acted on by CD1d dependences, are killed This kind of rush tumour growth cell or inhibit its promote tumour function [J Clin Invest., 2012；122:2221-2233].

Since the acceptor portion of iNKT cells is relative constant.INKT cells once identify sugared lipid antigen α The cell factor that will generate high concentration after GalCer activation, it is inevitable that iNKT cells, which participate in various immunological regulation,.It is true Upper α GalCer inherently anti-tumor agents.The NKT cells of α GalCer activation cooperate with IL-12 to those in lungs and liver Metastatic carcinoma plays important lethal effect.On the other hand, after using α GalCer, NKT cells are activated.NKT cells after activation are released The IFN-γ of amplification quantity；IFN-γ has activated internal NK cells again.Due to having transferred the tumor effect that kills of NK cells, Jin Erda The purpose of control tumour is arrived.The cell and molecular mechanism of α GalCer inducing antitumors further comprise up-regulation CD40L and cell toxicant The expression of property molecule.The CD40L of NKT cell surfaces has activated the CD40 of DC cell surfaces, and DC cells is caused to generate IL-12.DC The IL-12 of cell secretion has activated NKT cells again.NKT cells after activation generate IFN-γ.And to activate NK thin for IFN-γ The cytotoxic cell of born of the same parents and CD8+ (CTL), so as to mediate antitumor action [Cancer Sci., 2006,97 (9):807- 812].INKT cells are present in the intermediate state of natural immunity and acquired immunity.Participate in various immune responses.As exempting from For the new technology of epidemic disease treatment, iNKT cell very attractives.Simultaneously as the non-polymorphism of CD1d molecules, iNKT cells exist Self or even allosome genotoxic potential is substantially reduced compared to T cell.So CAR-iNKT cellular immunotherapies have huge answer Use space.

The iNKT cells of the Chimeric antigen receptor modification of patent targeting CD19 of the present invention, external function test are shown well Function, be that it will be applied to commercialization process of clinical trial or allosome CAR-iNKT cells and lay a good foundation from now on.

Invention content

First aspect present invention provides a kind of polynucleotide sequence, and the polynucleotide sequence is selected from：

(1) coded sequence, the coded sequence of people's CD8 α hinge areas containing sequentially connected anti-CD19 single-chain antibodies, people The coded sequence of CD8 transmembrane regions, the coded sequence of people's 41BB intracellular regions, people's CD3 ζ intracellular regions coded sequence；With

(2) complementary series of (1) described polynucleotide sequence.

In one or more embodiments, the polynucleotide sequence is in the coded sequence of the anti-CD19 single-chain antibodies The preceding also coded sequence containing signal peptide.In one or more embodiments, the amino acid sequence such as SEQ of the signal peptide ID NO:Shown in 2 1-21 amino acids.In one or more embodiments, the light chain variable of the anti-CD19 single-chain antibodies The amino acid sequence in area such as SEQ ID NO:Shown in 2 22-128 amino acids.It is described anti-in one or more embodiments The amino acid sequence of the heavy chain variable region of CD19 single-chain antibodies such as SEQ ID NO:Shown in 2 144-263 amino acids.At one Or in multiple embodiments, the amino acid sequence such as SEQ ID NO of the people CD8 α hinge areas:2 264-310 amino acids institutes Show.In one or more embodiments, the amino acid sequence such as SEQ ID NO of the people CD8 transmembrane regions:2 311-332 Shown in amino acid.In one or more embodiments, the amino acid sequence such as SEQ ID NO of the people 41BB intracellular regions:2 Shown in 333-380 amino acids.In one or more embodiments, the amino acid sequence such as SEQ of the people CD3 ζ intracellular regions ID NO:Shown in 2 381-491 amino acids.

In one or more embodiments, the signal peptide before the coded sequence of the anti-CD19 single-chain antibodies Coded sequence such as SEQ ID NO:Shown in 1 1-63 nucleotide sequences.In one or more embodiments, the anti-CD19 The coded sequence of the light chain variable region of single-chain antibody such as SEQ ID NO:Shown in 1 64-384 nucleotide sequences.At one or In multiple embodiments, the coded sequence such as SEQ ID NO of the heavy chain variable region of the anti-CD19 single-chain antibodies:1 430-789 Shown in the nucleotide sequence of position.In one or more embodiments, the coded sequence such as SEQ ID of the people CD8 α hinge areas NO:Shown in 1 790-930 nucleotide sequences.In one or more embodiments, the code sequence of the people CD8 transmembrane regions Row such as SEQ ID NO:Shown in 1 931-996 nucleotide sequences.In one or more embodiments, the people 41BB born of the same parents The coded sequence of inner region such as SEQ ID NO:Shown in 1 997-1140 nucleotide sequences.In one or more embodiments, The coded sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:Shown in 1 1144-1476 nucleotide sequences.

Second aspect of the present invention provides a kind of fusion protein, and the fusion protein is selected from：

(1) containing sequentially connected anti-CD19 single-chain antibodies, people CD8 α hinge areas, people CD8 transmembrane regions, people's 41BB intracellular regions With the fusion protein of people's CD3 ζ intracellular regions；With

(2) it lives in the amino acid sequence limited in (1) by replacing, lacking or add one or several amino acid and retain Change the fusion protein as derived from (1) of iNKT cell activity；

Preferably, the anti-CD19 single-chain antibodies are anti-CD19 monoclonal antibodies FMC63.

In one or more embodiments, the fusion protein also contains letter in the N-terminal of the anti-CD19 single-chain antibodies Number peptide.In one or more embodiments, the amino acid sequence such as SEQ ID NO of the signal peptide:2 1-21 amino acids It is shown.In one or more embodiments, the amino acid sequence such as SEQ of the light chain variable region of the anti-CD19 single-chain antibodies ID NO:Shown in 1 22-132 amino acids.In one or more embodiments, the heavy chain of the anti-CD19 single-chain antibodies can The amino acid sequence for becoming area can be such as SEQ ID NO:Shown in 1 148-264 amino acids.In one or more embodiments, The amino acid sequence such as SEQ ID NO of the people CD8 α hinge areas:Shown in 1 265-311 amino acids.One or more real It applies in scheme, the amino acid sequence such as SEQ ID NO of the people CD8 transmembrane regions:Shown in 1 312-333 amino acids.At one Or in multiple embodiments, the amino acid sequence such as SEQ ID NO of the people 41BB intracellular regions:1 334-381 amino acids institute Show.In one or more embodiments, the amino acid sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:1 382-492 Shown in amino acids.

Third aspect present invention provides a kind of nucleic acid constructs, and the nucleic acid constructs contains polynucleotides as described herein Sequence.

In one or more embodiments, the nucleic acid constructs is carrier.In one or more embodiments, institute Nucleic acid constructs is stated as retroviral vector, contains replication origin, 3 ' LTR, 5 ' LTR, polynucleotides as described herein Sequence and optional selectable label.

Fourth aspect present invention provides a kind of retrovirus, and the retrovirus contains nucleic acid construct as described herein Object preferably comprises the carrier, further preferably described retroviral vector.

Fifth aspect present invention provides a kind of iNKT cells of genetic modification, and the cell contains multinuclear glycosides as described herein Acid sequence containing nucleic acid constructs as described herein or has infected retrovirus as described herein.

Sixth aspect present invention provides a kind of pharmaceutical composition of the iNKT cells containing genetic modification as described herein.

Seventh aspect present invention offer polynucleotide sequence as described herein, fusion protein, nucleic acid constructs or reverse transcription Application of the virus in the iNKT cells for preparing activation.

The eighth aspect of the invention is genetic modification iNKT cell activations method and training method and its application

The 9th aspect offer of present invention polynucleotide sequence as described herein, fusion protein, nucleic acid constructs, reverse transcription Use of the INKT cells or its pharmaceutical composition of virus or genetic modification in the drug of disease for the treatment of CD19 mediations is prepared On the way.

In one or more embodiments, the disease of the CD19 mediations is leukaemia, lymthoma.

Description of the drawings

Fig. 1 is CD19-CAR retrovirus expression vectors (CD19-BBz) schematic diagram.SP：Signal peptide；VL：Light chain variable Area；Lk：Connector (G₄S)₃；VH：Heavy chain variable region；H：CD8 α hinge areas；TM：CD8 transmembrane regions.

Fig. 2 is the part sequencing result peak value figure of CD19-CAR retrovirus expression vectors (CD19-BBz).

Fig. 3 retroviral infection iNKT cells are after 5 days, the CAR positive rates of FCM results show iNKT cells.

Fig. 4 is the secretion for the 5 hours IL-2 of CD9CAR iNKT and target cell co-cultivation for preparing 14 days.

Fig. 5 is the secretion for the 5 hours INF γ of CD19CAR iNKT and target cell co-cultivation for preparing 14 days.

Fig. 6 is the killing to tumour cell after the CD19CAR iNKT cells of preparation 14 days co-culture 4 hours with target cell Effect.

Specific embodiment

The present invention provides a kind of Chimeric antigen receptor (CAR) for targeting CD19.It is mono- that the CAR contains sequentially connected anti-CD19 Chain antibody, people CD8 α hinge areas, people CD8 transmembrane regions, people 41BB intracellular regions, people's CD3 ζ intracellular regions segment.

Various anti-CD19 monoclonal antibodies well known in the art can be derived from by being suitable for the invention anti-CD19 single-chain antibodies.

Optionally, the light chain variable region and heavy chain variable region can be linked together by joint sequence.Can illustrate this Class single-chain antibody includes but not limited to FMC63, SJ25C1.In certain embodiments, the monoclonal antibody is that clone number is The monoclonal antibody of FMC63.In certain embodiments, the amino acid sequence of the light chain variable region of the anti-CD19 single-chain antibodies Such as SEQ ID NO:Shown in 2 22-128 amino acids residues.In other embodiments, the anti-CD19 single-chain antibodies The amino acid sequence of heavy chain variable region such as SEQ ID NO:Shown in 2 144-263 amino acids residues.

The amino acid sequence for being suitable for the invention people's CD8 α hinge areas can be such as SEQ ID NO:2 264-310 bit aminos Shown in acid.

It can be commonly used in the art in the various people CD8 transmembrane domains of CAR to be suitable for the invention people CD8 transmembrane regions. In certain embodiments, the amino acid sequence of the people CD8 transmembrane regions such as SEQ ID NO:2 311-332 amino acids institutes Show.

It can be the various 41BB for CAR known in the art to be suitable for the invention 41BB.As illustrative example, The present invention uses SEQ ID NO:41BB shown in 2 333-380 amino acids sequences.

It can be various people CD3 ζ intracellular regions of this field conventionally used for CAR to be suitable for the invention people's CD3 ζ intracellular regions. In certain embodiments, the amino acid sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:2 381-491 amino acids institutes Show.

The each part mentioned above of the fusion protein of the present invention is formed, such as the light chain variable region of anti-CD19 single-chain antibodies and heavy chain can Become area, people CD8 α hinge areas, people CD8 transmembrane regions, 41BB and people's CD3 ζ intracellular regions etc., can be directly connected between each other, Huo Zheke It is connected by joint sequence.Joint sequence can be the joint sequence suitable for antibody well known in the art, such as containing G's and S Joint sequence.In general, connector contains the front and rear motif repeated of one or more.For example, the motif can be GGGS, GGGGS, SSSSG, GSGSA and GGSGG.Preferably, which is adjacent in joint sequence, and amino acid is not inserted between repetition Residue.Joint sequence can include 1,2,3,4 or 5 repetition motif and form.The length of connector can be that 3~25 amino acid are residual Base, such as 3~15,5~15,10~20 amino acid residues.In certain embodiments, joint sequence is more glycine linlcers Sequence.The quantity of glycine is not particularly limited in joint sequence, usually 2~20, such as 2~15,2~10,2~8.It removes Glycine and serine come, also containing other known amino acid residue in connector, such as alanine (A), leucine (L), Threonine (T), glutamic acid (E), phenylalanine (F), arginine (R), glutamine (Q) etc..As an example, connector can be by SEQ ID NO:Any amino acid sequence composition in 7-18.In certain embodiments, the light chain of the anti-CD19 single-chain antibodies of the present invention can Become between area and heavy chain variable region by (GGGGS)_nConnection, wherein n are 1~5 integer.

It should be understood that in gene cloning operation, it is often necessary to design suitable restriction enzyme site, this certainly will be in expressed ammonia Base acid sequence end introduces one or more incoherent residues, and this has no effect on the activity of aim sequence.In order to build Fusion protein, the expression for promoting recombinant protein obtain the automatic recombinant protein being secreted into outside host cell or conducive to recombinant protein Purifying, it is often necessary to it is other suitable in the N- ends of recombinant protein, C- ends or the albumen to be added to some amino acid In region, it may for example comprise but be not limited to, suitable joint peptide, signal peptide, leader peptide, end extension etc..Therefore, it is of the invention The aminoterminal or c-terminus of fusion protein (i.e. described CAR) can also contain one or more polypeptide fragments, as protein tag.Appoint What suitable label may be used to herein.For example, the label can be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7,4A6, ε, B, gE and Ty1.These labels can be used for carrying out albumen pure Change.

The present invention also includes SEQ ID NO:Shown in the CAR shown in CAR sequences shown in 2 22-491 amino acids sequences CAR mutant.These mutant include：Have at least 80% with the CAR, preferably at least 85%, preferably at least 90% are excellent Choosing at least 95%, preferably at least 97% sequence identity and retain the CAR biological activity (as activation iNKT cells) Amino acid sequence.The sequence identity between the sequence of BLASTp two comparisons of calculating of such as NCBI can be used.

Mutant further includes：In SEQ ID NO:2 amino acid sequences shown in 22-491, shown in 1-491 In amino acid sequence there are one or several mutation (insertion, deletion or substitution) while still retain the biological activity of the CAR Amino acid sequence.Several mutation are often referred within 1-10, such as 1-8,1-5 or 1-3.Substitution is preferred It is conservative replaces.For example, in the art, when carrying out conservative replaces with amino acid with similar or analogous performance, usually not The function of protein or polypeptide can be changed." amino acid with similar or analogous performance " is including for example, the amino with similar side chain The family of sour residue, these families include the amino acid (such as lysine, arginine, histidine) with basic side chain, with The amino acid (such as aspartic acid, glutamic acid) of acid side-chain, amino acid (such as the sweet ammonia with uncharged polar side chain Acid, asparagine, glutamine, serine, threonine, tyrosine, cysteine), have non-polar sidechain amino acid (example Such as alanine, valine, leucine, isoleucine proline, phenylalanine, methionine, tryptophan), have β-branch side The amino acid (such as threonine, valine, isoleucine) of chain and amino acid (such as tyrosine, phenylpropyl alcohol with aromatic side chain Propylhomoserin, tryptophan, histidine).Therefore, in polypeptide of the present invention one is replaced with another amino acid residue from the same side chain class A or several sites, will not be in substantially influences its activity.

The present invention includes encoding the polynucleotide sequence of fusion protein of the present invention.The present invention polynucleotide sequence can be DNA form or rna form.DNA form includes cDNA, genomic DNA or artificial synthesized DNA.DNA can be it is single-stranded or Double-strand.DNA can be coding strand or noncoding strand.The present invention also includes the degeneracy of the polynucleotide sequence of encoding fusion protein Variant encodes identical amino acid sequence but the different nucleotide sequence of nucleotide sequence.

Polynucleotide sequence as described herein can usually use PCR amplification method to obtain.It specifically, can be public according to institute herein The nucleotide sequence opened, especially open reading frame sequence design primer, and with commercially available cDNA libraries or by art technology CDNA libraries prepared by conventional method known to personnel expand as template and obtain related sequence.When sequence is longer, usually need It carries out twice or multiple PCR amplification, the segment for then again amplifying each time is stitched together by proper order.For example, In certain embodiments, the polynucleotide sequence such as SEQ ID NO of fusion protein described herein are encoded:1 64-1473 cores Shown in thuja acid or such as SEQ ID NO:Shown in 1 1-1473 nucleotide.

Regulating and controlling sequence can be suitable promoter sequence.Promoter sequence is usually grasped with the coded sequence of albumen to be expressed The property made connection.Promoter can be that any nucleotide sequence of transcriptional activity is shown in selected host cell, including prominent Become, truncated and hybrid promoter, and can be from coding and the homologous or heterologous extracellular or intracellular polypeptide of the host cell Gene obtain.Regulating and controlling sequence can also be suitable transcription terminator sequences, and the sequence to terminate transcription is identified by host cell Row.3 ' end effectors of nucleotide sequence of the terminator sequence with encoding the polypeptide are connect.Have in the host cell of selection Any terminator of function can be used in the present invention.Regulating and controlling sequence can also be suitable targeting sequencing, to host cell translation The non-translational region of important mRNA.5 ' ends of nucleotide sequence of the targeting sequencing with encoding the polypeptide are operatively connected.It is selecting Functional any terminator can be used in the present invention in the host cell selected.

In certain embodiments, the nucleic acid constructs is carrier.Usually pass through the more of the present invention that are operably connected Nucleotide sequence is incorporated to expression vector to promoter, and by construct, realizes the expression of polynucleotide sequence of the present invention.The carrier Can be suitable for replicating and integrating eukaryocyte.Typical cloning vector, which includes to can be used for adjusting, it is expected nucleic acid sequence expression Transcription and translation terminator, homing sequence and promoter.

The polynucleotide sequence of the present invention can be cloned into the carrier of many types.For example, plasmid, phagocytosis can be cloned into Grain, phage-derived object, animal virus and clay.Further, carrier is expression vector.Expression vector can be with viral vectors Form is supplied to cell.Viral vector technology be well known in the present art and such as Sambrook etc. (2001, Molecular Cloning:A Laboratory Manual, Cold Spring Harbor Laboratory, New York) It is described in other virology and molecular biology manual.The virus that can be used as carrier includes but not limited to reverse transcription disease Poison, adenovirus, adeno-associated virus, herpesviral and slow virus.

In general, suitable carrier is included in the replication orgin to work at least one organism, promoter sequence, conveniently Restriction enzyme sites and one or more selectable label (for example, WO 01/96584；WO01/29058；And U.S. Patent number 6,326,193)。

For example, in certain embodiments, using retroviral vector, which contains multiple the present invention Initiation site processed, 3 ' LTR, 5 ' LTR, polynucleotide sequence as described herein and optional selectable label.

One example of suitable promoter is instant early stage cytomegalovirus (CMV) promoter sequence.The promoter sequence Row are can to drive the strong constitutive promoter sequence for being operably coupled to any polynucleotide sequence high level expression thereon Row.Another example of suitable promoter is -1 α of the elongation growth factor (EF-1 α).It is also possible, however, to use other composing types open Promoter sequences, including but not limited to simian virus 40 (SV40) early promoter, mouse mammary cancer viral (MMTV), people are immunized scarce It is instant to fall into long end repetition (LTR) promoter of virus (HIV), MoMuLV promoters, avian leukosis virus promoter, Epstein-Barr virus Early promoter, Rous sarcoma virus promoter and people's gene promoter, such as, but not limited to actin promoter, Myosin promoter, ferroheme promoter and creatine kinase promoter.Further, it also contemplates for starting using induction type Son.The use of inducible promoter provides molecular switch, and the induction type that is operably connected can be opened when expressing in the time limit The expression of the polynucleotide sequence of promoter, and closing expression when expression is undesirable.The example of inducible promoter Including but not limited to metallothionein promoter, Glucocorticoid promoter, progesterone promoter and tetracycline promoter.

In order to assess the expression of CAR polypeptides or part thereof, being introduced into the expression vector of cell also may include selectable mark Any one in gene or reporter or both is remembered, in order to from the cell mass sought to be transfected by viral vectors or infected Middle identification and selection expression cell.In other respects, selectable label can be carried on independent section of DNA and for corotation Contaminate program.The flank of selectable label and both reporters can all have appropriate regulatory sequence, so as in host It is expressed in cell.Useful selectable marker includes such as antibiotics resistance gene, such as neo etc..

Reporter is used to identify the cell of potential transfection and the functionality for evaluating regulatory sequence.DNA by After introducing recipient cell, the expression of reporter is measured under the suitable time.Suitable reporter may include encoding Luciferase, beta galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase or Green Fluorescent Protein gene base Cause.Suitable expression system is well known and prepares using known technology or commercially obtain.

The method that gene is introduced cell and gene expression is entered to cell is well known in the art.Carrier can by Any method in this field is easily introduced into host cell, for example, mammal, bacterium, yeast or insect cell.For example, Expression vector can be transferred to host cell by physics, chemistry or biological means.

The physical method that polynucleotides are introduced to host cell includes calcium phosphate precipitation, lipofection, particle bombardment, micro- Injection, electroporation etc..The biological method that interested polynucleotides are introduced to host cell includes the use of DNA and RNA loads Body.The chemical means that polynucleotides are introduced to host cell include dispersion system of colloid, such as macromolecular complex, nanometre glue Capsule, microballoon, pearl；With the system based on lipid, including oil in water emulsion, micella, mixed micelle and liposome.

The biological method that polynucleotides are introduced to host cell includes the use of viral vectors, particularly retrovirus vector Body, this has become the most widely used method that gene is inserted into mammal such as people's cell.Other viral vectors can source From slow virus, poxvirus, herpes simplex virus I, adenovirus and adeno-associated virus etc..Many has been developed based on virus System, for gene transfer to be entered mammalian cell.For example, retrovirus provides the convenience for gene delivery system Platform.By the gene insertion vector of selection and retroviral particle is packaged into using technology as known in the art.It should Recombinant virus then can be detached and be transferred in vivo or in vitro subject cell.Many retroviral systems are in the art It is known.In some embodiments, using adenovirus vector.Many adenovirus vectors are well known in the art. In one embodiment, slow virus carrier is used.

Therefore, in certain embodiments, the present invention also provides for activating the retrovirus of iNKT cells, the virus Containing retroviral vector as described herein and corresponding packaging gene, such as gag, pol and vsvg.

It is suitable for the invention various types of iNKT cells that iNKT cells can be various sources.For example, iNKT is thin Born of the same parents can derive from the PBMC of B cell malignant tumor patient.

It in certain embodiments, can be first with suitable (such as 3~8 μ g/ml, such as 5 μ g/ml) after obtaining iNKT cells α Galcer stimulation activation, then containing suitable (such as 30~80IU/ml, such as 50IU/ml) IL2 culture mediums carry out It cultivates spare.

Therefore, in certain embodiments, the present invention provides a kind of iNKT cells of genetic modification, the genetic modification INKT cells contain polynucleotide sequence as described herein or containing retroviral vector as described herein or have infected this Retrovirus or use method described herein described in text, which are prepared or stablize, expresses fusion protein as described herein.

The CAR-iNKT cells of the present invention can undergo firm internal iNKT Cell expansions and in blood and marrow with height The extended time quantum of persistent levels, and form specific memory iNKT cells.It is not intended to be fettered by any specific theory, Encounter and then eliminate expression Surrogate antigen target cell after, CAR-iNKT cells of the invention can differentiation in vivo into center remember Sample state.

The anti-tumor immune response as caused by CAR-iNKT cells can be active or passive immunity response.In addition, CAR is mediated Immune response can be adoptive immunotherapy step a part, wherein CAR-iNKT cells induction to the antigen binding in CAR The immune response of part specificity.

Therefore, CAR, its coded sequence, nucleic acid constructs, expression vector, virus and the CAR- of the present invention can be used The disease of iNKT cell therapies is preferably the disease of CD19 mediations.

The iNKT cells of the CAR- modifications of the present invention can be administered alone or as pharmaceutical composition and diluent and/or with Such as relevant cell factor of other components or cell mass combine application.Briefly, pharmaceutical composition of the invention may include CAR-iNKT cells as described herein, with one or more pharmacy or physiologically acceptable carriers, diluent or excipient With reference to.Such composition may include buffer solution such as neutral buffered saline, sulfate buffered saline etc.；Carbohydrate is all Such as glucose, mannose, sucrose or glucan, mannitol；Protein；Polypeptide or amino acid such as glycine；Antioxidant；Chela Mixture such as EDTA or glutathione；Adjuvant (for example, aluminium hydroxide)；And preservative.

The mode that the pharmaceutical composition of the present invention can be suitable for the disease of (or prevention) to be treated is applied.The quantity of application It will be determined with frequency by such factor, such as the illness of patient and the type of patient disease and severity.

When pointing out " effective quantity in immunology ", " antitumor effective quantity ", " tumour-inhibition effective quantity " or " therapeutic dose ", The precise volume of the present composition to be administered can be determined that the age of consideration patient (object), weight, tumour are big by doctor Small, infection or the individual difference of metastasis degree and illness.It can usually point out：Include the pharmaceutical composition of iNKT cells described herein Object can be with 10⁴To 10⁹The dosage of a cell/kg weight, preferably 10⁵To 10⁶The dosage of a cell/kg weight.INKT groups of cells Closing object can also be with these dosage multiple applications.Cell can be by using injection technique well known in immunotherapy (see for example Rosenberg etc., New Eng.J.of Med.319:1676,1988) it applies.Optimal dose and treatment for specific patient Scheme can be by monitoring the disease indication of patient and therefore adjustment for the treatment of is readily determined by medical domain technical staff.

The application of object composition object can carry out in any convenient manner, including by spray-on process, inject, swallow, defeated Liquid, implantation or transplanting.Compositions described herein can by subcutaneous, intradermal, knurl, in knot, in spinal cord, intramuscular, pass through vein Patient is administered in interior injection or peritonaeum.In one embodiment, iNKT cell compositions of the invention pass through intradermal or skin Lower injection is administered to patient.In another embodiment, iNKT cell compositions of the invention preferably pass through intravenous injection Using.The composition of iNKT cells can be injected directly into tumour, lymph node or infection position.

In some embodiments of the present invention, CAR-iNKT cell or combinations object of the invention can with it is known in the art Other therapies combine.The therapy includes but not limited to chemotherapy, radiotherapy and immunosuppressor.For example, this field week can be combined The radiotherapy for the disease for the treatment of CD19 mediations known or chemotheraping preparation are treated.

Herein, " anti-tumor effect " refers to a kind of biological effect, can be by the reduction of gross tumor volume, tumor cell number Reduction, the increase of life expectancy or the improvement expression with the relevant various physiological signs of cancer reduce, shifted number.

" patient ", " object ", " individual " etc. are used interchangeably herein, and referring to can cause the work of immune response organic Body, such as mammal.Example includes but not limited to people, dog, cat, mouse, rat and its genetically modified organism.

Gene order of the invention using anti-CD 19 antibodies (scFV for being specifically derived from clone FMC63), and from The CD8 α hinge areas of people, the CD8 transmembrane regions of people, the 41BB intracellular regions of people and people are searched in NCBI GenBank databases CD3 ζ intracellular region gene sequence informations, the anti-CD19scFv-CD8 hinge areas-CD8TM-41BB- of full genome synthesis Chimeric antigen receptor The genetic fragment of CD3 ζ, is inserted into retroviral vector.Recombinant plasmid packaging virus in 293T cells, infection iNKT are thin Born of the same parents make iNKT cells express the Chimeric antigen receptor.The present invention realizes turning for the iNKT cells of Chimeric antigen receptor genetic modification Change method is based on Retroviral Transformation method.This method has transformation efficiency high, and foreign gene can stablize expression, and can To shorten the advantages that in vitro culture iNKT cells reach the time of clinical number of stages.In transgenosis iNKT cell surfaces, conversion Nucleic acid by transcription, accurate translation on it.CAR-iNKT cells prepared by the present invention have specific tumor cell strong Killing ability, in the case that effect target ratio is 10 to 1, killing-efficiency is more than 65%.

The present invention is described in further detail by reference to following EXPERIMENTAL EXAMPLE.These embodiments are merely for explanation Property purpose provide, be not intended to it is restricted, unless otherwise prescribed.Therefore, the present invention should not be interpreted in any way as being limited to Lower embodiment, but should be interpreted as including due to provided herein is introduction will become apparent from any and whole variation. Method used in embodiment and reagent, unless otherwise stated, method and reagent for this field routine.

Embodiment 1：CD19scFv-CD8 α -41BB-CD3 ζ gene orders determine

The CD3 ζ intracellulars of the CD8 transmembrane regions of the people of people, the 41BB intracellular regions of people and people are searched from NCBI site databases Area's gene sequence information, anti-CD19 single-chain antibodies clone number is FMC63, these sequences are in website http:// Codon optimization is carried out on sg.idtdna.com/site, ensures to be more suitable for the mankind in the case where encoding amino acid sequence is constant Cell is expressed.

Using over-lap PCR by above-mentioned sequence successively by anti-CD19scFv, people's CD8 α hinge areas gene, people's CD8 transmembrane region bases Cause, people's 41BB intracellular regions gene, people's CD3 ζ intracellular region gene orders are attached, and different digestion positions are introduced in each sequence junction Point forms complete CD19-CAR gene orders.

With the nucleotide sequence of NotI (NEB) and EcoRI (NEB) double digestion the CAR molecules, connect through T4 ligases (NEB) The NotI-EcoRI sites into retrovirus MSCV (Addgene) are patched, are transformed into competence Escherichia coli (DH5 α).

Recombinant plasmid is served Hai Sheng works Bioisystech Co., Ltd be sequenced, by sequencing result and be fitted to MCD19-CAR sequence alignments verify whether sequence is correct.Sequencing primer is：

Justice:AGCATCGTTCTGTGTTGTCTC

Antisense:TGTTTGTCTTGTGGCAATACAC

After being sequenced correctly, simultaneously plasmid purification is extracted using the plasmid purification kit of Qiagen companies, plasmid purification Plasmid calcium phosphate method transfection 293T cells carry out retrovirus Packaging experimentation.

The plasmid map obtained constructed by the present embodiment is as shown in Figure 1.Fig. 2 shows the portion of the retrovirus expression plasmid Divide sequencing result peak value figure.

Embodiment 2：Retrovirus is packed

1. 293T cells should be less than for 20 generations in the 1st day, do not cover with excessively.With 0.6*10^6cells/ml bed boards, 10cm Ware adds the DMEM culture mediums of 10ml, abundant mixing cell, 37 degree of overnight incubations.

It is transfected (being typically bed board 14-18h or so) 2. the 2nd day 293T cell fusion degree reaches 90% or so；Prepare Plasmid composite, it is 12.5ug, Gag-pol 10ug, VSVg 6.25ug that the amounts of various plasmids, which is Retro backbone, CaCl₂250ul, H₂O is that 1ml total volumes are 1.25ml；Addition is with the isometric HBS of plasmid composite, side in another pipe Plasmid composite side is added to be vortexed and shakes 20s.Softly mixture is added to along side in 293T wares, 37 degree of culture 4h, removal Culture medium, PBS are washed one time, rejoin the fresh culture of preheating.

3. the 4th day：Packing is stored in -80 degree after supernatant is collected after transfection 48h and is filtered with 0.45um filters, continues to add The fresh DMEM medium of preheating.

Embodiment 3：The activation of iNKT cells

1. it after detaching PBMC, is obtained using the iNKT sorting kits (Cat.130-091-221) of Miltenyi Biotec INKT cells are resuspended in iNKT culture mediums [X-VIVO^M15 (LONZA)+1% dual anti-(GIBCO)+1%GlutaMax (GIBCO)+ 1%HEPES (GIBCO)+2%N acetyl-cysteine (U.S. human relations biology)+5% goes out human AB serum (GEMINI)+200IU/ml IL-2 (the double aigrets in Beijing)].

2. taking the PBMC after 40Gy gamma-ray irradiations, iNKT culture mediums are resuspended in after centrifugation and cell are resuspended, and add 5 μ g/ After mixing, cell is put to 37 DEG C, 2h is pre-processed in the incubator of 5%CO2 by the α Galcer (Avanti) of ml.

3. after pretreatment, by iNKT：PBMC=1 after gamma-ray irradiation:5 quantity is put to 37 DEG C, 5%CO2 than mixing Incubator in cultivate, every other day add IL-2, a concentration of 200IU/ml of addition.

4. after 10 days, re-activation is carried out to iNKT cells according to same operating method.

Embodiment 4：Retroviral infection iNKT cells

1. the 2nd day after iNKT cell re-activation cultures, PBS is diluted to the Retronectin of final concentration of 15 μ g/ml (Takara) non-tissue treated culture plates are coated with, 24 orifice plates are per 250 μ l of hole.It is protected from light, 4 DEG C spare overnight.

2. the 3rd day after iNKT cell re-activation cultures, taking out 24 orifice plates being coated with, coating buffer is abandoned in suction, and addition contains HBSS (LIFE) room temperature closing 30min of 2%BSA (Excell).Confining liquid volume is per 500 μ l of hole, and confining liquid is abandoned in suction, with containing The HBSS board-washings of 2.5%HEPES are twice.

3. in virus liquid adding hole, 2ml virus liquids are added per hole, 32 DEG C, 2000g, centrifuge 2h.

4. discarding supernatant liquid, 24 orifice plates add in the iNKT cells 5 × 10 after activation per hole⁵It is a, volume 1ml, culture medium INKT culture mediums, centrifuge 10min by 30 DEG C, 1000g.

5. after centrifugation, culture plate is placed in 37 DEG C, is cultivated in 5%CO2 incubators.

6. after infection for 24 hours, cell suspension is sucked out, 1500rpm, 4 DEG C, 5min is centrifuged.

7. after cell infection, the density of cell is observed daily, iNKT culture mediums is added in due course, ties up the density of iNKT cells It holds 5 × 10⁵/ ml or so, expands cell.

8. thus to obtain the CAR-iNKT cells of CD19-41BB-CAR retrovirus have been infected, CD19CAR- is named INKT cells.

Embodiment 5：The ratio of iNKT cells and the expression of surface C AR albumen after flow cytomery infection

The CAR-iNKT cells of 72 hours and NT-iNKT cells (control group) after infecting, PBS washings 1 are collected by centrifugation respectively Supernatant is abandoned after secondary, PBS after corresponding antibody is protected from light 30min is added in and washs, be resuspended, last flow cytomery CAR positive rates. Antibody is anti-mouse IgG F (ab') antibody (Jackson Immunoresearch).

The present embodiment testing result is shown in Fig. 3, and for the ratio of iNKT cells more than 90%, purity is high；Use CD19- For 41BB-CAR retroviral infection iNKT cells after 120 hours, the ratio of CAR-iNKT cells is 65.8%.

Embodiment 6：IL-2 secretions detect after CAR-iNKT cells are co-cultured with target cell

1. taking the CAR-iNKT cells prepared, it is resuspended in Lonza culture mediums, adjustment cell concentration is 1 × 10⁶/mL。

2. experimental group contains target cell (Raji) or negative control cell (K562) 2 × 10 per hole⁵It is a, CAR-T cells 2 × 10⁵ It is a, 200 μ l Lonza culture mediums；It is added in 96 orifice plates after abundant mixing；BD GolgiPlug are added in simultaneously (containing BFA, per 1ml 1 μ l BD GolgiPlug are added in cell culture medium), after abundant mixing, 37 DEG C are incubated 5 hours；After incubation, collect thin Born of the same parents, as experimental group.

3. the PBS cleaning cells per effective 1mL, 300g carefully suck or outwell supernatant after centrifuging 5min.

After 4.PBS washes cell, 250 μ l/EP pipe Fixation/Permeabilization solution are added in, 4 DEG C incubate 20min is educated to fix cell and rupture of membranes；With 1 × BD Perm/Wash^TMBuffer cleanings cell 2 times, 1mL/ times.

5. carrying out intracellular factor dyeing, appropriate IL-2 cell factors fluorescence antibody or negative control are taken, with BD Perm/ Wash^TMBuffer is diluted to 50 μ l, and the cell for having fixed rupture of membranes is fully resuspended with this antibody diluent, and 4 DEG C are protected from light incubation 30min, 1 × BD Perm/Wash^TMThe cleaning cells 2 times of buffer 1mL/ times, are then resuspended with PBS.

6. flow cytomery

The present embodiment testing result is shown in Fig. 4, it is seen then that CD19-41BB-CAR-iNKT cells are in the K562 of CD19 feminine genders The percentage for secreting IL-2 under cytosis has 52.78% ((36.80%-2.49%)/CAR⁺Rate), CD19-41BB-CAR- INKT cells secreted under the Raji cytosiies of the CD19 positives IL-2 percentage have 75.08% ((52.5%-3.10%)/ CAR⁺Rate).

Embodiment 7：INF- γ secretions detect after CAR-iNKT cells are co-cultured with target cell

5. carrying out intracellular factor dyeing, appropriate IFN-γ cell factor fluorescence antibody or negative control are taken, with BD Perm/ Wash^TMBuffer is diluted to 50 μ l, and the cell for having fixed rupture of membranes is fully resuspended with this antibody diluent, and 4 DEG C are protected from light incubation 30min, 1 × BD Perm/Wash^TMThe cleaning cells 2 times of buffer 1mL/ times, are then resuspended with PBS.

6. flow cytomery

The present embodiment testing result is shown in Fig. 5, it is seen then that CD19-41BB-CAR-iNKT cells are in the K562 of CD19 feminine genders The percentage for secreting INF- γ under cytosis has 9.20% ((6.64%-0.60%)/CAR⁺Rate), CD19-41BB-CAR- The percentage that iNKT cells secrete INF- γ under the Raji cytosiies of the CD19 positives has 66.69% ((44.6%- 0.72%)/CAR⁺Rate).

Embodiment 8：CAR-iNKT cells detect tumor specific cell lethal effect after being co-cultured with target cell

1.K562 cells (being the negative control cell of target cell without CD19 target proteins) are resuspended in serum free medium (1640) in, adjustment cell concentration is 1 × 10⁶/ ml adds in fluorescent dye BMQC (2,3,6,7-tetrahydro-9- Bromomethyl-1H, 5Hquinolizino (9,1-gh) coumarin) to final concentration of 5 μM.

2. mixing, 37 DEG C of incubation 30min.

3. room temperature, 1500rpm centrifugation 5min, abandon supernatant, and cell is resuspended in cytotoxicity culture medium (without phenol red 1640+ 5%AB serum) in, 37 DEG C of incubation 60min.

4. twice of fresh cells toxicity culture medium cleaning cell, and be resuspended in fresh cells toxicity culture medium, density 1 × 10⁶/ml。

5.Raji cells (expression CD19 target proteins are target cell) are suspended in the PBS containing 0.1%BSA, adjust concentration It is 1 × 10⁶/ml。

6. fluorescein based dye CFSE (carboxyfluoresceindiacetatesuccinimidyl ester) is added in end A concentration of 1 μM.

7. mixing, 37 DEG C of incubation 10min.

8. it after being incubated, adds in and is reacted with the isometric FBS of cell suspension, incubation at room temperature 2min with end mark.

9. cleaning cell is simultaneously resuspended in fresh cells toxicity culture medium, density 1 × 10⁶/ml。

10. cleaning iNKT cells are simultaneously suspended in cytotoxicity culture medium, adjustment a concentration of 5 × 10⁶/ml。

11.CAR-iNKT and NT-iNKT, according to effector cell：Target cell=10:1、3:1、1:1 ratio, in 5ml without Bacterium developmental tube (BD Biosciences) is cultivated, every group of setting three wells.In each co-cultivation group, target cell Raji Cell 50,000 (50 μ l), 50,000 K562 cell (50 μ l) of negative control cell.One group of setting only includes simultaneously Raji target cells and K562 negative control cells.

12. co-cultured cell is placed in 37 DEG C of incubation 4h.

13. after the completion of being incubated, PBS cleaning cells, the concentration recommended to specifications immediately after rapidly joins 7-AAD (7-aminoactinomycin D), is incubated 30min on ice.

14. being not required to clean, machine testing in streaming is directly carried out, data are analyzed with Flow Jo.

15. analysis measures the Raji to live after iNKT cells and target cell co-cultivation using the living cells gating of 7AAD feminine genders Target cell and the ratio of K562 negative control cells living.

16. iNKT cells and target cell for each group of co-cultivation：

17. the target cell survival % of cytotoxic killer cell %=100- calibrations, i.e., (Raji lives thin during no effector cell Born of the same parents' number-when containing effector cell Raji viable counts)/K562 viable counts ratio.

The present embodiment testing result is shown in Fig. 6, is 10 in effect target ratio:In the case of 1, CD19-41BB-CAR-iNKT cells 65% is reached to the killing rate of the Raji cells of the CD19 positives.

Sequence table

<110>Shanghai Heng Run Da Sheng bio tech ltd

<120>A kind of culture CD19 CAR-iNKT cellular processes and purposes

<160> 1

<170> PatentIn version 3.3

<210> 1

<211> 1473

<212> DNA

<213>Artificial sequence

<400> 1

atggctctgc ctgtgaccgc cctgctgctg cctctggctc tgctgctgca cgccgctcgg 60

cctgacattc agatgactca gaccacaagc agcctcagtg cgagcctggg ggacagggtg 120

actatcagct gccgggccag ccaggacatt tccaagtacc tgaattggta ccagcagaag 180

cccgatggta ctgtgaaact cctgatatat catacttcta ggctccattc cggggttcca 240

agccgattca gtggctccgg ttccggtaca gattattccc tgaccattag caacttggaa 300

caggaggaca ttgcaacgta tttctgtcag caaggcaaca cattgcccta cacattcggg 360

ggcgggacta aactcgaaat aactggcggc gggggttctg gtggcggcgg cagcggcggt 420

ggaggatcag aagtgaagct gcaggaaagt ggccccgggc tggtagcccc aagtcagtcc 480

ctgagtgtaa cctgtacagt gagtggagtg tctcttcctg actacggggt aagttggatt 540

cggcaacctc cacgcaaggg cctggagtgg ctcggcgtga tttggggatc tgagacaact 600

tactacaatt ccgccctgaa gagcaggctg accatcatta aggacaatag caagtcacag 660

gtgtttctga agatgaactc actgcagacc gacgacaccg ccatctatta ctgcgccaaa 720

cattattatt atggcgggag ttatgctatg gactactggg gccagggcac tagcgtcacc 780

gtcagcagta ctacaactcc agcacccaga ccccctacac ctgctccaac tatcgcaagt 840

cagcccctgt cactgcgccc tgaagcctgt cgccctgctg ccgggggagc tgtgcatact 900

cggggactgg actttgcctg tgatatctac atctgggcgc ccttggccgg gacttgtggg 960

gtccttctcc tgtcactggt tatcaccctt tactgcaggt tcagtgtcgt gaagagaggc 1020

cggaagaagc tgctgtacat cttcaagcag cctttcatga ggcccgtgca gactacccag 1080

gaggaagatg gatgcagctg tagattccct gaagaggagg aaggaggctg tgagctgaga 1140

gtgaagttct cccgaagcgc agatgcccca gcctatcagc agggacagaa tcagctgtac 1200

aacgagctga acctgggaag acgggaggaa tacgatgtgc tggacaaaag gcggggcaga 1260

gatcctgaga tgggcggcaa accaagacgg aagaaccccc aggaaggtct gtataatgag 1320

ctgcagaaag acaagatggc tgaggcctac tcagaaatcg ggatgaaggg cgaaagaagg 1380

agaggaaaag gccacgacgg actgtaccag gggctgagta cagcaacaaa agacacctat 1440

gacgctctgc acatgcaggc tctgccacca aga 1473

<160> 1

<170> PatentIn version 3.3

<210> 2

<211> 491

<212> PRT

<213>Artificial sequence

<400> 2

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Asp Ile Gln Met Thr Gln Thr Thr Ser Ser Leu

20 25 30

Ser Ala Ser Leu Gly Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln

35 40 45

Asp Ile Ser Lys Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr

50 55 60

Val Lys Leu Leu Ile Tyr His Thr Ser Arg Leu His Ser Gly Val Pro

65 70 75 80

Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile

85 90 95

Ser Asn Leu Glu Gln Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln Gly

100 105 110

Asn Thr Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Thr

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu

130 135 140

Val Lys Leu Gln Glu Ser Gly Pro Gly Leu Val Ala Pro Ser Gln Ser

145 150 155 160

Leu Ser Val Thr Cys Thr Val Ser Gly Val Ser Leu Pro Asp Tyr Gly

165 170 175

Val Ser Trp Ile Arg Gln Pro Pro Arg Lys Gly Leu Glu Trp Leu Gly

180 185 190

Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys Ser

195 200 205

Arg Leu Thr Ile Ile Lys Asp Asn Ser Lys Ser Gln Val Phe Leu Lys

210 215 220

Met Asn Ser Leu Gln Thr Asp Asp Thr Ala Ile Tyr Tyr Cys Ala Lys

225 230 235 240

His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln Gly

245 250 255

Thr Ser Val Thr Val Ser Ser Thr Thr Thr Pro Ala Pro Arg Pro Pro

260 265 270

Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu

275 280 285

Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp

290 295 300

Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly

305 310 315 320

Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Arg Phe Ser Val

325 330 335

Val Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe

340 345 350

Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg

355 360 365

Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser

370 375 380

Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr

385 390 395 400

Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys

405 410 415

Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn

420 425 430

Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu

435 440 445

Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly

450 455 460

His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr

465 470 475 480

Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg

485 490

<210> 3

<211> 21

<212> DNA

<213>Artificial sequence

<220>

<223>Primer

<400> 3

agcatcgttc tgtgttgtct c 21

<210> 4

<211> 22

<212> DNA

<213>Artificial sequence

<220>

<223>Primer

<400> 4

tgtttgtctt gtggcaatac ac 22

<210> 7

<211> 21

<212> PRT

<213>Artificial sequence

<220>

<223>Joint sequence

<400> 5

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Leu

1 5 10 15

Gly Ser Thr Glu Phe

20

Claims

1. a kind of polynucleotide sequence, the polynucleotide sequence is selected from：

(1) coded sequence of coded sequence, people's CD8 α hinge areas containing sequentially connected anti-CD19 single-chain antibodies, people CD8 across The coded sequence in film area, the coded sequence of people's 41BB intracellular regions, the coded sequence of people's CD3 ζ intracellular regions and optional EGFR contain The polynucleotide sequence of the coded sequence of the segment of extracellular domain III and extracellular domain IV；With

(2) complementary series of (1) described polynucleotide sequence.

2. polynucleotide sequence as described in claim 1, which is characterized in that

The polynucleotide sequence also coded sequence containing signal peptide before the coded sequence of the anti-CD19 single-chain antibodies, it is excellent Selection of land, the amino acid sequence such as SEQ ID NO of the signal peptide:Shown in 2 1-21 amino acids；And/or

The amino acid sequence such as SEQ ID NO of the light chain variable region of the anti-CD19 single-chain antibodies:2 22-128 amino acids institutes Show；And/or

The amino acid sequence such as SEQ ID NO of the heavy chain variable region of the anti-CD19 single-chain antibodies:2 144-263 amino acids It is shown；And/or

The amino acid sequence such as SEQ ID NO of the people CD8 α hinge areas:Shown in 2 264-310 amino acids；And/or

The amino acid sequence of the people CD8 transmembrane regions such as SEQ ID NO:Shown in 2 311-332 amino acids；And/or

The amino acid sequence of the people 41BB intracellular regions such as SEQ ID NO:Shown in 2 333-380 amino acids；And/or

The amino acid sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:Shown in 2 381-491 amino acids.

3. polynucleotide sequence as claimed in claim 2, which is characterized in that

The coded sequence such as SEQ ID NO of the signal peptide before the coded sequence of the anti-CD19 single-chain antibodies:1 1-63 Shown in the nucleotide sequence of position；And/or

The coded sequence such as SEQ ID NO of the light chain variable region of the anti-CD19 single-chain antibodies:1 64-384 nucleotide sequences It is shown；And/or

The coded sequence such as SEQ ID NO of the heavy chain variable region of the anti-CD19 single-chain antibodies:1 430-789 nucleotides sequences Shown in row；And/or

The coded sequence such as SEQ ID NO of the people CD8 α hinge areas:Shown in 1 790-930 nucleotide sequences；And/or

The coded sequence of the people CD8 transmembrane regions such as SEQ ID NO:Shown in 1 931-996 nucleotide sequences；And/or

The coded sequence of the people 41BB intracellular regions such as SEQ ID NO:Shown in 1 997-1140 nucleotide sequences；And/or

The coded sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:Shown in 1 1141-1473 nucleotide sequences.

4. a kind of fusion protein, the fusion protein is selected from：

(1) containing sequentially connected anti-CD19 single-chain antibodies, people CD8 α hinge areas, people CD8 transmembrane regions, people 41BB intracellular regions and people The fusion protein coded sequence of CD3 ζ intracellular regions；With

(2) it is activated in the amino acid sequence limited in (1) by replacing, lacking or add one or several amino acid and retain The fusion protein as derived from (1) of INKT cell activity；

5. fusion protein as claimed in claim 4, which is characterized in that the fusion protein has following one or more special Sign：

The fusion protein also contains signal peptide in the N-terminal of the anti-CD19 single-chain antibodies, it is preferable that the amino of the signal peptide Acid sequence such as SEQ ID NO:Shown in 2 1-21 amino acids；

The amino acid sequence such as SEQ ID NO of the light chain variable region of the anti-CD19 single-chain antibodies:1 22-128 amino acids institute Show；

The amino acid sequence of the heavy chain variable region of the anti-CD19 single-chain antibodies can be such as SEQ ID NO:1 144-263 bit aminos Shown in acid；

The amino acid sequence such as SEQ ID NO of the people CD8 α hinge areas:Shown in 1 264-310 amino acids；

The amino acid sequence of the people CD8 transmembrane regions such as SEQ ID NO:Shown in 1 311-332 amino acids；

The amino acid sequence of the people 41BB intracellular regions such as SEQ ID NO:Shown in 1 333-380 amino acids；

The amino acid sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:Shown in 1 381-491 amino acids.

6. a kind of nucleic acid constructs, the nucleic acid constructs contains the polynucleotide sequence described in any one of claim 1-3；

Preferably, the nucleic acid constructs is carrier；

It is highly preferred that the nucleic acid constructs is retroviral vector, containing replication origin, 3 ' LTR, 5 ' LTR and Polynucleotide sequence described in any one of claim 1-3.

7. a kind of retrovirus, the retrovirus contains the nucleic acid constructs described in claim 6, preferably comprises described Carrier, further preferably described retroviral vector.

8. the pharmaceutical composition of a kind of iNKT cells of genetic modification or the iNKT cells containing the genetic modification, which is characterized in that The cell contains polynucleotide sequence described in any one of claim 1-3 or containing the nucleic acid structure described in claim 6 It builds object or has infected retrovirus described in claim 7.

9. genetic modification iNKT cell activations method and training method and its application in claim 8.

10. the fusion egg described in any one of polynucleotide sequence, claim 4-5 described in any one of claim 1-3 In vain, the nucleic acid constructs described in claim 6 or the retrovirus described in claim 7 are in the iNKT cells for preparing activation Application.

11. the fusion egg described in any one of polynucleotide sequence, claim 4-5 described in any one of claim 1-3 In vain, the nucleic acid constructs described in claim 6, the retrovirus described in claim 7 or gene according to any one of claims 8 Purposes of the iNKT cells or its pharmaceutical composition of modification in the drug of disease for the treatment of CD19 mediations is prepared；

Preferably, the disease of the CD19 mediations is leukaemia, lymthoma.