CN108130368B

CN108130368B - Application of lncRNA in preparation of product for diagnosing or predicting adolescent idiopathic scoliosis

Info

Publication number: CN108130368B
Application number: CN201711396072.2A
Authority: CN
Inventors: 王以朋; 李子全; 李政垚; 刘书中; 王牧川; 牛潼
Original assignee: Peking Union Medical College Hospital Chinese Academy of Medical Sciences
Current assignee: Peking Union Medical College Hospital Chinese Academy of Medical Sciences
Priority date: 2017-12-21
Filing date: 2017-12-21
Publication date: 2021-12-14
Anticipated expiration: 2037-12-21
Also published as: CN108130368A

Abstract

The invention discloses a new molecular marker ENST00000414894.1 and/or TRHDE-AS1 related to adolescent idiopathic scoliosis, and further proves that ENST00000414894.1 and TRHDE-AS1 are expressed in adolescent idiopathic scoliosis patients to be down-regulated, and the molecular marker ENST00000414894.1 and/or TRHDE-AS1 can be applied to preparation of products for diagnosing or indicating adolescent idiopathic scoliosis. The invention also discloses application of the molecular marker in preparation of a kit for diagnosing or indicating adolescent idiopathic scoliosis. The molecular marker can be used for diagnosing the juvenile idiopathic scoliosis at the early stage, is quick and effective, has important significance for the early treatment of the juvenile idiopathic scoliosis and the saving of medical cost, and provides a treatment target and an important basis for clinical application such as gene treatment, drug treatment and the like.

Description

Application of lncRNA in preparation of product for diagnosing or predicting adolescent idiopathic scoliosis

Technical Field

The invention relates to the technical field of biology, in particular to application of ENST00000414894.1 and/or TRHDE-AS1 in preparation of a product for diagnosing or predicting adolescent idiopathic scoliosis.

Background

Idiopathic Scoliosis (IS) IS a disease with a high incidence (incidence rate of 1.3%) that severely affects quality of life, accounting for approximately 80% of the total Scoliosis. According to the different onset ages, the disease is classified into Infant Idiopathic Scoliosis (IIS) (0.3 years old), Juvenile Idiopathic Scoliosis (JIS) (3-9 years old), Adolescent Idiopathic Scoliosis (AIS) (10-16 years old). Wherein AIS comprises about 80% of the idiopathic scoliosis population. The etiology of AIS is not clear, and there are several hypotheses describing its pathogenesis, but all fail to explain the occurrence of AIS well.

Existing studies have shown that AIS occurs with a significant genetic predisposition. Although a great deal of research on the directions of genomics, proteomics and the like has achieved certain results at home and abroad, the conclusion is not consistent, and the occurrence and the progress of AIS cannot be satisfactorily explained. In the continuous recognition of huge genetic information of human, unlike the traditional gene coding protein, the non-coding gene sequence is gradually recognized by people and begins to play an important role in some disease mechanisms. One of them is long non-coding RNA (10ng non-codingRNAs, lncRNAs), which is a kind of RNA molecule with transcript length over 200nt and without protein coding function in eukaryotic cells. The current research continuously finds that the lncRNA has complex action mechanism and function, and plays an important role in the occurrence and development of a plurality of human diseases by serving as a regulator between gene information and products thereof. The research takes lncRNA as a main research object, and the expression level of lncRNA selected from peripheral blood by using a gene chip technology is detected by real-time quantitative PCR in muscle tissues, so that the research is carried out from a new perspective of long-chain non-coding RNA, and some new recognitions on the pathogenesis of AIS are expected.

Disclosure of Invention

In order to solve the above problems, an object of the present invention is to provide the use of ENST00000414894.1 and/or TRHDE-AS1 in the preparation of a product for diagnosing or predicting adolescent idiopathic scoliosis.

The second purpose of the invention is to provide a reagent for measuring the expression level of ENST00000414894.1 and TRHDE-AS 1.

The invention also aims to provide application of the reagent for determining the expression level of ENST00000414894.1 and/or TRHDE-AS1 in a sample of a subject in preparing a kit for diagnosing or predicting adolescent idiopathic scoliosis.

Based on the above, the invention adopts Agilent human lncRNA Array V3.0 chip technology, combines with bioinformatics analysis method, researches lncRNA differential expression condition between case group and normal control group, screens lncRNA ENST00000414894.1 and/or TRHDE-AS1 related to differential expression possibly influencing muscle and skeleton system, and uses RT-PCR to verify chip result. Furthermore, the differential expression level of the screened lncRNA in the paraspinal muscles is analyzed, so that the method has important guiding significance for further discussing the pathogenesis of the AIS patients, treating the AIS and perfecting the related functions of the lncRNA.

Firstly, the invention provides the application of ENST00000414894.1 and/or TRHDE-AS1 in preparing a product for diagnosing or predicting adolescent idiopathic scoliosis.

Preferably, said ENST00000414894.1 and TRHDE-AS1 are down-regulated in adolescent idiopathic scoliosis patients.

Preferably, the product for diagnosing or predicting adolescent idiopathic scoliosis comprises a gene chip, a reagent or a kit.

Further, the present invention provides a reagent for determining the expression level of ENST00000414894.1 and TRHDE-AS1, said reagent comprising a primer that specifically amplifies juvenile idiopathic scoliosis-associated lncRNA ENST00000414894.1 and/or TRHDE-AS 1.

Preferably, the primer comprises the following nucleotide sequence:

specific amplification ENST00000414894.1 primer:

the upstream primer SEQID NO. 1: AGCCGCCCTATTCAGTTCAC, respectively;

the downstream primer SEQID NO. 2: TCCAAGTTCCGAGTTGTGGG, respectively;

specific amplification TRHDE-AS1 primer:

the upstream primer SEQID NO. 3: GGTCCTCTGGGTGGAATGTG, respectively;

the downstream primer SEQID NO. 4: GGCCGGACACTTCTTTCTCA are provided.

Further, the invention also provides application of the reagent for determining the expression level of ENST00000414894.1 and/or TRHDE-AS1 in a sample of a subject in preparing a kit for diagnosing or predicting adolescent idiopathic scoliosis.

Preferably, the sample of the subject comprises a serum, urine or tissue sample.

Preferably, the determination of the expression levels of ENST00000414894.1 and TRHDE-AS1 in the subject sample is performed by fluorescent quantitative PCR.

Preferably, the kit further comprises the following components:

(1) extracting reagent from total RNA in the sample;

(2) a reverse transcription reagent;

(3) quantitative PCR reagent;

(4) normal control sample cDNA.

Preferably, the RNA extraction reagent comprises Trizol, chloroform, isopropanol, 75% ethanol, etc.; the reverse transcription reagent comprises a reverse transcription buffer solution, a reverse transcriptase, Oligo dT and Random6mers primers and the like; the quantitative PCR reagent comprises a SYBR Green polymerase chain reaction system consisting of PCR buffer solution, SYBR Green fluorescent dye and dNTPs, a primer and RNase Free H₂O; the normal sample cDNA: as a negative control, the PCR assay was quantified together with the cDNA of the test sample, and the same amount of cDNA as the test sample was used for each reaction system.

The invention has the following beneficial effects:

the invention discloses a novel molecular marker ENST00000414894.1 and/or TRHDE-AS1 related to adolescent idiopathic scoliosis, and further proves that ENST00000414894.1 is down-regulated in adolescent idiopathic scoliosis patients, and can be applied to preparation of products for diagnosing or indicating adolescent idiopathic scoliosis. The invention also discloses application of the molecular marker in preparation of a kit for diagnosing or indicating adolescent idiopathic scoliosis. The molecular marker can be used for diagnosing the juvenile idiopathic scoliosis at the early stage, is quick and effective, has important significance for the early treatment of the juvenile idiopathic scoliosis and the saving of medical cost, and provides a treatment target and an important basis for clinical application such as gene treatment, drug treatment and the like.

Drawings

FIG. 1 qRT-PCR verified gene chip results.

Detailed Description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the reagents used are commercially available.

The overall experimental scheme of the invention is as follows:

1. peripheral blood was measured by comparing 4 adolescent idiopathic scoliosis patients and 4 age and gender matched normal control populations. Screening lncRNA ENST00000414894.1 and TRHDE-AS1 which have expression level difference and possibly influence the muscle and skeleton system in function by gene chip technology, GO, Pathway analysis, CNC network diagram construction and other bioinformatics technologies;

2. the expression condition of the DNA chip is verified by qRT-PCR, and the result is consistent with the chip result.

3. The expression level of lncRNA in the paraspinal muscles of the lesion part of a case group and the corresponding part of a control group is verified through qRT-PCR, and whether the lncRNA has expression difference in the paraspinal muscles of patients or not is discussed, so that the method plays an important role in the generation and development of the special scoliosis of the teenagers.

The main experimental reagents used in the invention are as follows:

trizol LS (Ambion, USA); isopropanol, chloroform, absolute ethanol (shanghai chemical agents ltd); RNA purification kit (QIGEN, germany); PrimeScript RT reagent kit reverse transcription kit (Takara Bio Inc.); the quantitative PCR detection kit (Bao bioengineering Co., Ltd.) uses Agilent human lncRNA Array V3.0 to carry out gene chip detection, and commissions Beijing Boao biotechnology Co., Ltd; cy3-dCTP (GE healthcare); 20XSSC (Beijing Boo ao Biotechnology, Inc.); agilent one-color RNA Spike-in kit (Agilent Co., USA).

Example 1 sample Collection Standard

1. Study object

The study adopts a case-control study method, a peripheral blood sample case group is selected from Chinese Han female AIS of Beijing collaborating and hospital scoliosis orthopaedy, and a control group is selected from normal female matched with the case group in gender, age and ethnicity.

The paravertebral muscle specimen case group is selected from Chinese Han female AIS patients in Beijing together and hospital for scoliosis orthopaedy, and the control group is intervertebral disc degeneration operation patients without spinal deformity matched with the case group in gender, age and ethnicity.

1.1 case group

All from adolescent idiopathic scoliosis patients treated by the surgery in my hospital from 4 months to 3 months in 2013 to 2014, and Han nationality adolescent idiopathic scoliosis patients with complete clinical data and imaging data (including spine x-ray, CT and three-dimensional reconstruction and whole spine MRI) are selected.

Case inclusion criteria

1. The adolescent idiopathic scoliosis is diagnosed definitely;

2. a female;

3. age 10-18 years;

4. informed consent;

5. has complete clinical data and imaging data (including spine x-ray, CT and three-dimensional reconstruction, and whole spine MRI).

Exclusion criteria

1. Patients with other definite causes of spinal deformity, such as congenital scoliosis, neuromuscular scoliosis, spinal trauma, infection, tumor, etc.;

2. in combination with other chronic disease patients (which may lead to growth and development being affected):

3. AIS patients with incomplete imaging data and clinical data;

4. AIS patients who did not obtain informed consent.

1.2 control group

Gender, nationality, age and case matched people without spine deformity and known diseases; wherein the peripheral blood sample is selected from normal population, and the paraspinal muscle sample is selected from patients with intervertebral disc degeneration. Since perfect matching is difficult in terms of age of a patient with degenerative disc, the age is properly extended to 90 years.

Inclusion criteria

1. Informed consent;

2. a female;

3. age <30 years old;

4. has complete clinical data and imaging data (X-ray eliminates spinal deformity).

Exclusion criteria

1. No informed consent was obtained;

2. patients with malformations of the spine;

3. there are diseases that damage the neuromuscular system;

4. patients with other chronic diseases are combined.

Example 2 screening of lncRNA

Fasting peripheral blood was collected and total RNA was extracted with 4 adolescent idiopathic scoliosis patient specimens as AIS group and 4 normal control groups as normal control group (NC group).

1. Total RNA extraction from peripheral whole blood

1) Adding 0.25ml of peripheral blood and 0.75ml of frozen mixed solution of a trizol LS reagent into each EP tube, and violently shaking and uniformly mixing;

2) incubating for 5 minutes at room temperature to completely dissociate the nucleic acid protein complex;

3) 0.2ml of chloroform was added to each EP tube (i.e., 0.2ml of chloroform was added to each 0.75ml Trizol LS reagent sample), and the EP tube caps were closed. Shaking vigorously for 15 seconds;

4) standing for 3 minutes at room temperature to quickly and effectively separate an organic phase from an inorganic phase;

5) centrifuging for 10 minutes at 4 ℃ and 12000G by using a low-temperature centrifuge;

6) after centrifugation, the EP tube was carefully removed, and the mixed liquid therein was seen to be divided into three layers: the lower layer is red phenol chloroform phase, the middle layer is white protein layer and the upper layer is colorless water phase layer. All the RNA required for this experiment was present in the aqueous layer.

7) Carefully transfer the aqueous layer to another EP tube with a micropipette (take care not to suck to the middle layer);

8) adding 0.6ml of isopropanol into the aqueous phase layer, uniformly mixing, and then incubating for 10 minutes at 15-30 ℃ to effectively precipitate the RNA in the aqueous phase layer (the isopropanol protects hydrophilic groups in an RNA chain through the hydrophobic effect of-OH);

9) centrifuging for 10 minutes at 4 ℃ and 12000G by using a low-temperature centrifuge;

10) removing the supernatant, adding lmL 75% ethanol (at least lmL 75% ethanol per 0.75ml of the homogenized sample of LTRIzol reagent) into each EP tube, and washing the tube wall of the EP tube by gently inverting the tube;

11) centrifuging for 5 minutes at 4 deg.C and 12000G with low temperature centrifuge, and carefully discarding ethanol;

12) repeating the steps 10-11, and washing the RNA precipitate again;

13) after removing the ethanol solution, the EP tube was left to air to dry the RNA pellet for 5-10 minutes at room temperature (centrifugation or heat drying is not possible, otherwise RNA would be difficult to dissolve);

14) adding 15ul of RNase-free water into an EP tube by using a micropipettor, flicking and repeatedly and softly blowing and beating by using a suction pipe, incubating for 10 minutes in a room temperature box, and dissolving RNA;

15) the RNA obtained can be used for the next experiment or stored at-80 ℃.

2. Purification of RNA

Agilent human lncRNA Array V3.0 has high requirement on the purity of RNA extracted from a sample, so that the total RNA of the extracted cells is purified by using an RNasey Mini Kit (Qiagen p/n 74104) Kit, and the specific steps refer to the specification.

3. RNA quality inspection

Detecting the concentration and purity of the extracted RNA by using a NanoDrop ND-1000 type spectrophotometer; and detecting the quality of the RNA by denaturing agarose gel electrophoresis, and preliminarily judging whether the quality of the extracted RNA sample is qualified or not from the electrophoresis result, wherein whether the extracted RNA sample can be used for further analysis or not. And then detecting the extraction condition of the RNA sample by a NanoDrop1000 spectrophotometer, wherein the sample analyzed by the lncRNA chip requires that: OD260/OD280 was 1.8-2.0.

RNA quality determination criteria: the OD260/OD280 value of the RNA sample is between 1.8 and 2.0; the total RNA electrophoresis pattern has clear 28S and 18S bands; the electrophoresis pattern after the water bath heat preservation for 1 hour at 70 ℃ has no obvious difference with the pattern before the water bath heat preservation.

4.1 ncRNAs chip detection

4.1 Total RNA Synthesis of cDNA

(1) Synthesis of First Strand cDNA by reverse transcription

5 mu.L of Total RNA (100-500ng) was taken and added to a 0.2ml nuclease-free Eppendorf centrifuge tube.

② 1 mu L of crystal core gene expression profile external reference (Cat. No.360030) is added, and simultaneously Agilent spike-in with corresponding volume is added according to the following table 1.

TABLE 1 reaction volume

③ prepare reverse transcription MasterMix on ice (the amount of a single reaction system is shown in table 2 below), mix gently, centrifuge briefly and put on ice.

TABLE 2 reaction System

And fourthly, adding 5 mu L of reverse transcription Master Mix into a 0.2ml centrifuge tube containing the Total RNA sample. The final reaction volume for reverse transcription was L0. mu.L.

And fifthly, gently blowing, sucking, uniformly mixing for 2-3 times, performing instantaneous centrifugation, and placing on ice.

Sixthly, placing the reverse transcription centrifugal tube on a PCR instrument, reacting for 1 hour at 25 ℃, reacting for 1 hour at 42 ℃, and keeping for more than 5min at 4 ℃. The tubes were removed, centrifuged briefly, and placed on ice in preparation for Second Strand cDNA synthesis.

(2) Synthesis of Second Strand cDNA

(ii) Second Strand Master Mix was prepared on ice (Table 3 below shows for a single reaction system)

Volume), gently mixed, centrifuged briefly and then ice-cooled.

TABLE 3 reaction System

Adding 50 mu L of Second Strand MasterMix into the reaction tube in the sixth step of First Strand cDNA synthesis, and mixing the volume of 60 mu L; blowing, sucking, mixing for 2-3 times, centrifuging instantaneously, and placing on ice.

Thirdly, placing the second chain synthesis centrifugal tube on a PCR instrument, reacting for 1h at 16 ℃ (closing the heating function of the cover of the PCR instrument), reacting for l0min at 65 ℃, and keeping for more than 5min at 4 ℃.

Fourthly, after the reaction is finished, the reaction tube is placed on ice to continue the synthesis reaction, or is quickly frozen and stored at minus 20 ℃.

4.2 in vitro transcription Synthesis of cRNA

Preparing in vitro transcription MasterMix (the dosage of a single reaction system is shown in the following table 4), gently mixing, and collecting the solution at the bottom of a tube by short-time centrifugation.

② taking 30 μ L IVT MasterMix to the reaction tube in the Second Strand cDNA synthesis step, mixing evenly by blowing and sucking, and placing on instantaneous centrifugal ice.

Thirdly, placing the in vitro transcription synthesis centrifugal tube on a PCR instrument, reacting for 16h at 40 ℃, and keeping at 4 ℃.

After the reaction, the reaction mixture was subjected to instantaneous centrifugation, and the product was purified using RNeasy Mini Kit (Qiagenp/n 74104) and then quantified using an ultraviolet spectrophotometer.

TABLE 4 reaction System

4.3cRNA reverse transcription

Taking 10 mu g of a cRNA purified product, adjusting the volume to 22 mu L, adding the product into a 0.2ml nuclease-free centrifuge tube, adding 2 mu L Random Primer, uniformly mixing, placing the mixture on a PCR instrument, placing the mixture at 70 ℃ for 5min, 25 ℃ for 5min and 4 ℃ for 2min, performing instantaneous centrifugation, collecting liquid to the bottom of the tube, and placing the liquid on ice.

② preparing cRNA reverse transcription MasterMix (the dosage of a single reaction system is shown in the following table 5), gently mixing the mixture evenly, and collecting the solution at the bottom of the tube by short-time centrifugation.

TABLE 5 reaction System

And thirdly, adding 16 mu L of reverse transcription MasterMix into the centrifuge tube after the reaction in the step I, blowing, sucking and mixing uniformly for 2-3 times, and performing instantaneous centrifugation.

Placing the cRNA reverse transcription centrifugal tube on a PCR instrument, reacting at 25 ℃ for l0min, reacting at 40 ℃ for 1.5h, reacting at 70 ℃ for 10min, reacting at 4 ℃ for 5min, and placing the centrifugal tube on ice.

Fifthly, operating on ice, adding 2 microliter RNase H into a cRNA reverse transcription centrifugal tube, mixing uniformly, performing instantaneous centrifugation, placing on a PCR instrument, reacting for 45min at 37 ℃, reacting for 5min at 95 ℃, and maintaining for 5min at 4 ℃.

Sixthly, after the reaction is finished, the mixture can be frozen at the temperature of 20 ℃ below zero overnight, or purification operation can be immediately carried out by using a Nucleospin @ ExtractII (MN, Cat.No.740609.250) kit.

4.4 fluorescent labelling

Concentrating the volume of cDNA product obtained after reverse transcription and purification to 14 mu L, adding 4 mu L RandomPrimer, mixing uniformly, placing on a PCR instrument after short-time centrifugation, denaturing at 95 ℃ for 3min, and carrying out ice bath for 5 min.

② the reagents in the table 6 are added in turn, and the mixture is blown and beaten for 2-3 times by a pipette and mixed evenly.

TABLE 6 reaction System

③ after short-time centrifugation, the mixture is placed on a PCR instrument and reacted for 1.5h at 37 ℃, 5min at 70 ℃ and kept at 4 ℃.

Fourthly, after the fluorescent dye labeling reaction is finished, cDNA is purified by using a Nucleospin @ Extract II (MN, Cat.No.740609.250) kit, and the purified fluorescent labeling product is subjected to fluorescence doping amount and nucleic acid quantification by using an ultraviolet spectrophotometer.

4.5 chip hybridization

(1) Labeled product hybridization preparation

The elution volume of the labeled product purified by the Nucleospin @ Extract II kit was about 30. mu.L.

② the single tube labeled (cy3-dCTP) purified elution product is concentrated by vacuum pumping or the water is supplemented to the volume of 27.5 mu L for standby.

(2) Preparation of hybridization system and hybridization reaction

Prepared labeled product was mixed with the reagents of table 7 below.

And secondly, adding 100 mu L of hybridization solution into the hybridization cover sheet fence, slightly covering the fence with the Agilent label surface facing downwards, installing an Agilent hybridization box and screwing, slightly and horizontally rotating the hybridization box, and checking whether the liquid in the hybridization cavity of each subarray flows or not.

Thirdly, the hybridization box is arranged on a rotor of the hybridization furnace, the hybridization box is arranged symmetrically, and after a proper amount of ultrapure water is added into a tray, hybridization is carried out at 45 ℃ overnight.

TABLE 7 reaction System

4.6 chip cleaning and scanning

After the hybridization of the chips, the chips were taken out and washed in a Boo S1ide Washer8 chip, and the washing procedure was as follows:

washing liquor I: 0.2% SDS, 2 XSSC, 120S at 42 ℃ for 2 washes.

Washing liquid II: 0.2% SDS, 2 XSSC, 80S at 42 ℃ 3 times.

And secondly, after the cleaning procedure is finished, centrifugally drying the fabric to be scanned.

And thirdly, scanning the cleaned chip by using an Agilent chip scanner (G2565CA) to obtain a hybridization picture.

5. Chip result analysis

The latest information of the lncRNA related databases such as RefSeq, UCSC, Ensembl, H-invDB, Hox lncRNAs, RNAdb, T-UCRs, LncRNA-a, Combinedlit, etc. is overlaid by using human lncRNA Array V3.0y of Agilent, USA. The specimens of 4 adolescent idiopathic scoliosis patients were used as AIS group, and 4 normal control groups were used as normal control group (NC group). And scanning the hybridized chip by using an Agilent chip scanner to obtain an image. After the chip scanning image is analyzed and processed by NimbkScan software (version 2.5) and Agilent GeneSpring GX software (version 11.5.1), the lncRNA expression data of the AIS group and the NC group are obtained: and (4) screening by Fold multiplying power (Fold Change) to obtain lncRNA data with obvious differential expression, wherein the parameter selection standard is FC >2.0, and P is less than 0.05. There were 120 lncrnas with high differential expression, 3.819-fold highest fold differential expression, and 19 lncrnas with low differential expression, 9.781-fold highest fold differential expression.

In order to better analyze the functions of the differentially expressed genes, the inventor further screens the differentially expressed lncRNAs possibly related to nerves, muscles and bones through GO analysis, Pathways analysis, CNC gene expression network diagram construction and other bioinformatics analysis;

according to the site of the lncRNA with differential expression, the fold of differential expression, the functional analysis of lncRNAs and the research on literature conditions, 2 lncRNAs TRHDE-AS1 and ENST00000414894.1 with differential expression and down-regulation are screened.

Example 3 validation of a large sample of qRT-PCR

Age-matched 20 AIS patients and 20 normal women are taken AS study objects, and ENST00000414894.1 and TRHDE-AS1 which have obvious differential expression and are predicted to possibly participate in AIS pathogenesis are selected for real-time quantitative PCR verification.

1. Total RNA extraction from peripheral whole blood

The procedure is as in example 2.

2. Reverse transcription process for cDNA synthesis:

the RNA qualified for quality inspection is reversely transcribed into cDNA, and the specific steps are as follows:

1) removal of DNA in RNA samples: the reagents in table 8 below were added to the centrifuge tubes in sequence and vortexed to mix.

TABLE 8 reaction reagents

2) Slightly centrifuging, placing in a PCR instrument, and reacting for 5 minutes at 42 ℃;

3) preparing a reverse transcription system as shown in table 9, adding the reverse transcription system into the centrifugal tube which is finished with the step 2, and uniformly mixing the reverse transcription system and the centrifugal tube in a vortex manner;

4) slightly centrifuging, placing the mixture in a PCR instrument, reacting for 30 minutes at 37 ℃ and reacting for 5 seconds at 85 ℃; and the cDNA was stored in a-20 ℃ freezer.

TABLE 9 reverse transcription System

3、qRT-PCR

The primers were synthesized by Invitrogen bioengineering, Inc. of Beijing, and are shown in Table 10:

TABLE 10 primer sequences

The reaction system is as follows:

TABLE 11 reaction System

The amplification procedure was: reacting at 94 ℃ for 5 min; denaturation and amplification and extension, reaction at 94 ℃ for 30s, at 58 ℃ for 30s, and at 72 ℃ for 40s for 40 cycles; the reaction was carried out at 72 ℃ for 7 min.

4. Results

According to the relative quantitative formula of qRT-PCR: 2^-ΔΔCtX 100%, comparing ENST00000414894.1 with TRHDE-AS1 in case group and control groupExpression level of (a), results: the expression levels of ENST00000414894.1 and TRHDE-AS1 were lower in the case group than in the control group; the 2 lncRNAs were well verified in the enlarged sample, and the qPCR results were in substantial agreement with the trend of the chip data (FIG. 1).

Example 4 verification in LncRNA paraspinal muscles

1. Selection of paraspinal muscles

The expression level of selected lncRNA in paraspinal muscles was measured by qPCR on collected paraspinal muscles at the lesion site of AIS patients (21 cases) and the paraspinal muscles at the relative position of control group (4 cases).

2. Muscle total RNA extraction

1) Taking out the preserved muscle tissue from the liquid nitrogen, and grinding the muscle tissue into powder in a mortar by using the liquid nitrogen;

2) adding about 1.2ml of TRIZOL reagent into a mortar, and grinding the solidified TRIZOL to be uniformly mixed with the powdery muscle tissue;

3) melting solid TRIzol at room temperature, mixing muscle powder and TRIzol, and transferring into a 1.5ml centrifuge tube;

4) incubating for 5 minutes at room temperature to completely decompose the nucleoprotein;

5) 0.2ml of chloroform was added to each EP tube (i.e., 0.2ml of chloroform was added to each 0.75ml Trizol LS reagent sample), and the EP tube caps were closed. Shaking vigorously for 15 seconds;

6) standing for 3 minutes at room temperature to quickly and effectively separate an organic phase from an inorganic phase;

7) centrifuging for 10 minutes at 4 ℃ and 12000G by using a low-temperature centrifuge;

8) after centrifugation, the EP tube was carefully removed, and the mixed liquid therein was seen to be divided into three layers: the lower layer is red phenol chloroform phase, the middle layer is white protein layer and the upper layer is colorless water phase layer. All the RNA required for this experiment was present in the aqueous layer.

9) Carefully transfer the aqueous layer to another EP tube with a micropipette (take care not to suck to the middle layer);

10) adding 0.6ml of isopropanol into the aqueous phase layer, uniformly mixing, and then incubating for 10 minutes at 15-30 ℃ to effectively precipitate the RNA in the aqueous phase layer (the isopropanol protects hydrophilic groups in an RNA chain through the hydrophobic effect of-OH);

11) centrifuging for 10 minutes at 4 ℃ and 12000G by using a low-temperature centrifuge;

12) removing the supernatant, adding lmL 75% ethanol (at least 1mL 75% ethanol per 0.75mL of the homogenized sample of the LTRIzol reagent) into each EP tube, and washing the tube wall of the EP tube by slightly inverting the tube;

13) centrifugation was carried out for 5 minutes at 4 ℃ and 12000G using a cryocentrifuge, the ethanol being carefully discarded:

14) repeating the steps 10-11, and washing the RNA precipitate again;

15) after removing the ethanol solution, the EP tube was left to air to dry the RNA pellet for 5-10 minutes at room temperature (centrifugation or heat drying is not possible, otherwise RNA would be difficult to dissolve);

16) adding 20-40 μ L of RNase-free water (DEPC water adjusted according to the concentration of the prepared RNA solution) into an EP tube by using a micropipette, flicking and repeatedly and gently blowing by using a pipette, incubating for 10 minutes in a room temperature box, and dissolving RNA;

17) the RNA can be used for the next experiment or stored at-80 ℃;

18) RNA concentration and purity were determined using a NanoDrop ND.1000 model UV spectrophotometer.

3. Reverse transcription process for cDNA synthesis:

the procedure is as in example 3.

4、qRT-PCR

The procedure is as in example 3.

5. Results of the experiment

The expression level of selected lncRNA is detected in the paraspinal muscles of the AIS patients and the control group, and the expression level of ENST00000414894.1 and TRHDE-AS1 in the AIS patients is reduced to different degrees compared with the control group.

It was suggested that low level expression of ENST00000414894.1, TRHDE-AS1 in paraspinal muscles plays an important role in the pathogenesis of AIS.

EXAMPLE 5 preparation of the kit

Based on the primer set obtained in example 3, the diagnostic kit for detecting AIS of the present invention was assembledThe primer pair for specifically amplifying ENST00000414894.1 and TRHDE-AS1 is shown AS SEQ ID NO 1-2 and SEQ ID NO 3-4, and the primer pair for specifically amplifying housekeeping Gene (GAPDH) is shown AS SEQ ID NO 5-6; also comprises SYBR Green polymerase chain reaction system, such as PCR buffer solution, SYBR Green fluorescent dye, dNTPs, and polymerase. The PCR buffer solution comprises 25mM KCl and 2.5mM MgCl₂，200mM(NH₄)₂SO₄。

The final determination of the composition of the diagnostic kit by optimization of primer concentration and annealing temperature includes: (1) extracting reagent for total RNA of cells; (2) a reverse transcription reagent; (3) quantitative PCR reagent; (4) undifferentiated cell cDNA as negative control and detection sample cDNA were used together for quantitative PCR detection, and each reaction system used the same amount of cDNA as the detection sample. The total RNA extraction reagent for cells is shown in Table 12, the specific components and amounts of the reverse transcription reagent are shown in Table 13, and the specific components and amounts of the quantitative PCR reagent are shown in Table 14.

TABLE 12 Total RNA extraction reagent

Components	Amount of the composition used
		Trizol	1mL
Chloroform	0.2mL
		Isopropanol (I-propanol)	0.5mL
75% ethanol	1mL

TABLE 13 reverse transcription reagents

TABLE 14 quantitative PCR reagents

Components	The amount of each reaction system is used
		SYBRGreen polymerase chain reaction system	12.5μL
ForwardPrimer(1μM)	1μL
		ReversePrimer(1μM)	1μL
RNaseFreedH₂O	To 25 μ L

The optimal reaction conditions are as follows: pre-denaturation at 95 ℃ for 5min, (denaturation at 95 ℃ for 15sec, annealing at 60 ℃ for 45sec, extension at 72 ℃ for 35 sec). times.40 cycles, extension at 72 ℃ for 15 min.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> Beijing coordination hospital of Chinese academy of medical sciences

Application of <120> lncRNA in preparation of product for diagnosing or predicting adolescent idiopathic scoliosis

<130> P17154

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

agccgcccta ttcagttcac 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tccaagttcc gagttgtggg 20

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ggtcctctgg gtggaatgtg 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ggccggacac ttctttctca 20

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ctataaattg agcccgcagc c 21

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gcgcccaata cgaccaaatc 20

Claims

1. Use of an agent for determining the expression level of TRHDE-AS1 in a sample from a subject, said TRHDE-AS1 being down-regulated in expression in a adolescent idiopathic scoliosis patient, in the manufacture of a kit for diagnosing or prognosing adolescent idiopathic scoliosis.

2. The use of claim 1, wherein the sample from the subject comprises a serum, urine, or tissue sample.

3. The use of claim 2, wherein the level of TRHDE-AS1 expression in the sample from the subject is determined by fluorescent quantitative PCR.

4. The use of claim 1, wherein the kit further comprises the following components:

(1) extracting reagent from total RNA in the sample;

(2) a reverse transcription reagent;

(3) quantitative PCR reagent;

(4) normal control sample cDNA.