CN108424963B - Application of circ _0079591 in serum as URSA diagnosis and pregnancy outcome assessment marker - Google Patents
Application of circ _0079591 in serum as URSA diagnosis and pregnancy outcome assessment marker Download PDFInfo
- Publication number
- CN108424963B CN108424963B CN201810602718.6A CN201810602718A CN108424963B CN 108424963 B CN108424963 B CN 108424963B CN 201810602718 A CN201810602718 A CN 201810602718A CN 108424963 B CN108424963 B CN 108424963B
- Authority
- CN
- China
- Prior art keywords
- circ
- ursa
- pregnancy outcome
- serum
- pregnancy
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses application of circ _0079591 in serum as a URSA diagnosis and pregnancy outcome assessment marker, and uses circ _0079591 as the URSA diagnosis and pregnancy outcome assessment marker to develop a corresponding detection kit.
Description
Technical Field
The invention belongs to the field of biomedicine, and particularly relates to application of circ _0079591 in serum as a marker for diagnosis of Unexplained Recurrent Spontaneous Abortion (URSA) and pregnancy outcome assessment.
Background
Spontaneous abortion occurs 2 or more times continuously and is called recurrent abortion (RSA), the incidence rate is about 1% -5% of women of childbearing age, the etiology is complex, except for few chromosome, endocrine, anatomical, infection and other factors, about 80% of etiology is unknown, and the abortion is called unexplained recurrent abortion (URSA). URSA seriously harms reproductive health of women of childbearing age, but biological indexes with strong specificity, high sensitivity and good stability are not available at present, and no clear and uniform standard exists in clinical intervention treatment, so that the pregnancy outcome cannot be effectively predicted. Therefore, there is a need to search for new effective markers for clinical diagnosis, treatment and prognosis detection of URSA, which provides the basis for diagnosing and treating URSA and developing related drugs.
Circular RNA (circular RNA) is in a closed circular shape, is a special endogenous non-coding RNA without a 5 'terminal cap and a 3' terminal tail, mainly consists of exon transcription products, is rarely derived from introns or intron fragments, and is a new hotspot in the field of RNA research at present. circRNA is present in a variety of eukaryotes, as well as widely in different tissues of the same organism; most circrnas have highly conserved sequences, only a few of which are evolutionarily not conserved; most localize in the cytoplasm and a few localize within the nucleus. Moreover, part of the circRNA has the function of miRNA molecular sponge, interacts with miRNA, and regulates and controls the expression of target genes; most circrnas exert a regulatory effect at the transcriptional or post-transcriptional level, and a few at the transcriptional level. Some previous researches find that circRNA plays an important role in the occurrence process of diseases such as atherosclerosis, nervous system disorder, prion diseases, diabetes, tumor, cancer and the like, and becomes a new hot spot of research in the medical field at present. The circRNA molecule is in a closed ring structure, is not influenced by RNA exonuclease, and compared with the traditional linear RNA, the circRNA is more stable in expression and not easy to degrade, and the tissue specificity and stability of the circRNA enable the circRNA molecule to be expected to be a good marker for URSA clinical diagnosis, treatment and prognosis detection.
Disclosure of Invention
In view of the above prior art, the inventors have conducted extensive technical research and long-term clinical practice to provide a product related to diagnosis of URSA and/or evaluation of pregnancy outcome of a patient with URSA, and to provide the use of circ _0079591 as a marker for diagnosis of URSA and evaluation of pregnancy outcome.
In a first aspect of the invention, there is provided the use of circ _0079591 as a marker for the diagnosis of URSA and/or the assessment of pregnancy outcome in a patient with URSA in the manufacture of a product for the diagnosis of URSA and/or for the assessment of pregnancy outcome in a patient with URSA.
Wherein the nucleic acid sequence of the circ _0079591 is as follows:
AGCACTAGACAAACTGAATGGATTTCAGTTAGAGAATTTCACCTTGAAAGTAGCCTATATCCCTGATGAAATGGCCGCCCAGCAAAACCCCTTGCAGCAGCCCCGAGGTCGCCGGGGGCTTGGGCAGAGGGGCTCCTCAAGGCAGGGGTCTCCAGGATCCGTATCCAAGCAGAAACCATGTGATTTGCCTCTGCGCCTGCTGGTTCCCACCCAATTTGTTGGAGCCATCATAGGAAAAGAAGGTGCCACCATTCGGAACATCACCAAACAGACCCAGTCTAAAATCGATGTCCACCGTAAAGAAAATGCGGGGGCTGCTGAGAAGTCGATTACTATCCTCTCTACTCCTGAAGGCACCTCTGCGGCTTGTAAGTCTATTCTGGAGATTATGCATAAGGAAGCTCAAGATATAAAATTCACAGAAGAGATCCCCTTGAAGATTTTAGCTCATAATAACTTTGTTGGACGTCTTATTGGTAAAGAAGGAAGAAATCTTAAAAAAATTGAGCAAGACACAGACACTAAAATCACGATATCTCCATTGCAGGAATTGACGCTGTATAATCCAGAACGCACTATTACAGTTAAAGGCAATGTTGAGACATGTGCCAAAGCTGAGGAGGAGATCATGAAGAAAATCAGGGAGTCTTATGAAAATGATATTGCTTCTATGAATCTTCAAGCACATTTAATTCCTGGATTAAATCTGAACGCCTTGGGTCTGTTCCCACCCACTTCAGGGATGCCACCTCCCACCTCAGGGCCCCCTTCAGCCATGACTCCTCCCTACCCGCAGTTTGAGCAATCAGAAACGGAGACTGTTCATCTGTTTATCCCAGCTCTATCAGTCGGTGCCATCATCGGCAAGCAGGGCCAGCACATCAAGCAGCTTTCTCGCTTTGCTGGAGCTTCAATTAAG
further, the circ _0079591 is circ _0079591 in the serum sample.
In a second aspect of the invention, the use of a kit or gene chip for detecting circ _0079591 in the manufacture of a product for diagnosing URSA and/or for assessing pregnancy outcome of a patient with URSA is provided.
Further, the kit comprises at least a forward primer 5'-ATCAGTCGGTGCCATCATCG-3' and a reverse primer 5'-GCGGCCATTTCATCAGGGATA-3' for circ _ 0079591.
Further, the gene chip at least comprises a probe which is hybridized with the nucleic acid sequence of the circ _ 0079591.
Further, the product can diagnose whether the patient has URSA by detecting the expression level of circ _0079591 in serum, and the low expression of circ _0079591 is related to the occurrence, development and pregnancy outcome of URSA.
Further, the product for detecting the expression level of circ _0079591 comprises: detecting the expression level of circ _0079591 by RT-PCR, real-time quantitative PCR, in situ hybridization, gene chip or gene sequencing to diagnose URSA and/or to evaluate products of pregnancy outcome of URSA patients.
In a third aspect of the invention, there is provided a product for diagnosing URSA and/or assessing pregnancy outcome in a patient with URSA, the product being characterised by: the product can diagnose URSA and/or evaluate pregnancy outcome of URSA patients by detecting the expression level of circ _0079591 in serum, and high-throughput detection results show that the expression of circ _0079591 in a URSA group is obviously reduced compared with that of normal pregnant women.
Further, the product is a chip or a detection kit; wherein the chip comprises at least a probe which hybridizes to the nucleic acid sequence of circ _ 0079591.
Further, the detection kit comprises a reagent for preparing a reverse transcription reaction system and a reagent for preparing a qPCR reaction system.
In a fourth aspect of the invention, there is provided the use of circ _0079591 in the manufacture of a medicament for the treatment of URSA.
Further, the drug is an agonist of circ _ 0079591.
Compared with the prior art, the technical scheme of the invention has the beneficial effects that:
(1) the invention is verified by high-throughput chip and clinical large sample expression, circ _0079591 obtained by screening can be used as a marker for diagnosing URSA, and the diagnosis efficiency is up to 91.70%.
(2) The circ _0079591 obtained by screening through a high-throughput chip can be used as a marker for pregnancy outcome assessment of URSA patients, and the diagnosis efficiency is up to 88.70%.
(3) The invention provides a basis for developing a medicament for improving the expression level of circ _0079591 in the future.
(4) The invention takes the circ _0079591 as a marker for diagnosing URSA and pregnancy outcome assessment, develops a corresponding detection kit, has high detection sensitivity, high specificity and convenient detection, meets the detection requirement of URSA patients, and has high diagnosis accuracy through clinical verification.
Drawings
The accompanying drawings, which are incorporated in and constitute a part of this specification, are included to provide a further understanding of the invention, and are incorporated in and constitute a part of this specification, illustrate exemplary embodiments of the invention and together with the description serve to explain the invention and not to limit the invention.
FIG. 1: and (3) screening the peripheral blood difference circRNA of the URSA patient and a normal pregnant woman.
FIG. 2: URSA patients were verified to express circ _0079591 in peripheral blood from normal pregnant women.
FIG. 3: the expression of the peripheral blood circ _0079591 in the pregnancy failure group and the pregnancy success group of URSA patients is verified.
FIG. 4: ROC Curve graph of URSA patient and normal pregnant woman, A is circ _0079591ROC graph, B is progestational hormone ROC graph.
FIG. 5: ROC Curve graphs of a pregnancy failure group and a pregnancy success group in URSA patients, wherein A is a circ _0079591ROC graph, and B is a progestogen ROC graph.
Detailed Description
It is to be understood that the following detailed description is exemplary and is intended to provide further explanation of the invention as claimed. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of exemplary embodiments according to the invention. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, and it should be understood that when the terms "comprises" and/or "comprising" are used in this specification, they specify the presence of the stated features, steps, operations, and/or combinations thereof, unless the context clearly indicates otherwise.
Interpretation of terms:
circ _ 0079591: the nucleic acid sequence of the circular RNA0079591 is shown as SEQ ID NO. 1.
As introduced in the background art, the prior art has certain defects in the use of progestogen and the like for diagnosing URSA and pregnancy outcome assessment, and in order to solve the technical problems, the invention obtains circ _0079591 through high-throughput chip screening and can be used as a URSA diagnosis and pregnancy outcome assessment marker.
In another embodiment of the present invention, the circ _0079591 is circ _0079591 in a serum sample.
In a specific embodiment of the present invention, the related specific technical solution includes:
(1) venous blood of URSA patients and normal pregnant women (6 cases in each group) is collected, mononuclear cells are separated, and differential circular RNA is screened by adopting a high-throughput chip.
(2) Sample size was expanded (60 each per group) and fluorescent real-time quantitative pcr (qpcr) was validated to screen for differential circular RNA expression.
(3) Analysis of clinical data (age, sex).
(4) Logistic regression model analysis.
(5) ROC curve analysis examines the efficacy and optimal cutoff value.
In an exemplary embodiment of the invention, the application of the kit or gene chip for detecting circ _0079591 in the preparation of products for diagnosing URSA and/or evaluating pregnancy outcome of URSA patients is provided.
In a specific embodiment of the invention, the kit comprises at least forward primer 5'-ATCAGTCGGTGCCATCATCG-3' and reverse primer 5'-GCGGCCATTTCATCAGGGATA-3' for circ _ 0079591.
In one embodiment of the invention, the gene chip comprises at least a probe hybridizing to the nucleic acid sequence of circ _ 0079591.
In one embodiment of the invention, the product can diagnose whether the patient has URSA by detecting the expression level of circ _0079591 in serum, and the low expression of circ _0079591 is related to the occurrence, development and pregnancy outcome of URSA.
In another embodiment of the present invention, the product for detecting the expression level of circ _0079591 in serum comprises: detecting the expression level of circ _0079591 by RT-PCR, real-time quantitative PCR, in situ hybridization, gene chip or gene sequencing to diagnose URSA and/or to evaluate products of pregnancy outcome of URSA patients.
Wherein the gene sequencing is capable of detecting a relative change in the level of gene expression, such as Illumina sequencing. The Illumina platform is a Sequencing method based on Sequencing-By-Synthesis (SBS) technology. The reversible blocking technology can realize that only one base is synthesized each time, the fluorescent group is marked, the corresponding laser is used for exciting the fluorescent group, and the exciting light is captured, so that the base information is read. The original image Data file obtained by high-throughput sequencing is analyzed and converted into an original sequencing sequence through Base recognition (Base Calling), the sequence is called Raw Data or Raw Reads, and the result is stored in a FASTQ (fq for short) file format. Sequencing the clear Reads with the designated reference genome using hisat2 to obtain the position information on the reference genome or genes and the sequence characteristic information specific to the sequenced sample. The expression level of a gene is directly reflected by the abundance of the transcript, and the higher the abundance degree of the transcript, the higher the expression level of the gene. In transcriptome sequencing analysis, the expression level of a gene can be estimated by counting the number of sequencing sequences (reads) that map to exon regions of the transcript. The transcript expression was calculated using FPKM (Fragments Per kb Per Million Reads) as the number of Fragments Per kilobase Per Million Fragments from a particular transcript. FPKM considers the influence of sequencing depth and transcript length on fragments counting, and is the most common method for estimating the expression level of the transcripts at present. The FPKM calculation formula is as follows:
in an exemplary embodiment of the invention, there is provided a product for diagnosing URSA and/or assessing pregnancy outcome in a patient with URSA, the product being characterized by: the product can diagnose URSA and/or evaluate pregnancy outcome of URSA patients by detecting the expression level of circ _0079591 in serum, and high-throughput detection results show that the expression of circ _0079591 in a URSA group is obviously reduced compared with that of normal pregnant women.
In one embodiment of the invention, the product is a chip or a test kit; wherein the chip comprises at least a probe which hybridizes to the nucleic acid sequence of circ _ 0079591.
In one embodiment of the present invention, for the detection kit, the detection system comprises a reverse transcription reaction system and a qPCR reaction system, and the detection kit comprises reagents for preparing the reverse transcription reaction system and reagents for preparing the qPCR reaction system.
In one embodiment of the present invention, the reagents used for preparing the reverse transcription reaction system include at least reverse transcription buffer (MLV-5 XBuffer), dNTP mix, RNAse protein inhibitor (RNAsin), reverse transcriptase mix (M-MLV) and polythymidine (OligodT).
In a specific embodiment of the invention, the reagents for preparing the qPCR reaction system at least comprise a forward primer solution and a reverse primer solution for circ _0079591, and further comprise a SYBR Green mixed solution and nuclease-free pure water.
In an exemplary embodiment of the invention, there is provided the use of circ _0079591 in the manufacture of a medicament for the treatment of URSA.
In a specific embodiment of the present invention, the drug is an agonist of circ _0079591, and the agonist of circ _0079591 refers to a product capable of increasing the expression level of circ _0079591, and the product comprises: a circ _0079591 overexpression vector, a circ _0079591 transcription activation type Cas9-VP64-sgRNA co-expression vector, a compound, a composition or a reagent for improving the expression level of circ _0079591 and the like. Among them, circular RNA overexpression vectors (e.g., lentiviral expression vectors, adenoviral expression vectors) and transcription-activated Cas9-VP64-sgRNA co-expression vectors have been commercialized, and can also be prepared by conventional technical means.
In order to make the technical solutions of the present invention more clearly understood by those skilled in the art, the technical solutions of the present invention will be described in detail below with reference to specific embodiments.
In the following examples, the reagents used were all analytical grade and were commercially available unless otherwise indicated. Experimental procedures not specifically identified herein are generally carried out under conventional conditions such as those described in the molecular cloning guidelines published by scientific Press, J. SammBruk et al, or under conditions recommended by the manufacturer. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In addition, any methods and materials similar or equivalent to those described herein can be used in the practice of the present invention.
1. Subject inclusion and exclusion criteria:
(one) source of cases
All cases are from 60 cases of stay in the gynecologic hospital and outpatient service of the Shandong Chinese medicine university affiliated hospital in 2016 (01) to 2017 (06). The blood samples of the normal control group are all from normal pregnancy physical examination persons in subsidiary hospitals of Shandong Chinese medicine university, and are diseases without heart, brain, lung, liver and kidney and thrombotic diseases, and diseases without known influence on research indexes, and the total number of the blood samples is 60.
(II) inclusion standard:
(1) URSA patient inclusion criteria:
the patient has 2 or more than 2 times of spontaneous abortion history and no history of live birth;
the chromosomes of both couples and (or) the embryo are normal, and the family genetic disease and the close marriage history are not available;
the gynecological examination of leucorrhea, ultrasonic examination and/or hysterosalpingography and the like eliminates organic lesions, anatomical malformation of reproductive organs and infectious factors of patients;
fourthly, the menstrual cycle is normal, the basal body temperature is two-phase, and the normal ovulation is monitored by ultrasonic;
analyzing the sperm of the male;
sixthly, endocrine tests such as sex hormone, thyroid function, blood sugar, insulin and the like are normal;
seventhly, the examination of autoantibodies such as antinuclear antibody, anticardiolipin antibody, antithyroid antibody and anti-2-glycoprotein I antibody is negative;
examination related to the state before thrombus, including that D-dimer, fibrin (protogen) degradation products, blood coagulation series and whole blood analysis are all normal;
ninthly, negative IgM series;
active immunotherapy has not been performed in r.
(2) Normal controls were included as standards:
the normal pregnancy physical examination women within 12 weeks of gestation have no history of spontaneous abortion, stillbirth and stillbirth, heredity, anatomy and endocrine abnormality, and history of infection and autoimmune diseases; during the pregnancy, there are no symptoms and signs of threatened abortion such as vaginal bleeding and abdominal pain; the embryo development is normal and the heart tube beats as proved by ultrasound.
2. And (3) high-flux chip detection:
peripheral blood from URSA and normal pregnant women was collected, total RNA quantified using NanoDrop ND-2000(Thermo Scientific) and RNA integrity tested by Agilent Bioanalyzer 2100(Agilent Technologies). After the RNA quality is qualified, the total RNA is reversely transcribed into double-strand cDNA, and cRNA labeled by Cyanine-3-CTP (Cy3) is further synthesized. The labeled cRNA was hybridized to an Agilent Human lncRNA Microrray V6 (4X 180K, Design ID:084410) chip, which was eluted and scanned with Agilent Scanner G2505C (Agilent Technologies) to obtain the original image.
Raw data were extracted by processing raw images using Feature Extraction software (version10.7.1.1, Agilent Technologies). Subsequently, the quantile standardization and subsequent processing were carried out using Genespring software (version 13.1, Agilent Technologies). The normalized data is filtered and at least one 100% of the probes labeled "P" from each set of samples used for comparison are left for subsequent analysis. And performing difference circRNA and LncRNA by using the P value and the fold change value of the T test, wherein the screening standard is that the fold change value is more than or equal to 2.0 under the up-regulation or down-regulation and the P value is less than or equal to 0.05.
qPCR validation of differential circRNA expression:
(1) cell extraction of RNA:
take 5X 106～1×107Adding 1ml of Trizon into each cell, fully and uniformly mixing, and standing at room temperature for 5-10 min; adding 200 mul/1 ml Trizon chloroform, covering the EP tube tightly and shaking vigorously for 15 s; centrifugation at 4 ℃: 12000rpm is multiplied by 10min, and the upper aqueous phase is taken in a new EP tube; adding isopropanol with the same volume, gently inverting and mixing, and standing at room temperature for 10 min; centrifugation at 4 ℃: 12000rpm is multiplied by 10 min; discarding the supernatant, adding 1ml of 75 (v/v)% ethanol (anhydrous ethanol: DNase/RDase-free water: 3:1), and gently mixing; centrifugation at 4 ℃: 12000rpm is multiplied by 5 min; discarding the supernatant, and adding 1ml of absolute ethyl alcohol; centrifuging at 4 ℃ and at 12000rpm for 5 min; discarding the supernatant (removing residual liquid as much as possible), and drying at room temperature or in vacuum for 10-20 min; adding appropriate amount of DNase/RDase-free water (usually 30-50 μ l) according to the amount of RNA precipitation to dissolve RNA; after mixing, the concentration was measured and recorded for reverse transcription.
(2) RT assay
Taking 0.2ml of EP tube to mark the name and date of the sample, and adding RNA, DNase/RDase-free water and OligodT into the marked EP tube according to requirements; running RT-1 program at 70 deg.C for 5min (Table 1); MIX of MLV-5 XBuffer, dNTP, RNAsin and M-MLV prepared according to the system is added into the EP tube, an RT-2 program is operated, the temperature is 42 ℃, 1h is carried out, cDNA is obtained, and a PCR experiment is carried out (table 2).
TABLE 1 RNA and OligodT
| Volume of the system | 20μl |
| RNA | 11μl |
| DNase/RDase-free water | 11-V1 |
| OligodT | 1μl |
| Volume of RNA used V1 | 2000ng/C1 |
TABLE 2 reverse transcription reaction System
| Volume of the system | 20μl |
| MLV-5×buffer | 4μl |
| dNTP | 2μl |
| RNAsin | 1μl |
| M-MLV | 1μl |
| RNA+OligodT | 11μl |
(3) qPCR experiments: dissolving SYBR, the primers and the cDNA, performing instantaneous centrifugation, mixing uniformly, and placing on ice; DNase/RDase-free water.
TABLE 3 PCR reaction system (20. mu.l)
| Reaction system | 20μl |
| Primer F (10 μm) | 1.2μl |
| Primer R (10 μm) | 1.2μl |
| SYBR | 10μl |
| cDNA | 2μl |
| DNase/RDase-free water | 5.6μl |
Instantaneous centrifugation; the 7500 program was run and conditions were set as in the table below.
TABLE 4 PCR procedure
TABLE 5 circ _0079591 primer sequences
| circ_0079591 | Sequence(5'->3') |
| Forward primer | ATCAGTCGGTGCCATCATCG(SEQ ID NO:2) |
| Reverse primer | GCGGCCATTTCATCAGGGATA(SEQ ID NO:3) |
| Product length | 154bp |
4. Statistical analysis:
SPSS22.0 software (SPSS inc., USA) was used. The continuous variable adopts Median (Median) and mean value + -standard deviation
Represents; the measurement data is tested by t, and the count data is tested by χ2And (6) checking. Diagnostic ability was judged by plotting Receiver Operating Characteristic (ROC) curves and calculating the corresponding area under the curve (AUC). The optimal cutoff value is selected as the value corresponding to the maximum sum of sensitivity and specificity. The area under the curve AUC variability was compared using the medcale10.4.7.0 software. P<0.05 (double-sided) is statistically different. And (4) analyzing the testing efficiency and the sample size by adopting R software, wherein the testing efficiency is that R is more than or equal to 0.8.
Results
1. High throughput assay results
The high throughput results showed that circ _0079591, circ _0082660, LncRNA non hsat167899.1, LncRNA ENST00000514235 expressed significantly different in the URSA group compared to the normal pregnancy control group, wherein, as shown in fig. 1, circ _0079591 expressed significantly lower in the URSA group compared to the normal pregnancy control group, P < 0.05. The applicant has protected as other patent applications the specific technical solutions of circ _0082660, LncRNA non hssat 167899.1 and LncRNA ENST 00000514235.
qPCR validation of circ _0079591 expression
As shown in fig. 2, circ _0079591 expression was significantly reduced in the URSA group compared to the normal control group (P < 0.05); as shown in figure 3, circ _0079591 showed significantly lower expression in the pregnancy failure group than in the pregnancy success group in the URSA patients, with P < 0.05.
3. Analysis of clinical data between groups
(1) Age: the age comparison between groups had no statistical significance (P >0.05) and were comparable (see Table 6, Table 7).
TABLE 6 age comparison between Normal and URSA groups
Note: the age between groups was tested for t, P > 0.05.
TABLE 7 comparison of age between pregnancy success and failure groups in URSA
Note: the age between groups was tested for t, P > 0.05.
Logistic regression analysis: the Logistic regression analysis of the normal pregnancy group and the URSA group is shown in Table 8, and the Logistic regression analysis of the pregnancy success group and the pregnancy failure group in URSA is shown in Table 9.
TABLE 8 Logistic regression analysis between normal pregnancy group and URSA group
the results of the single-factor Logistic regression model constructed by taking the circ _0079591 as an independent variable and the multi-factor Logistic regression model constructed after simultaneously correcting the age show that the statistical results obtained by correction and non-correction are consistent, so that the circ _0079591 is determined to have the potential of diagnosing URSA.
TABLE 9 Logistic regression analysis of pregnancy success and failure groups in URSA
the results of the single-factor Logistic regression model constructed by taking circ _0079591 as an independent variable and the multi-factor Logistic regression model constructed after age is corrected at the same time show that the statistical results obtained by correction and non-correction are consistent, so that the circ _0079591 is determined to have the potential of predicting URSA pregnancy outcome.
ROC curve analysis test efficacy and optimal cutoff value:
the results are shown in FIG. 4, with an area under the circ-0079591 ROC curve of 0.917 higher than that of the progestin (0.703), p < 0.05. The relative expression amount of circ _0079591 is lower than 1.833, and URSA is diagnosed; relative expression higher than 1.833, no URSA is diagnosed; the diagnostic efficiency was 91.70%.
The results are shown in FIG. 5, with an area under the circ _0079591ROC curve of 0.887, higher than that of the progestin (0.838), p < 0.05. The relative expression level of circ _0079591 is lower than 1.794, and the prognosis of URSA patients is evaluated as pregnancy failure; relative expression is higher than 1.794, and the prognosis of URSA patient is evaluated as success of pregnancy; the efficiency of the prognostic assessment was 88.70%.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
SEQUENCE LISTING
<110> institute of basic medicine of Shandong province academy of medical sciences
<120> application of circ _0079591 in serum as URSA diagnosis and pregnancy outcome assessment marker
<130> 2018
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 919
<212> DNA
<213> circ _0079591 sequence
<400> 1
agcactagac aaactgaatg gatttcagtt agagaatttc accttgaaag tagcctatat 60
ccctgatgaa atggccgccc agcaaaaccc cttgcagcag ccccgaggtc gccgggggct 120
tgggcagagg ggctcctcaa ggcaggggtc tccaggatcc gtatccaagc agaaaccatg 180
tgatttgcct ctgcgcctgc tggttcccac ccaatttgtt ggagccatca taggaaaaga 240
aggtgccacc attcggaaca tcaccaaaca gacccagtct aaaatcgatg tccaccgtaa 300
agaaaatgcg ggggctgctg agaagtcgat tactatcctc tctactcctg aaggcacctc 360
tgcggcttgt aagtctattc tggagattat gcataaggaa gctcaagata taaaattcac 420
agaagagatc cccttgaaga ttttagctca taataacttt gttggacgtc ttattggtaa 480
agaaggaaga aatcttaaaa aaattgagca agacacagac actaaaatca cgatatctcc 540
attgcaggaa ttgacgctgt ataatccaga acgcactatt acagttaaag gcaatgttga 600
gacatgtgcc aaagctgagg aggagatcat gaagaaaatc agggagtctt atgaaaatga 660
tattgcttct atgaatcttc aagcacattt aattcctgga ttaaatctga acgccttggg 720
tctgttccca cccacttcag ggatgccacc tcccacctca gggccccctt cagccatgac 780
tcctccctac ccgcagtttg agcaatcaga aacggagact gttcatctgt ttatcccagc 840
tctatcagtc ggtgccatca tcggcaagca gggccagcac atcaagcagc tttctcgctt 900
tgctggagct tcaattaag 919
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence
<400> 2
atcagtcggt gccatcatcg 20
<210> 3
<211> 21
<212> DNA
<213> Artificial sequence
<400> 3
gcggccattt catcagggat a 21
Claims (4)
1. Use of an agent for detecting circ _0079591 in the manufacture of a product for diagnosing URSA and/or for assessing pregnancy outcome of a patient with URSA;
the reagent is a quantitative detection reagent;
the nucleic acid sequence of the circ _0079591 is shown as SEQ ID NO. 1;
the circ _0079591 is circ _0079591 in a serum sample;
the reagents include forward primer 5'-ATCAGTCGGTGCCATCATCG-3' and reverse primer 5'-GCGGCCATTTCATCAGGGATA-3' for circ _ 0079591.
2. The application of the gene chip for detecting circ _0079591 in preparing products for diagnosing URSA and/or evaluating pregnancy outcome of URSA patients;
the nucleic acid sequence of the circ _0079591 is shown as SEQ ID NO. 1;
the circ _0079591 is circ _0079591 in a serum sample;
the gene chip includes forward 5'-ATCAGTCGGTGCCATCATCG-3' and reverse 5'-GCGGCCATTTCATCAGGGATA-3' primers for circ _0079591 and probes that hybridize to the nucleic acid sequence of circ _ 0079591.
3. Use according to claim 2, characterized in that: the product can diagnose whether the patient has URSA and/or evaluate pregnancy outcome of the URSA patient by detecting the expression level of circ _0079591 in serum.
4. Use according to claim 3, characterized in that: the product for detecting the expression level of circ _0079591 in serum comprises: the expression level of circ _0079591 is detected by RT-PCR, real-time quantitative PCR, gene chip or gene sequencing to diagnose URSA and evaluate products of pregnancy outcome of URSA patients.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810602718.6A CN108424963B (en) | 2018-06-12 | 2018-06-12 | Application of circ _0079591 in serum as URSA diagnosis and pregnancy outcome assessment marker |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810602718.6A CN108424963B (en) | 2018-06-12 | 2018-06-12 | Application of circ _0079591 in serum as URSA diagnosis and pregnancy outcome assessment marker |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108424963A CN108424963A (en) | 2018-08-21 |
| CN108424963B true CN108424963B (en) | 2021-10-22 |
Family
ID=63164830
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810602718.6A Active CN108424963B (en) | 2018-06-12 | 2018-06-12 | Application of circ _0079591 in serum as URSA diagnosis and pregnancy outcome assessment marker |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108424963B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111593116A (en) * | 2020-06-18 | 2020-08-28 | 复旦大学附属妇产科医院 | Recurrent abortion biomarker and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107338324A (en) * | 2017-09-08 | 2017-11-10 | 南京医科大学 | For the serum lncRNA marks of acatalepsia reason recurrent miscarriage, primer sets and application and kit |
| CN107937512A (en) * | 2017-11-23 | 2018-04-20 | 南京医科大学 | For diagnosing serum microRNA markers, primer sets and application and the kit of recurrent miscarriage |
-
2018
- 2018-06-12 CN CN201810602718.6A patent/CN108424963B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107338324A (en) * | 2017-09-08 | 2017-11-10 | 南京医科大学 | For the serum lncRNA marks of acatalepsia reason recurrent miscarriage, primer sets and application and kit |
| CN107937512A (en) * | 2017-11-23 | 2018-04-20 | 南京医科大学 | For diagnosing serum microRNA markers, primer sets and application and the kit of recurrent miscarriage |
Non-Patent Citations (4)
| Title |
|---|
| Circular RNAs expressed in chorionic villi are probably involved in the occurrence of recurrent spontaneous abortion;Yating Qian等;《Biomedicine & Pharmacotherapy》;20170214;第88卷;摘要、第1155~1160页、表2-表3、图1-图6 * |
| MicroRNA Profiles in Spontaneous Decidualized Menstrual Endometrium and Early Pregnancy Decidua with Successfully Implanted Embryos;Wang Y等;《PLOS One》;20160106;第11卷(第1期);第1~14页 * |
| Role of IGF2BP3 in trophoblast cell invasion and migration;W Li等;《Cell Death and Disease》;20140123;第5卷;第1~11页 * |
| 环状RNA 在生殖和围产领域的研究进展;张爽等;《重庆医科大学学报》;20170622;第42卷(第8期);第976~980页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108424963A (en) | 2018-08-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109097477B (en) | circRNA marker for breast cancer diagnosis and application thereof | |
| JP6092655B2 (en) | Classification of test body fluid samples | |
| US20220228223A1 (en) | Squamous cell carcinoma diagnostic or prognosis prediction marker and use thereof | |
| EP4006151A1 (en) | Esophageal cancer biomarker and use therefor | |
| CN103764843B (en) | For the method and composition for the risk for determining heart failure or heart failure | |
| CN108130368B (en) | Application of lncRNA in preparation of product for diagnosing or predicting adolescent idiopathic scoliosis | |
| CN111269985B (en) | Application of hsa _ circRNA6448-14 in diagnosis and prognosis prediction of esophageal squamous cell carcinoma | |
| CN108866187B (en) | Long-chain non-coding RNA marker related to lung cancer auxiliary diagnosis and application thereof | |
| WO2013179672A1 (en) | Method for assessing endometriosis | |
| CN112725438B (en) | Endometrial polyp methylation marker combination, detection kit and application | |
| CN108424963B (en) | Application of circ _0079591 in serum as URSA diagnosis and pregnancy outcome assessment marker | |
| CN107312865B (en) | Purposes of the LOC100130111 in preparation osteosarcoma diagnostic products, therapeutic agent | |
| CN108707659B (en) | Application of LncRNA in serum as URSA diagnosis and pregnancy outcome assessment marker | |
| CN108753950B (en) | Application of LncRNA in serum as URSA diagnosis and pregnancy outcome assessment marker | |
| CN108753949B (en) | Application of circ _0082660 in serum as URSA diagnosis and pregnancy outcome assessment marker | |
| CN112266955B (en) | Ankylosing spondylitis diagnostic marker and application thereof | |
| CN108424960B (en) | Application of LncRNA as deep venous thrombosis diagnosis marker | |
| EP4010498B1 (en) | Method for diagnosing breast cancer | |
| CN111304322B (en) | Preparation method of kit for joint detection of esophageal cancer by four novel circRNAs | |
| KR102627788B1 (en) | Gastric cancer biomarkers and their uses | |
| CN108384849B (en) | Application of circ _0005396 in serum as diagnostic marker of deep vein thrombosis | |
| CN114746551A (en) | Marker for diagnosing colorectal cancer, method for assisting diagnosis of colorectal cancer, method for collecting data to be used for diagnosis of colorectal cancer, diagnostic kit for colorectal cancer, therapeutic agent for colorectal cancer, method for treating colorectal cancer, and method for diagnosing colorectal cancer | |
| CN108588217B (en) | Application of LncRNA as deep venous thrombosis diagnosis marker | |
| CN112522391A (en) | Application of hsa _ circ _0008961 as gout diagnosis marker | |
| CN110144352B (en) | Molecular marker for early diagnosis of orthopedic diseases |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20210927 Address after: 250355 4655, University Road, University Science Park, Changqing District, Ji'nan, Shandong Applicant after: SHANDONG University OF TRADITIONAL CHINESE MEDICINE Applicant after: INSTITUTE OF BASIC MEDICINE, SAMS Address before: 250062 Ji'nan City, Shandong Province, No. ten, No. 18877 Applicant before: INSTITUTE OF BASIC MEDICINE, SAMS |
|
| TA01 | Transfer of patent application right | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |