CN107881228A - A kind of molecular marked compound related to adolescent idiopathic scoliosis and its application - Google Patents

A kind of molecular marked compound related to adolescent idiopathic scoliosis and its application Download PDF

Info

Publication number
CN107881228A
CN107881228A CN201711394662.1A CN201711394662A CN107881228A CN 107881228 A CN107881228 A CN 107881228A CN 201711394662 A CN201711394662 A CN 201711394662A CN 107881228 A CN107881228 A CN 107881228A
Authority
CN
China
Prior art keywords
idiopathic scoliosis
adolescent idiopathic
mir210hg
scoliosis
marked compound
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201711394662.1A
Other languages
Chinese (zh)
Inventor
王以朋
李子全
李政垚
刘书中
王牧川
牛潼
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Peking Union Medical College Hospital Chinese Academy of Medical Sciences
Original Assignee
Peking Union Medical College Hospital Chinese Academy of Medical Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Peking Union Medical College Hospital Chinese Academy of Medical Sciences filed Critical Peking Union Medical College Hospital Chinese Academy of Medical Sciences
Priority to CN201711394662.1A priority Critical patent/CN107881228A/en
Publication of CN107881228A publication Critical patent/CN107881228A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Abstract

The invention discloses a kind of new molecular marked compound ENST00000602322.1 and/or MIR210HG related to adolescent idiopathic scoliosis, and further confirm that ENST00000602322.1 expresses downward in adolescent idiopathic scoliosis patient, MIR210HG up-regulated expressions in adolescent idiopathic scoliosis patient, it can be applied in diagnosis or indication adolescent idiopathic scoliosis product is prepared.Purposes the invention also discloses the molecular marked compound in the kit for preparing diagnosis or indication adolescent idiopathic scoliosis simultaneously.It can be diagnosed using the molecular marked compound early stage adolescent idiopathic scoliosis occurs, it is fast and effective, not only the saving of the early treatment to adolescent idiopathic scoliosis and medical treatment cost is significant, and provides therapy target and important evidence for clinical practices such as gene therapy, drug therapies.

Description

A kind of molecular marked compound related to adolescent idiopathic scoliosis and its application
Technical field
The present invention relates to biological technical field, and in particular to ENST00000602322.1 and/or MIR210HG is as blue or green few The molecular marked compound of year idiopathic scoliosis and its application.
Background technology
Idiopathic scoliosis (Idiopathic Scoliosis, IS) is that a kind of incidence of disease is high (incidence of disease 1.3%), sternly Ghost image rings the disease of quality of life, constitutes about the 80% of scoliosis morbidity sum.Baby children is divided into according to the difference of age of onset Youngster's idiopathic scoliosis (Infantile Idiopathic Scoliosis, IIS) (0.3 years old), juvenile's idiopathic backbone side Convex (Juvenile Idiopathic Scoliosis, JIS) (3-9 year), adolescent idiopathic scoliosis (Adolescent Idiopathic Scoliosis, AIS) (10-16 year).Wherein AIS accounts for about 80% in idiopathic scoliosis patient groups. AIS teiology is not yet clear and definite, and the description to its pathogenesis at present has a variety of hypothesis, but all can not explain AIS's well Occur.
Existing research shows that AIS has obvious genetic predisposition.Both at home and abroad to its genomics, albumen Though the numerous studies in the directions such as matter group have obtained certain achievement, conclusion is not consistent, can not be well to AIS hair Raw, progress makes satisfied explanation.Among the gene information huge to the mankind constantly understanding, the base not in traditional code albumen Cause, Noncoding gene sequence are gradually recognized by people, and start the important function being presented in some diseases mechanism.Long-chain is non- Coding RNA (10ng non-codingRNAs, lncRNAs) is exactly one kind therein, and it is a kind of transcript length in eukaryotic Degree does not have encoding histone function RNA molecule more than 200nt's.Current research constantly finds the complicated mechanism of action of lncRNA With function, by being used as regulation and control person between gene information and its product, the occurrence and development to numerous diseases of the mankind rise emphatically for it Act on.This research passes through what is selected with biochip technology in peripheral blood using lncRNA as main study subject LncRNA, real-time quantitative PCR detection expression is carried out in musculature to it, from this New Century Planned Textbook of long-chain non-coding RNA Explored, expect the understanding for there are some new to AIS pathogenesis.
The content of the invention
In order to solve the above problems, an object of the present invention is to provide one kind and adolescent idiopathic scoliosis phase The molecular marked compound of pass.
The second object of the present invention is to provide a kind of diagnostic kit for being used to detect adolescent idiopathic scoliosis.
Based on this, the present invention uses Agilent human lncRNA Array V3.0 chip technologies, believes with reference to biology Breath learns analysis method, studies the lncRNA differential expression situations between case group and Normal group, and that screens differential expression can Muscle, skeletal system related lncRNAs ENST00000602322.1 and/or MIR210HG can be influenceed, and applies RT-PCR Proofing chip result.Further, the present invention by differential expression level in paraspinal muscle of the lncRNA of Analysis and Screening for The pathogenesis of further investigated AIS patient, the method for treating AIS and the correlation function that improves lncRNA have important guidance Meaning.
First, the present invention provides a kind of molecular marked compound related to adolescent idiopathic scoliosis, the molecule mark Note thing is lncRNA ENST00000602322.1 and/or lncRNA MIR210HG.
Preferably, the ENST00000602322.1 expresses downward in adolescent idiopathic scoliosis patient；It is described MIR210HG up-regulated expressions in adolescent idiopathic scoliosis patient.
Further, the invention provides the ENST00000602322.1 and/or MIR210HG to prepare detection green grass or young crops less Application in year idiopathic scoliosis product.
Preferably, the product includes genetic chip, kit or preparation.
Further, it is used to detect the diagnostic kit of adolescent idiopathic scoliosis present invention also offers a kind of, The diagnostic kit contain the molecular marked compound ENST00000602322.1 related to adolescent idiopathic scoliosis and/ Or MIR210HG.
Preferably, the kit includes：Specific amplification adolescent idiopathic scoliosis correlation lnRNA ENST00000602322.1 and/or MIR210HG primer.
Preferably, the primer includes following nucleotide sequence：
Specific amplification ENST00000602322.1 primers：
Sense primer SEQID NO.1：ACCTTCCCACCTACCAGTCT；
Anti-sense primer SEQID NO.2：CTGGGAAACCACCATAGCTT；
Specific amplification MIR210HG primers：
Sense primer SEQID NO.3：CTTCTGTGTGTTTCTGCCGC；
Anti-sense primer SEQID NO.4：TCGCCCAGAGTTCCTACTCA.
Preferably, the kit also includes following components：
(1) total RNA extraction reagent in sample；
(2) Reverse Transcription；
(3) quantitative PCR reagent；
(4) normal control sample cDNA.
Preferably, the RNA extracts reagents include Trizol, chloroform, isopropanol and 75% ethanol etc.；Reverse transcription reagents bag Include RT Buffer, reverse transcriptase and Oligo dT and Random6mers primers etc.；The quantitative PCR reagent includes PCR buffer solutions, SYBR Green fluorescent dyes, dNTPs composition SYBR Green PCR systems, primer and RNase Free H2O；The normal sample cDNA：As negative control with detecting the common quantitative PCR detections of sample cDNA, often Individual reaction system use is with detecting sample cDNA equal amounts.
Preferably, the sample includes serum, urine or tissue samples.
Beneficial effects of the present invention are as follows：
The invention discloses a kind of new molecular marked compound related to adolescent idiopathic scoliosis ENST00000602322.1 and/or MIR210HG, and further confirm ENST00000602322.1 in adolescent idiopathic ridge Express and lower in the convex patient in post side, MIR210HG up-regulated expressions in adolescent idiopathic scoliosis patient, can be examined in preparation Applied in disconnected or indication adolescent idiopathic scoliosis product.Examined simultaneously the invention also discloses the molecular marked compound in preparation Purposes in disconnected or indication adolescent idiopathic scoliosis kit.Can be in teenager Te Fa using the molecular marked compound Property early stage for occurring of scoliosis diagnosed, it is fast and effective, not only to the early treatment of adolescent idiopathic scoliosis and The saving of medical treatment cost is significant, and provides therapy target and again for clinical practices such as gene therapy, drug therapies Will foundation.
Brief description of the drawings
Fig. 1 qRT-PCR verify gene chip results.
Embodiment
Following examples are used to illustrate the present invention, but are not limited to the scope of the present invention.Unless otherwise specified, embodiment In the conventional meanses that are well known to those skilled in the art of used technological means, reagent used can be commercially available.
The integral experiment scheme of the present invention is as follows：
1st, the normal control population by being matched to 4 adolescent idiopathic scoliosis patients and 4 ages, sex Peripheral blood.Sieved by biochip technology and the bioinformatics technique such as GO, Pathway analysis and CNC networks structure Select expression otherness and it may functionally influence the lncRNA of muscle, skeletal system ENST00000602322.1 and MIR210HG；
2nd, its expression is verified by qRT-PCR, it is as a result consistent with chip results.
3rd, by qRT-PCR in the paraspinal muscle of case group diseased region and control group corresponding site lncRNA expressions Verified, inquire into lncRNA whether patient's paraspinal muscle different expression be present and to the hair of teenager spy's hair style scoliosis Hair tonic exhibition plays an important role.
The major experimental reagent that the present invention uses is as follows：
Trizol LS (Ambion companies of the U.S.)；Isopropanol, chloroform, absolute ethyl alcohol (Solution on Chemical Reagents in Shanghai Co., Ltd)； RNA purification kits (German QIGEN companies)；PrimeScript RT reagent kit reverse transcription reagent box (precious biological work Journey Co., Ltd)；Quantitative PCR detection kit (precious bioengineering Co., Ltd) genechip detection uses Agilent Human lncRNA Array V3.0, commission Beijing Bo Ao Bioisystech Co., Ltd are carried out；Cy3-dCTP(GE Healthcare)；20xSSC (Beijing Boao Biological Co., Ltd)；Agilent one-color RNA Spike-in kit (Agilent companies of the U.S.).
The sample of embodiment 1 collects standard
1st, research object
Case-control study method is taken in this research, and periphery blood specimen case group is selected from BJ Union Hospital's row backbone The Chinese Han women AIS of the convex orthopaedy in side, control group is from sex, age, the national normal female to match with case group.
Chinese Han women AIS of the paraspinal muscle sample case group selected from BJ Union Hospital's row patients with scoliosis undergoing suffers from Person, control group are sex, age, the national intervertebral disc degeneration patient with operation without deformity of spine to match with case group.
1.1 case group
In April, 2013 in March, 2014 is all from the adolescent idiopathic scoliosis patient of our hospital's operative treatment, choosing Take the Han nationality of complete clinical data and imaging data (including backbone x lines, CT and three-dimensional reconstruction, full backbone MRI) blue or green few Year adolescent idiopathic scoliosis.
Case inclusive criteria
1. adolescent idiopathic scoliosis diagnosis is clear and definite；
2. women；
3. age 10-18 year；
4. informed consent；
5. there are complete clinical data and imaging data (including backbone x lines, CT and three-dimensional reconstruction, full backbone MRI).
Exclusion standard
1. other clear and definite deformity of spine patients of the cause of disease, such as congenital scoliosis, neuromuscular type scoliosis, backbone Wound, infection, tumour etc.；
2. merge other patients with chronic diseases (can cause grow impacted)：
3. the incomplete AIS patient of imaging data, clinical data；
4. the AIS patient of informed consent is not obtained.
1.2 control group
The crowd that disease is known without deformity of spine, without oneself that sex, nationality, age and case match；Wherein peripheral blood mark Originally the normal population being selected from, paraspinal muscle sample are selected from intervertebral disc degeneration patient.Due to more difficult in terms of intervertebral disc degeneration patient age Perfect matching, thus its age is suitably expanded to 90 years old.
Inclusive criteria
1. informed consent；
2. women；
3. the age<30 years old；
4. there are complete clinical data and imaging data (x-ray exclusion deformity of spine).
Exclusion standard
1. informed consent is not obtained；
2. vertebra has deformation patients；
3. the disease of injured nerve muscle systems be present；
4. merge other patients with chronic diseases.
The lncRNA of embodiment 2 screening
Using 4 adolescent idiopathic scoliosis patient samples as AIS groups, using 4 Normal groups as Normal group (NC groups), empty stomach peripheral blood is gathered, and extract total serum IgE.
1st, the Total RNAs extraction of periphery whole blood
1) 0.25mL peripheral bloods and 0.75mL Trizol LS reagent are added in each EP pipes freezes mixed liquor, Acutely rock mixing；
2) it is incubated 5 minutes at room temperature, will be completely dissociated nucleic acid-protein compound；
3) 0.2mL chloroforms are added in each EP pipes (to add in the Trizol LS reagent reagent samples i.e. per 0.75mL 0.2mL chloroforms), cover tightly EP lids.Acutely rock 15 seconds；
4) 3 minutes are stood at room temperature, organic phase and inorganic phase is quickly and effectively separated；
5) centrifuged 10 minutes under conditions of 12000G at 4 DEG C with refrigerated centrifuge；
6) it is careful after centrifuging to take out in EP pipes, it is seen that mixing liquid therein is divided into three layers：The red phenol chloroform phase of lower floor, Intermediate layer white egg white and the colourless aqueous layer on upper strata.RNA is all present in aqueous layer needed for this experiment.
7) aqueous layer is carefully transferred to another EP pipes (being careful not to be drawn onto intermediate layer) with micropipettor；
8) 0.6mL isopropanols are added in aqueous layer, 15-30 DEG C is incubated 10 minutes after mixing, allows RNA to have in aqueous layer Effect ground precipitation (hydrophobic effect that isopropanol passes through-OH so that the hydrophilic radical in RNA chains is protected)；
9) centrifuged 10 minutes under conditions of 12000G at 4 DEG C with refrigerated centrifuge；
10) supernatant is removed, the ethanol of lmL 75% is added in each EP pipes (per the sample of 0.75mL TRIzol reagents homogenate At least ethanol of lmL 75% is added in product), gently turn upside down washing EP tube walls；
11) centrifuged 5 minutes under conditions of 12000G at 4 DEG C with refrigerated centrifuge, carefully discard ethanol；
12) above-mentioned 10-11 steps are repeated, wash RNA precipitate again；
13) remove ethanol solution after, by EP pipes be placed in air at room temperature dry RNA precipitate 5-10 minutes (cannot centrifuge Or heat drying, otherwise RNA will be difficult dissolving)；
14) added with micropipettor in EP pipes without RNase water 15ul, flick and softly blown and beaten repeatedly with suction pipe, room Incubation 10 minutes, dissolve RNA；
15) gained RNA can be used for experiment in next step or in -80 DEG C of preservation.
2nd, RNA purifying
Purity requirements of the Agilenthuman lncRNA ArrayV3.0 to sample extraction RNA is higher, and therefore, we adopt The cell total rna of extraction is purified with RNaseyMini Kit (Qiagenp/n 74104) kits, specific steps are with reference to explanation Book.
3rd, RNA quality inspections
With the detection of NanoDrop ND-1000 types spectrophotometric determination extraction RNA concentration and purity；And denaturation Agarose gel electrophoresis detects RNA quality, and whether up-to-standard the RNA sample that can be extracted from electrophoresis result with preliminary judgement is, Whether can be used for further analyzing.And then the extraction situation of RNA sample is detected by NanoDrop1000 spectrophotometers, The sample requirement of lncRNA chip analysis：OD260/OD280 is 1.8-2.0.
RNA quality judging standards：The OD260/OD280 values of RNA samples are between 1.8-2.0；Total serum IgE electrophoresis pattern has clearly Clear 28S, 18S band；70 DEG C of water-baths be incubated 1 hour after electrophoresis pattern and the collection of illustrative plates no significant difference before water-bath insulation.
4th, 1ncRNAs chips detect
4.1 total serum IgEs synthesize cDNA
(1) reverse transcription synthesis First Strand cDNA
1. taking 5 μ L Total RNA (100-500ng), it is added in the Eppendorf centrifuge tubes of 0.2mL nuclease frees.
2. add and join (Cat.No.360030) 1 μ L outside brilliant core gene expression profile, while respective volume is added according to table 1 below Agilent spike-in.
The reaction volume of table 1
3. preparing reverse transcription MasterMix (as shown in table 2 below is single reaction system dosage) on ice, gently mix, It is put on ice after of short duration centrifugation.
The reaction system of table 2
4. taking 5 μ L reverse transcription MasterMix, it is added in the 0.2mL centrifuge tubes containing Total RNA samples.Reverse transcription is most End reaction volume is l0 μ L.
5. soft pressure-vaccum mixes 2-3 times, brief centrifugation, it is placed on ice.
6. reverse transcription centrifuge tube is placed in PCR instrument, 25 DEG C of reactions 1h, 42 DEG C of reactions 1h, 4 DEG C of holding more than 5min.Take Go out reverse transcription centrifuge tube, brief centrifugation, be placed on ice, be ready for Second Strand cDNA synthetic reactions.
(2) Second Strand cDNA are synthesized
1. Second Strand Master Mix (table 3 below show single reaction system dosage) are prepared on ice, gently It is light to mix, ice bath after of short duration centrifugation.
The reaction system of table 3
2. take in 6. 50 μ L Second Strand Master Mix are added to First Strand cDNA synthesis steps In reaction tube, mixed volume is 60 μ L；Pressure-vaccum mixes 2-3 times, brief centrifugation, is placed on ice.
3. the second chain synthesis centrifuge tube is placed in PCR instrument, 16 DEG C of reaction 1h (closing PCR instrument lid heating function), 65 DEG C React l0min, 4 DEG C of holding more than 5min.
4. reaction tube is placed in by reaction after terminating continues synthetic reaction on ice, or freezes in -20 DEG C rapidly.
4.2 in-vitro transcriptions synthesize cRNA
1. prepare in-vitro transcription Master Mix (table 4 below show single reaction system dosage), gently mix, it is of short duration from Solution is collected in ttom of pipe by the heart.
The reaction system of table 4
2. in the reaction tube in taking 30 μ L IVT Master Mix to Second Strand cDNA synthesis steps 4., blow Persorption is even, and brief centrifugation is placed on ice.
3. in-vitro transcription synthesis centrifuge tube is placed in PCR instrument, 40 DEG C of reaction 16h, 4 DEG C of holdings.
After 4. reaction terminates, brief centrifugation, using RNeasy Mini Kit (Qiagen p/n 74104) kits to production Thing is purified, and cRNA products after purification are quantified using ultraviolet specrophotometer.
4.3 cRNA reverse transcriptions
1. taking the μ g of cRNA purified products 10, adjustment volume to 22 μ L, it is added in 0.2mL nuclease free centrifuge tubes, and adds Enter 2 μ L Random Primer mixings, be placed in PCR instrument, 70 DEG C of 5min, 25 DEG C of 5min, 4 DEG C of 2min, brief centrifugation collection liquid Body is positioned on ice to ttom of pipe.
2. cRNA reverse transcriptions MasterMix (table 5 below show single reaction system dosage) is prepared, it is soft to mix, it is of short duration Solution is collected in ttom of pipe by centrifugation.
The reaction system of table 5
3. taking 16 μ L reverse transcriptions MasterMix to add step 1. in reacted centrifuge tube, cumulative volume is 40 μ L, and pressure-vaccum mixes It is even 2-3 times, brief centrifugation.
4. cRNA reverse transcription centrifuge tubes are placed in PCR instrument, 25 DEG C of reaction l0min, 40 DEG C of reaction 1.5h, 70 DEG C are reacted 10min, 4 DEG C of reaction 5min, centrifuge tube are placed on ice.
5. operating on ice, 2 μ L RNase H mixings are added in cRNA reverse transcription centrifuge tubes, brief centrifugation, are placed in PCR instrument On, 37 DEG C of reactions 45min, 95 DEG C of reactions 5min, 4 DEG C of maintenance 5min.
After 6. reaction terminates, it can be frozen at -20 DEG C overnight, or use Nucleospin immediately@(MN is public by Extract II Department, Cat.No.740609.250) kit progress purification process.
4.4 fluorescence labeling
1. the cDNA bulk products obtained reverse transcription and after purification are concentrated into 14 μ L, 4 μ L Random Primer are added Mix, be placed in after of short duration centrifugation in PCR instrument, 95 DEG C of denaturation 3min, ice bath 5min.
2. sequentially adding reagent in table 6,2-3 mixing is blown and beaten using pipettor.
3. after of short duration centrifugation, it is placed in PCR instrument, 37 DEG C of reaction 1.5h, 70 DEG C of reaction 5min, 4 DEG C keep.
The reaction system of table 6
After 4. fluorochrome label reaction terminates, Nucleospin is used@ExtractII (MN companies, Cat.No.740609.250) kit carries out cDNA purifying, and fluorescence labeling after purification is produced using ultraviolet specrophotometer Thing carries out Fluorescent dye incorporation amount and nucleic acid quantification.
4.5 chip hybridization
(1) marked product hybridization prepares
1. through Nucleospin@Marked product after Extract II kits, elution volume is in 30 μ L or so.
2. single tube is marked, (cy3-dCTP) purifying eluted product vacuumizes concentration or moisturizing volume is standby to 27.5 μ L.
(2) system preparation, hybridization reaction are hybridized
1. by ready marked product, mixed with reagent in table 7 below.
The reaction system of table 7
2. taking 100 μ L hybridization solutions to be loaded into hybridization cover plate fence, " Agilent " label gently covers fence down, After installing Agilent hybridizing boxes and screwing, hybridizing box can be gently horizontally rotated, check liquid in the hybridization cavity of each sub- battle array Whether flow.
3. hybridizing box is arranged on the rotor of hybrid heater, pay attention to being symmetrically installed, while addition is appropriate ultrapure in pallet After water, 45 DEG C of hybridized overnights.
4.6 chips clean and scanning
After 1. chip hybridization terminates, taking-up chip is washed in rich S1ide Washer8 chips difficult to understand to be cleaned in instrument, cleans journey Sequence is as follows：
Washing lotion I：0.2%SDS, 2 × SSC, 42 DEG C of 120S are cleaned 2 times.
Washing lotion II：0.2%SDS, 2 × SSC, 42 DEG C of 80S are cleaned 3 times.
2. after the completion of cleaning procedure, centrifuge dripping is to be scanned.
3. being scanned the chip after cleaning using Agilent chip scanners (G2565CA), obtain hybridizing picture.
5th, chip results are analyzed
By using the human lncRNA Array V3.0y of Agilent companies of the U.S., newest RefSeq is covered, The lncRNA phases such as UCSC, Ensembl, H-invDB, Hox lncRNAs, RNAdb, T-UCRs, LncRNA-a, CombinedLit Close the up-to-date information of database.Using 4 adolescent idiopathic scoliosis patient samples as AIS groups, using 4 Normal groups as Normal group (NC groups).The chip after hybridization is scanned to obtain image using Agilent chip scanners.Chip scanning Image passes through NimbkScan softwares (version 2.5) and Agilent GeneSpring GX softwares (version 11.5.1) After analyzing and processing, the lncRNA expression data of AIS groups and NC groups are obtained：Obtained again by folding multiplying power (Fold Change) screening The lncRNA data of significant difference expression are obtained, parameter selection standard is FC>2.0, P<0.05.The wherein lncRNA of the high expression of difference There are 120, it is 3.819 times that wherein the high expression of difference, which folds multiple highest, and the lncRNA of difference low expression there are 19, wherein poor It is 9.781 times that different low expression, which folds multiple highest,.
In order to more preferably analyze the function of difference expression gene, inventor further passes through GO, Pathways analysis and structure The possibility for building a variety of bioinformatic analysis screening differential expressions such as CNC gene expression networks is related to nerve, muscle, bone LncRNAs；
According to the lncRNA of differential expression site, differential expression multiple, lncRNAs functional analyses and investigation document feelings Condition, lncRNAs ENST00000602322.1 that 1 differential expression lowers and 1 differential expression up-regulation are screened lncRNAs MIR210HG。
The qRT-PCR large samples of embodiment 3 are verified
Using the 20 AIS patients and 20 normal females of age-matched as research object, choose differential expression significantly, ENST00000602322.1, MIR210HG that predictive display may participate in AIS morbidities carry out real-time quantitative PCR checking.
1st, the Total RNAs extraction of periphery whole blood
Step is the same as shown in embodiment 2.
2nd, the process of reverse-transcription of cDNA synthesis：
By the qualified RNA reverse transcriptions of quality inspection into cDNA, comprise the following steps that：
1) DNA in RNA sample is removed：The reagent added successively in centrifuge tube in table 8 below, and the mixing that is vortexed.
2) somewhat centrifuge, be placed in PCR instrument, 42 DEG C are reacted 5 minutes；
3) it is as shown in table 9 to prepare reverse transcription system, adds oneself and completes in the centrifuge tube of step 2, and the mixing that is vortexed；
4) somewhat centrifuge, be placed in PCR instrument, 37 DEG C are reacted 30 minutes, and 85 DEG C are reacted 5 seconds；And cDNA is stored in -20 DEG C Refrigerator.
The reaction reagent of table 8
Ingredient names Usage amount
RNA 1μL
gDNAEraser 1μL
5xgDNAEraserBuffer 2μL
RNaseFreedH2O 10 μ L altogether
The reverse transcription system of table 9
3、qRT-PCR
Primer is synthesized by Beijing Inventrogen bioengineering Co., Ltd, and primer is as shown in table 10：
The primer sequence of table 10
Described reaction system is as follows：
The reaction system of table 11
Amplification program is：94 DEG C of reaction 5min；Denaturation and amplification and extension, 94 DEG C reaction 30s, 58 DEG C reaction 30s, 72 DEG C 40s is reacted, totally 40 circulations；72 DEG C of reaction 7min.
4th, result
According to qRT-PCR relative quantification formula：2-ΔΔCt× 100%, compare ENST00000602322.1 and As a result MIR210HG is shown, expression of the ENST00000602322.1 in case group in case group and the expression of control group Level is less than control group, and expressions of the MIR210HG2 in case group is higher than control group；This 2 lncRNAs are in enlarged sample In preferably verified, qPCR result and chip data trend are basically identical (Fig. 1).
Verified in the LncRNA paraspinal muscles of embodiment 4
1st, the selection of paraspinal muscle
The relative position paraspinal muscle of paraspinal muscle and control group (4) at diseased region by collecting AIS patient (21), QPCR is carried out to the lncRNA screened and detects its expression in paraspinal muscle.
2nd, muscle Total RNAs extraction
1) musculature of preservation is taken out from liquid nitrogen, with liquid nitrogen in mortar by its grind into fine powder；
2) about 1.2mL TRIzol reagents are added in mortar, and the TRIzol grindings of solidification are made into itself and powdered muscle Tissue is well mixed；
3) the inferior solid-state TRIzol of room temperature melts, and mixes muscle powder with transferring them to 1.5mL centrifuge tubes after TRIzol In；
4) it is incubated 5 minutes at room temperature, ribosome is decomposed completely；
5) 0.2mL chloroforms are added in each EP pipes (to add in the Trizol LS reagent reagent samples i.e. per 0.75mL 0.2mL- chloroforms), cover tightly EP lids.Acutely rock 15 seconds；
6) 3 minutes are stood at room temperature, organic phase and inorganic phase is quickly and effectively separated；
7) centrifuged 10 minutes under conditions of 12000G at 4 DEG C with refrigerated centrifuge；
8) it is careful after centrifuging to take out in EP pipes, it is seen that mixing liquid therein is divided into three layers：The red phenol chloroform phase of lower floor, Intermediate layer white egg white and the colourless aqueous layer on upper strata.RNA is all present in aqueous layer needed for this experiment.
9) aqueous layer is carefully transferred to another EP pipes (being careful not to be drawn onto intermediate layer) with micropipettor；
10) 0.6mL isopropanols are added in aqueous layer, 15-30 DEG C is incubated 10 minutes after mixing, allows RNA in aqueous layer Effectively precipitate (hydrophobic effect that isopropanol passes through-OH so that the hydrophilic radical in RNA chains is protected)；
11) centrifuged 10 minutes under conditions of 12000G at 4 DEG C with refrigerated centrifuge；
12) supernatant is removed, the ethanol of lmL 75% is added in each EP pipes (per the sample of 0.75mL TRIzol reagents homogenate At least lmL75% ethanol is added in product), gently turn upside down washing EP tube walls；
13) centrifuged 5 minutes under conditions of 12000G at 4 DEG C with refrigerated centrifuge, carefully discard ethanol：
14) above-mentioned 10-11 steps are repeated, wash RNA precipitate again；
15) remove ethanol solution after, by EP pipes be placed in air at room temperature dry RNA precipitate 5-10 minutes (cannot centrifuge Or heat drying, otherwise RNA will be difficult dissolving)；
16) added with micropipettor in EP pipes without RNase water 20-40 μ L (according to the required RNA solution concentration prepared Adjust DEPC water), flick and softly blown and beaten repeatedly with suction pipe, room incubation 10 minutes, dissolve RNA；
17) gained RNA can be used for experiment in next step or in -80 DEG C of preservation；
18) using NanoDrop ND.1000 types ultraviolet specrophotometer measure RNA concentration and purity.
3rd, the process of reverse-transcription of cDNA synthesis：
Step is the same as shown in embodiment 3.
4、qRT-PCR
Step is the same as shown in embodiment 3.
5th, experimental result
The detection of expression is carried out to the lncRNA screened in AIS patient and control group paraspinal muscle, is found ENST00000602322.1 expression has different degrees of reduction compared with control group in AIS patient；MIR210HG2's Expression has different degrees of rise compared with control group.
Prompting, low expression level and MIR210HG2 height in paraspinal muscle of the ENST00000602322.1 in paraspinal muscle Morbidity of the horizontal expression to AIS plays an important role.
The preparation of the kit of embodiment 5
The primer sets obtained based on embodiment 3, assemble detection AIS diagnostic kits of the present invention, specific amplified ENST00000602322.1, MIR210HG primer pair such as SEQ ID NO:1-2 and SEQ ID NO:Shown in 3-4, and special expansion Increase the primer pair such as SEQ ID NO of house-keeping gene (GAPDH):Shown in 5-6；Also include SYBR Green PCR bodies System, such as PCR buffer solutions, SYBR Green fluorescent dyes, dNTPs, polymerase.The composition of the PCR buffer solutions is 25mM KCl, 2.5mM MgCl2, 200mM (NH4)2SO4。
By the optimization to primer concentration and annealing temperature, the final composition for determining diagnostic kit includes：(1) cell is total RNA extracts reagents；(2) Reverse Transcription；(3) quantitative PCR reagent；(4) neoblast cDNA:As negative control and detection The common quantitative PCR detections of sample cDNA, each reaction system use is with detecting sample cDNA equal amounts.Cell total rna extraction examination Agent is as shown in table 12, and the specific composition and dosage of Reverse Transcription are as shown in table 13, the specific composition and dosage of quantitative PCR reagent As shown in table 14.
The total RNA extraction reagent of table 12
Component Usage amount
Trizol 1mL
Chloroform 0.2mL
Isopropanol 0.5mL
75% ethanol 1mL
The Reverse Transcription of table 13
Component Each reaction system usage amount
5xPrimeScript Buffer 2μL
PrimeScript RT Enzyme Mix I 0.5μL
Oligo dT Primer (50 micromole) 0.5μL
Random6 mers (100 micromole) 0.5μL
RNase Free dH2O Polishing is to 10 μ L
The quantitative PCR reagent of table 14
Component Each reaction system usage amount
SYBR Green PCR systems 12.5μL
Forward Primer(1μM) 1μL
Reverse Primer(1μM) 1μL
RNase Free dH2O To 25 μ L
Optimum reaction condition is：95 DEG C of pre-degeneration 5min, (95 DEG C of denaturation 15sec, 60 DEG C of annealing 45sec, 72 DEG C extend 35sec) × 40 circulation, 72 DEG C of extension 15min.
Although above the present invention is described in detail with a general description of the specific embodiments, On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause This, these modifications or improvements, belong to the scope of protection of present invention without departing from theon the basis of the spirit of the present invention.
Sequence table
<110>Chinese Academy of Medical Sciences Beijing Union Medical College Hospital
<120>A kind of molecular marked compound related to adolescent idiopathic scoliosis and its application
<130> p17155
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
accttcccac ctaccagtct 20
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
ctgggaaacc accatagctt 20
<210> 3
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
cttctgtgtg tttctgccgc 20
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
tcgcccagag ttcctactca 20
<210> 5
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
ctataaattg agcccgcagc c 21
<210> 6
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
gcgcccaata cgaccaaatc 20

Claims (9)

1. a kind of molecular marked compound related to adolescent idiopathic scoliosis, it is characterised in that the molecular marked compound is LncRNA ENST00000602322.1 and/or lncRNA MIR210HG.
2. molecular marked compound as claimed in claim 1, it is characterised in that the ENST00000602322.1 is special in teenager Express and lower in hair property Patients Undergoing Scoliosis Correction；MIR210HG up-regulated expressions in adolescent idiopathic scoliosis patient.
3.ENST00000602322.1 and/or MIR210HG answering in detection adolescent idiopathic scoliosis product is prepared With.
It is 4. as claimed in claim 3, it is characterised in that the product includes genetic chip, kit or preparation.
A kind of 5. diagnostic kit for being used to detect adolescent idiopathic scoliosis, it is characterised in that the diagnostic kit Contain the molecular marked compound ENST00000602322.1 and/or MIR210HG related to adolescent idiopathic scoliosis.
6. adolescent idiopathic scoliosis diagnostic kit as claimed in claim 5, it is characterised in that the kit bag Include：Specific amplification adolescent idiopathic scoliosis related gene ENST00000602322.1's and/or MIR210HG draws Thing.
7. detection kit as claimed in claim 6, it is characterised in that the primer includes following nucleotide sequence：
Specific amplification ENST00000602322.1 primers：
Sense primer SEQID NO.1：ACCTTCCCACCTACCAGTCT；
Anti-sense primer SEQID NO.2：CTGGGAAACCACCATAGCTT；
Specific amplification MIR210HG primers：
Sense primer SEQID NO.3：CTTCTGTGTGTTTCTGCCGC；
Anti-sense primer SEQID NO.4：TCGCCCAGAGTTCCTACTCA.
8. adolescent idiopathic scoliosis diagnostic kit as claimed in claims 6 or 7, it is characterised in that the reagent Box also includes following components：
(1) total RNA extraction reagent in sample；
(2) Reverse Transcription；
(3) quantitative PCR reagent；
(4) normal control sample cDNA.
9. adolescent idiopathic scoliosis diagnostic kit as claimed in claim 8, it is characterised in that the sample includes Serum, urine or tissue samples.
CN201711394662.1A 2017-12-21 2017-12-21 A kind of molecular marked compound related to adolescent idiopathic scoliosis and its application Pending CN107881228A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201711394662.1A CN107881228A (en) 2017-12-21 2017-12-21 A kind of molecular marked compound related to adolescent idiopathic scoliosis and its application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201711394662.1A CN107881228A (en) 2017-12-21 2017-12-21 A kind of molecular marked compound related to adolescent idiopathic scoliosis and its application

Publications (1)

Publication Number Publication Date
CN107881228A true CN107881228A (en) 2018-04-06

Family

ID=61771115

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201711394662.1A Pending CN107881228A (en) 2017-12-21 2017-12-21 A kind of molecular marked compound related to adolescent idiopathic scoliosis and its application

Country Status (1)

Country Link
CN (1) CN107881228A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109266747A (en) * 2018-09-21 2019-01-25 中国医学科学院北京协和医院 Merge the sick related GPR56 of deformity of spine and its application to I type neurofibroma
CN109355252A (en) * 2018-11-08 2019-02-19 中国医学科学院北京协和医院 Application of the HOXD8 in the product that preparation promotes mesenchymal stem cell Osteoblast Differentiation
CN109402248A (en) * 2018-11-08 2019-03-01 中国医学科学院北京协和医院 A kind of lncRNA marker lncAIS of adolescent idiopathic scoliosis and its application

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104328169A (en) * 2014-06-24 2015-02-04 吴南 Product for diagnosing congenital scoliosis and application of product
CN107326076A (en) * 2017-07-12 2017-11-07 北京赛尔维康生物医学科技有限公司 A kind of scoliosis early stage auxiliary detection kit and its application

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104328169A (en) * 2014-06-24 2015-02-04 吴南 Product for diagnosing congenital scoliosis and application of product
CN107326076A (en) * 2017-07-12 2017-11-07 北京赛尔维康生物医学科技有限公司 A kind of scoliosis early stage auxiliary detection kit and its application

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
WEIJIE MIN等: "Long Noncoding RNA miR210HG as a Potential Biomarker for the Diagnosis of Glioma", 《PLOS ONE》 *
XIAO-YANG LIU等: "Expression Signatures of Long Noncoding RNAs in Adolescent Idiopathic Scoliosis", 《BIOMED RESEARCH INTERNATIONAL》 *
刘晓阳等: "长链非编码RNA在青少年特发性脊柱侧凸中的表达研究", 《中国骨与关节外科》 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109266747A (en) * 2018-09-21 2019-01-25 中国医学科学院北京协和医院 Merge the sick related GPR56 of deformity of spine and its application to I type neurofibroma
CN109266747B (en) * 2018-09-21 2021-07-27 中国医学科学院北京协和医院 GPR56 related to I-type neurofibroma complicated with spinal malformation and application thereof
CN109355252A (en) * 2018-11-08 2019-02-19 中国医学科学院北京协和医院 Application of the HOXD8 in the product that preparation promotes mesenchymal stem cell Osteoblast Differentiation
CN109402248A (en) * 2018-11-08 2019-03-01 中国医学科学院北京协和医院 A kind of lncRNA marker lncAIS of adolescent idiopathic scoliosis and its application
CN109355252B (en) * 2018-11-08 2020-11-06 中国医学科学院北京协和医院 Application of HOXD8 in preparation of product for promoting osteogenic differentiation of mesenchymal stem cells
CN109402248B (en) * 2018-11-08 2022-05-20 中国医学科学院北京协和医院 lncRNA marker lncAIS of adolescent idiopathic scoliosis and application thereof

Similar Documents

Publication Publication Date Title
CN108130368A (en) Applications of the lncRNA in diagnosis or indication adolescent idiopathic scoliosis product is prepared
Alda et al. Investigating responders to lithium prophylaxis as a strategy for mapping susceptibility genes for bipolar disorder
CN108085395A (en) Primer sets, kit and the method for cervical carcinoma polygenes DNA methylation assay based on high-flux sequence
CN107881228A (en) A kind of molecular marked compound related to adolescent idiopathic scoliosis and its application
EA023630B1 (en) Biomarker for detecting high-altitude adaptation and high-altitude pulmonary edema
CN105936940A (en) Nucleic acid sequence for detecting deaf genes and applications thereof
CN108504658A (en) Purposes of the LINC01836 in preparing diagnosing gastric cancer product, medicine
CN104428426B (en) The diagnosis miRNA overview of multiple sclerosis
CN111944912B (en) Skin gene detection method
KR102414106B1 (en) Multiple biomarkers for diagnosis of breast cancer and Uses thereof
CN113724862A (en) Colorectal cancer biomarker and screening method and application thereof
US20190002983A1 (en) Serum mirna marker for opll diagnosis and application thereof
KR101587869B1 (en) Biomarker for prediction of sensitive skin and test kit using the same
CN112266955B (en) Ankylosing spondylitis diagnostic marker and application thereof
CN107326076A (en) A kind of scoliosis early stage auxiliary detection kit and its application
CN106947818A (en) A kind of molecular marker of diagnosis and treatment adenocarcinoma of colon
CN106498051B (en) Application of the ZNF800 gene in preparation osteoporosis early screening product
CN106047876B (en) A kind of nasopharyngeal carcinoma related molecule sign and its application
CN113166810A (en) SNP marker for diagnosing cerebral aneurysm including single base polymorphism of GBA gene
CN110117656A (en) A kind of biomarker relevant to sdenocarcinoma of stomach occurrence and development
CN113817818B (en) Tool for diagnosing allergic airway inflammation
CN110144352B (en) Molecular marker for early diagnosis of orthopedic diseases
CN106947819A (en) Adenocarcinoma of colon diagnosis and treatment mark
CN108034715B (en) Kit for detecting osteoporosis
WO2022009988A1 (en) Method for detecting severity of atopic dermatitis

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20180406