CN108130368A

CN108130368A - Applications of the lncRNA in diagnosis or indication adolescent idiopathic scoliosis product is prepared

Info

Publication number: CN108130368A
Application number: CN201711396072.2A
Authority: CN
Inventors: 王以朋; 李子全; 李政垚; 刘书中; 王牧川; 牛潼
Original assignee: Peking Union Medical College Hospital Chinese Academy of Medical Sciences
Current assignee: Peking Union Medical College Hospital Chinese Academy of Medical Sciences
Priority date: 2017-12-21
Filing date: 2017-12-21
Publication date: 2018-06-08
Anticipated expiration: 2037-12-21
Also published as: CN108130368B

Abstract

The invention discloses a kind of and relevant new molecular marked compound ENST00000414894.1 and/or the TRHDE AS1 of adolescent idiopathic scoliosis, and further confirm that ENST00000414894.1, TRHDE AS1 express downward in adolescent idiopathic scoliosis patient, it can be applied in diagnosis or indication adolescent idiopathic scoliosis product is prepared.Purposes the invention also discloses the molecular marked compound in the kit for preparing diagnosis or indication adolescent idiopathic scoliosis simultaneously.It can be diagnosed early stage adolescent idiopathic scoliosis occurs using the molecular marked compound, quickly and effectively, it is not only significant to the saving of the early treatment of adolescent idiopathic scoliosis and medical treatment cost, but also provide therapy target and important evidence for clinical practices such as gene therapy, drug therapies.

Description

LncRNA is in diagnosis or indication adolescent idiopathic scoliosis product is prepared Using

Technical field

The present invention relates to biotechnologies, and in particular to prepared by ENST00000414894.1 and/or TRHDE-AS1 Application in diagnosis or indication adolescent idiopathic scoliosis product.

Background technology

Idiopathic scoliosis (Idiopathic Scoliosis, IS) is that a kind of incidence is high (incidence 1.3%), sternly Ghost image rings the disease of quality of life, accounts about the 80% of scoliosis morbidity sum.Baby children is divided into according to the difference of age of onset Youngster's idiopathic scoliosis (Infantile Idiopathic Scoliosis, IIS) (0.3 years old), juvenile's idiopathic backbone side Convex (Juvenile Idiopathic Scoliosis, JIS) (3-9 Sui), adolescent idiopathic scoliosis (Adolescent Idiopathic Scoliosis, AIS) (10-16 Sui).Wherein AIS accounts for about 80% in idiopathic scoliosis patient groups. The teiology of AIS is not yet clear and definite, at present to the description of its pathogenesis there are many hypothesis, but all can not explain AIS's well Occur.

Existing research shows that the generation of AIS has apparent genetic predisposition.Both at home and abroad to its genomics, albumen Though the numerous studies in the directions such as matter group have obtained certain achievement, conclusion is not consistent, can not be well to the hair of AIS Raw, progress makes satisfied explanation.Among the gene information huge to the mankind constantly understanding, the base not in traditional code albumen Cause, Noncoding gene sequence are gradually recognized by people, and start the important function being presented in some diseases mechanism.Long-chain is non- Coding RNA (10ng non-codingRNAs, lncRNAs) is exactly one kind therein, it is that a kind of transcript is long in eukaryocyte Degree does not have encoding histone function RNA molecule more than 200nt's.Current research constantly finds the mechanism of action of lncRNA complexity With function, by being used as regulation and control person between gene information and its product, the occurrence and development of numerous diseases of the mankind are risen emphatically It acts on.This research passes through what is selected in peripheral blood with biochip technology using lncRNA as main study subject LncRNA carries out it real-time quantitative PCR detection expression, from this New Century Planned Textbook of long-chain non-coding RNA in musculature It is explored, expects the understanding for having some new the pathogenesis of AIS.

Invention content

To solve the above-mentioned problems, one of the objects of the present invention is to provide ENST00000414894.1 and/or TRHDE- Applications of the AS1 in diagnosis or indication adolescent idiopathic scoliosis product is prepared.

The second object of the present invention is to provide one kind for measuring ENST00000414894.1 and TRHDE-AS1 expression Horizontal reagent.

The third object of the present invention be to provide for measure in subject's sample ENST00000414894.1 and/or Application of the reagent of TRHDE-AS1 expressions in the kit for preparing diagnosis or indication adolescent idiopathic scoliosis.

Based on this, the present invention is believed using Agilent human lncRNA Array V3.0 chip technologies with reference to biology Breath learns analysis method, studies the lncRNA differential expression situations between case group and Normal group, and that screens differential expression can The relevant lncRNAs ENST00000414894.1 and/or TRHDE-AS1 of muscle, skeletal system can be influenced, and using RT-PCR Proofing chip result.Further, the present invention by differential expression level in paraspinal muscle of the lncRNA of Analysis and Screening for The pathogenesis of further investigated AIS patient, the method for treating AIS and the correlation function for improving lncRNA have important guidance Meaning.

First, the present invention provides ENST00000414894.1 and/or TRHDE-AS1 and is preparing diagnosis or indication teenager Application in idiopathic scoliosis product.

Preferably, the ENST00000414894.1 and TRHDE-AS1 tables in adolescent idiopathic scoliosis patient Up to downward.

Preferably, the diagnosis or indication adolescent idiopathic scoliosis product include genetic chip, reagent or reagent Box.

Further, present invention offer is a kind of is used to measure ENST00000414894.1 and TRHDE-AS1 expressions Reagent, the reagent include specific amplification adolescent idiopathic scoliosis correlation lncRNA ENST00000414894.1 And/or the primer of TRHDE-AS1.

Preferably, the primer includes following nucleotide sequence：

Specific amplification ENST00000414894.1 primers：

Sense primer SEQID NO.1：AGCCGCCCTATTCAGTTCAC；

Downstream primer SEQID NO.2：TCCAAGTTCCGAGTTGTGGG；

Specific amplification TRHDE-AS1 primers：

Sense primer SEQID NO.3：GGTCCTCTGGGTGGAATGTG；

Downstream primer SEQID NO.4：GGCCGGACACTTCTTTCTCA.

Further, the present invention also provides for measure in subject's sample ENST00000414894.1 and/or Application of the reagent of TRHDE-AS1 expressions in the kit for preparing diagnosis or indication adolescent idiopathic scoliosis.

Preferably, the sample of the subject includes serum, urine or tissue samples.

Preferably, the measure of ENST00000414894.1 and TRHDE-AS1 expressions is logical in subject's sample Cross fluorescence quantitative PCR method progress.

Preferably, the kit further includes following components：

(1) total RNA extraction reagent in sample；

(2) Reverse Transcription；

(3) quantitative PCR reagent；

(4) normal control sample cDNA.

Preferably, the RNA extracts reagents include Trizol, chloroform, isopropanol and 75% ethyl alcohol etc.；Reverse transcription reagents packet Include RT Buffer, reverse transcriptase and Oligo dT and Random6mers primers etc.；The quantitative PCR reagent includes PCR buffer solutions, SYBR Green fluorescent dyes, dNTPs composition SYBR Green PCR systems, primer and RNase Free H₂O；The normal sample cDNA：As negative control with detecting the common quantitative PCR detections of sample cDNA, often A reaction system use is with detecting sample cDNA equal amounts.

Beneficial effects of the present invention are as follows：

The invention discloses a kind of and relevant new molecular marked compounds of adolescent idiopathic scoliosis ENST00000414894.1 and/or TRHDE-AS1, and further confirm ENST00000414894.1 in adolescent idiopathic ridge It expresses and lowers in the convex patient in column side, can be applied in diagnosis or indication adolescent idiopathic scoliosis product is prepared.Simultaneously originally Invention also discloses purposes of the molecular marked compound in the kit for preparing diagnosis or indication adolescent idiopathic scoliosis. It can be diagnosed early stage adolescent idiopathic scoliosis occurs using the molecular marked compound, it is quickly and effectively, not only right The early treatment of adolescent idiopathic scoliosis and the saving of medical treatment cost are significant, and are gene therapy, drug The clinical practices such as treatment provide therapy target and important evidence.

Description of the drawings

Fig. 1 qRT-PCR verify gene chip results.

Specific embodiment

The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention..Unless otherwise specified, embodiment Used in the conventional means that are well known to those skilled in the art of technological means, reagent used can be commercially available.

The integral experiment scheme of the present invention is as follows：

1st, by 4 adolescent idiopathic scoliosis patients and 4 ages, the matched normal control population of gender Peripheral blood.It is sieved by biochip technology and the bioinformatics techniques such as GO, Pathway analysis and CNC networks structure Select expression otherness and it may functionally influence the lncRNA of muscle, skeletal system ENST00000414894.1 and TRHDE-AS1；

2nd, its expression is verified by qRT-PCR, it is as a result consistent with chip results.

3rd, by qRT-PCR in the paraspinal muscle of case group diseased region and control group corresponding site lncRNA expressions Verified, inquire into lncRNA whether in patient's paraspinal muscle there are different expression and to the hair of teenager spy's hair style scoliosis Hair tonic exhibition plays an important role.

The major experimental reagent that the present invention uses is as follows：

Trizol LS (Ambion companies of the U.S.)；Isopropanol, chloroform, absolute ethyl alcohol (Solution on Chemical Reagents in Shanghai Co., Ltd)； RNA purification kits (German QIGEN companies)；PrimeScript RT reagent kit reverse transcription reagent box (precious biology work Journey Co., Ltd)；Quantitative PCR detection kit (precious bioengineering Co., Ltd) genechip detection uses Agilent Human lncRNA Array V3.0, commission Beijing Bo Ao Bioisystech Co., Ltd carry out；Cy3-dCTP(GE Healthcare)；20xSSC (Beijing Boao Biological Co., Ltd)；Agilent one-color RNA Spike-in kit (Agilent companies of the U.S.).

1 sample collection standard of embodiment

1st, research object

Case-control study method is taken in this research, and periphery blood specimen case group is selected from BJ Union Hospital's row backbone The Chinese Han women AIS of the convex orthopaedy in side, control group is from gender, age, the national normal female to match with case group.

Chinese Han women AIS of the paraspinal muscle sample case group selected from BJ Union Hospital's row patients with scoliosis undergoing suffers from Person, control group are gender, age, the national intervertebral disc degeneration patient with operation without deformity of spine to match with case group.

1.1 case group

In April, 2013 in March, 2014 is all from the adolescent idiopathic scoliosis patient of our hospital's operative treatment, choosing The Han nationality blueness of complete clinical data and imaging data (including backbone x lines, CT and three-dimensional reconstruction, full backbone MRI) has been taken to lack Year adolescent idiopathic scoliosis.

Case inclusion criteria

1. adolescent idiopathic scoliosis diagnosis is clear and definite；

2. women；

3. age 10-18 Sui；

4. informed consent；

5. there are complete clinical data and imaging data (including backbone x lines, CT and three-dimensional reconstruction, full backbone MRI).

Exclusion criteria

1. other specific deformity of spine patients of the cause of disease, such as congenital scoliosis, neuromuscular type scoliosis, backbone Wound, infection, tumour etc.；

2. merge other patients with chronic diseases (can cause growth and development impacted)：

3. the incomplete AIS patient of imaging data, clinical data；

4. the AIS patient of informed consent is not obtained.

1.2 control group

The crowd that disease is known without deformity of spine, without oneself that gender, nationality, age and case match；Wherein peripheral blood mark Originally the normal population being selected from, paraspinal muscle sample are selected from intervertebral disc degeneration patient.Due to more difficult in terms of intervertebral disc degeneration patient age Perfect matching, thus its age is suitably expanded to 90 years old.

Inclusion criteria

1. informed consent；

2. women；

3. the age<30 years old；

4. there are complete clinical data and imaging data (x-ray exclusion deformity of spine).

Exclusion criteria

1. informed consent is not obtained；

2. vertebra has deformation patients；

3. there are the diseases of injured nerve muscle systems；

4. merge other patients with chronic diseases.

The screening of embodiment 2lncRNA

Using 4 adolescent idiopathic scoliosis patient samples as AIS groups, using 4 Normal groups as Normal group (NC groups) acquires empty stomach peripheral blood, and extracts total serum IgE.

1st, the Total RNAs extraction of periphery whole blood

1) 0.25ml peripheral bloods and 0.75mLTrizol LS reagent are added in each EP pipes freezes mixed liquor, Acutely rock mixing；

2) it is incubated at room temperature 5 minutes, will be completely dissociated nucleic acid-protein compound；

3) 0.2ml chloroforms are added in each EP pipes (to add in the Trizol LS reagent reagent samples i.e. per 0.75ml 0.2ml chloroforms), cover tightly EP pipe lids.Acutely rock 15 seconds；

4) 3 minutes are stood at room temperature, organic phase and inorganic phase is made quickly and effectively to detach；

5) it with refrigerated centrifuge at 4 DEG C, is centrifuged 10 minutes under conditions of 12000G；

6) it is carefully taken out in EP pipes after centrifuging, it is seen that mixing liquid therein is divided into three layers：The red phenol chloroform phase of lower floor, Middle layer white egg white and the colourless aqueous layer on upper strata.RNA is all present in aqueous layer needed for this experiment.

7) aqueous layer is carefully transferred to another EP pipes (being careful not to be drawn onto middle layer) with micropipettor；

8) 0.6ml isopropanols are added in aqueous layer, is incubated 10 minutes for 15-30 DEG C after mixing, RNA is allowed to have in aqueous layer Effect ground precipitation (hydrophobic effect that isopropanol passes through-OH so that the hydrophilic radical in RNA chains is protected)；

9) it with refrigerated centrifuge at 4 DEG C, is centrifuged 10 minutes under conditions of 12000G；

10) supernatant is removed, lmL75% ethyl alcohol is added in each EP pipes (per the sample of 0.75mLTRIzol reagents homogenate Middle addition at least lmL75% ethyl alcohol), gently turn upside down washing EP tube walls；

11) it with refrigerated centrifuge at 4 DEG C, is centrifuged 5 minutes under conditions of 12000G, carefully discards ethyl alcohol；

12) above-mentioned 10-11 steps are repeated, wash RNA precipitate again；

13) after removing ethanol solution, EP pipes are placed in air at room temperature drying RNA precipitate (cannot centrifuge for 5-10 minutes Or heat drying, otherwise RNA will be difficult dissolving)；

14) it is added in without RNA enzyme water 15ul, flick and is softly blown and beaten repeatedly with suction pipe, room in EP pipes with micropipettor Incubation 10 minutes dissolves RNA；

15) gained RNA can be used for experiment in next step or in -80 DEG C of preservation.

2nd, the purifying of RNA

Agilent human lncRNA Array V3.0 are higher to the purity requirement of sample extraction RNA, therefore, we The cell total rna of extraction is purified using RNasey Mini Kit (Qiagen p/n 74104) kits, specific steps reference Specification.

3rd, RNA quality inspections

With the detection of the concentration and purity of NanoDrop ND-1000 types spectrophotometric determination extraction RNA；And denaturation Agarose gel electrophoresis detects the quality of RNA, whether the RNA sample that can be extracted from electrophoresis result with preliminary judgement is up-to-standard, Whether can be used for further analyzing.And then the extraction situation of RNA sample is detected by NanoDrop1000 spectrophotometers, The sample requirement of lncRNA chip analysis：OD260/OD280 is 1.8-2.0.

RNA quality judging standards：The OD260/OD280 values of RNA samples are between 1.8-2.0；Total serum IgE electrophoresis pattern has clearly Clear 28S, 18S band；70 DEG C of water-baths keep the temperature 1 hour after electrophoresis pattern and the collection of illustrative plates no significant difference before water-bath heat preservation.

4th, 1ncRNAs chips detect

4.1 total serum IgEs synthesize cDNA

(1) reverse transcription synthesis First Strand cDNA

1. taking 5 μ L Total RNA (100-500ng), it is added in the Eppendorf centrifuge tubes of 0.2ml nuclease frees.

Join (Cat.No.360030) 1 μ L, while respective volume is added according to the following table 1 2. adding in outside brilliant core gene expression profile Agilent spike-in.

1 reaction volume of table

3. reverse transcription MasterMix (as shown in table 2 below is single reaction system dosage) is prepared on ice, gently mixing, It is put on ice after of short duration centrifugation.

2 reaction system of table

4. taking 5 μ L reverse transcription Master Mix, it is added in the 0.2ml centrifuge tubes containing Total RNA samples.Reverse transcription is most End reaction volume is l0 μ L.

5. soft pressure-vaccum mixing 2-3 times, brief centrifugation is placed on ice.

6. reverse transcription centrifuge tube is placed in PCR instrument, 25 DEG C of reactions 1h, 42 DEG C of reactions 1h, 4 DEG C of holding more than 5min.It takes Go out reverse transcription centrifuge tube, brief centrifugation is placed on ice, is ready for Second Strand cDNA synthetic reactions.

(2) synthesis Second Strand cDNA

1. preparing Second Strand Master Mix on ice, (the following table 3 show single reaction system and uses

Amount), gently mixing, ice bath after of short duration centrifugation.

3 reaction system of table

2. take 50 μ L Second StrandMasterMix be added to First Strand cDNA synthesis steps 6. in it is anti- Ying Guanzhong, mixed volume are 60 μ L；Pressure-vaccum mixing 2-3 times, brief centrifugation are placed on ice.

3. the second chain synthesis centrifuge tube is placed in PCR instrument, 16 DEG C of reaction 1h (closing PCR instrument lid heating function), 65 DEG C React l0min, 4 DEG C of holding more than 5min.

Continue synthetic reaction on ice 4. being after reaction placed in reaction tube or freeze in -20 DEG C rapidly.

4.2 in-vitro transcriptions synthesize cRNA

1. prepare in-vitro transcription MasterMix (the following table 4 show single reaction system dosage), gently mixing, it is of short duration from Solution is collected in tube bottom by the heart.

2. in the reaction tube in taking 30 μ L IVT MasterMix to Second Strand cDNA synthesis steps 4., pressure-vaccum Mixing, brief centrifugation are placed on ice.

3. in-vitro transcription synthesis centrifuge tube is placed in PCR instrument, 40 DEG C of reaction 16h, 4 DEG C of holdings.

4. after reaction, brief centrifugation, using RNeasy Mini Kit (Qiagenp/n 74104) kits to production Object is purified, and cRNA products after purification are quantified using ultraviolet specrophotometer.

4 reaction system of table

4.3cRNA reverse transcription

1. taking 10 μ g of cRNA purified products, adjustment volume to 22 μ L is added in 0.2ml nuclease free centrifuge tubes, and is added Enter 2 μ L Random Primer mixings, be placed in PCR instrument, 70 DEG C of 5min, 25 DEG C of 5min, 4 DEG C of 2min, brief centrifugation collection liquid Body is positioned on ice to tube bottom.

2. preparing cRNA reverse transcriptions MasterMix (the following table 5 show single reaction system dosage), soft mixing is of short duration Solution is collected in tube bottom by centrifugation.

5 reaction system of table

3. 16 μ L reverse transcriptions MasterMix is taken to add in the centrifuge tube 1. step is reacted after, total volume is 40 μ L, and pressure-vaccum mixes It is 2-3 times even, brief centrifugation.

4. cRNA reverse transcription centrifuge tubes are placed in PCR instrument, 25 DEG C of reaction l0min, 40 DEG C of reaction 1.5h, 70 DEG C are reacted 10min, 4 DEG C of reaction 5min, centrifuge tube are placed on ice.

5. operating on ice, 2 μ L RNase H mixings are added in cRNA reverse transcription centrifuge tubes, brief centrifugation is placed in PCR instrument On, 37 DEG C of reactions 45min, 95 DEG C of reactions 5min, 4 DEG C of maintenance 5min.

6. after reaction, can be frozen at -20 DEG C overnight or immediately using Nucleospin@ExtractII (MN companies, Cat.No.740609.250) kit carries out purification process.

4.4 fluorescent marker

1. the cDNA bulk products obtained reverse transcription and after purification are concentrated into 14 μ L, add in 4 μ L RandomPrimer and mix Even, of short duration centrifugation is placed in PCR instrument, 95 DEG C of denaturation 3min, ice bath 5min.

2. sequentially adding reagent in table 6,2-3 mixing is blown and beaten using pipettor.

6 reaction system of table

3. after of short duration centrifugation, it is placed in PCR instrument, 37 DEG C of reaction 1.5h, 70 DEG C of reaction 5min, 4 DEG C keep.

4. fluorochrome label is after reaction, using Nucleospin@Extract II (MN companies, Cat.No.740609.250) kit carries out cDNA purifying, and fluorescent marker after purification is produced using ultraviolet specrophotometer Object carries out Fluorescent dye incorporation amount and nucleic acid quantification.

4.5 chip hybridization

(1) marked product hybridization prepares

1. the marked product after Nucleospin@Extract II kits, elution volume is in 30 μ L or so.

2. it is spare to 27.5 μ L (cy3-dCTP) purifying eluted product to be marked to vacuumize concentration or moisturizing volume single tube.

(2) preparation of hybridization system, hybridization reaction

1. by ready marked product, mixed with reagent in the following table 7.

2. 100 μ L hybridization solutions is taken to be loaded into hybridization cover plate fence, " Agilent " label gently covers fence down, After installing Agilent hybridizing boxes and screwing, hybridizing box can be gently horizontally rotated, check liquid in the hybridization cavity of each sub- battle array Whether flow.

3. hybridizing box is mounted on the rotor of hybrid heater, pay attention to being symmetrically installed, while addition is appropriate ultrapure in pallet After water, 45 DEG C of hybridized overnights.

7 reaction system of table

4.6 chips clean and scanning

1. after chip hybridization, taking-up chip is washed in rich Austria S1ide Washer8 chips to be cleaned in instrument, cleans journey Sequence is as follows：

Washing lotion I：0.2%SDS, 2 × SSC, 42 DEG C of 120S are cleaned 2 times.

Washing lotion II：0.2%SDS, 2 × SSC, 42 DEG C of 80S are cleaned 3 times.

2. after the completion of cleaning procedure, centrifuge dripping is to be scanned.

3. being scanned using Agilent chip scanners (G2565CA) to the chip after cleaning, hybridization picture is obtained.

5th, chip results are analyzed

By using the human lncRNA Array V3.0y of Agilent companies of the U.S., newest RefSeq is covered, The lncRNA phases such as UCSC, Ensembl, H-invDB, Hox lncRNAs, RNAdb, T-UCRs, LncRNA-a, CombinedLit Close the up-to-date information of database.Using 4 adolescent idiopathic scoliosis patient samples as AIS groups, using 4 Normal groups as Normal group (NC groups).The chip after hybridization is scanned to obtain image using Agilent chip scanners.Chip scanning Image passes through NimbkScan softwares (version 2.5) and Agilent GeneSpring GX softwares (version 11.5.1) After analyzing and processing, the lncRNA expression data of AIS groups and NC groups are obtained：It is obtained using multiplying power (Fold Change) screening is folded The lncRNA data of significant difference expression are obtained, parameter selection standard is FC>2.0, P<0.05.The wherein lncRNA of difference height expression There are 120, it is 3.819 times that wherein it is highest, which to fold multiple, for the expression of difference height, and the lncRNA of difference low expression there are 19, wherein poor It is 9.781 times that it is highest, which to fold multiple, for different low expression.

In order to more preferably analyze the function of difference expression gene, inventor further passes through GO, Pathways analysis and structure The possibility for building a variety of bioinformatic analysis screening differential expressions such as CNC gene expression networks is related to nerve, muscle, bone LncRNAs；

According to the site of the lncRNA of differential expression, differential expression multiple, lncRNAs functional analyses and investigation document feelings Condition has screened lncRNAs TRHDE-AS1 and ENST00000414894.1 that 2 differential expressions are lowered.

Embodiment 3qRT-PCR large samples are verified

Using the 20 AIS patients and 20 normal females of age-matched as research object, choose differential expression significantly, ENST00000414894.1, TRHDE-AS1 that prediction may participate in AIS morbidities carry out real-time quantitative PCR verification.

1st, the Total RNAs extraction of periphery whole blood

Step is the same as shown in embodiment 2.

2nd, the process of reverse-transcription of cDNA synthesis：

By the RNA reverse transcriptions of quality inspection qualification into cDNA, it is as follows：

1) DNA in RNA sample is removed：The reagent in the following table 8, and the mixing that is vortexed are added in centrifuge tube successively.

8 reaction reagent of table

2) it slightly centrifuges, is placed in PCR instrument, 42 DEG C are reacted 5 minutes；

3) it is as shown in table 9 to prepare reverse transcription system, adds in oneself and completes in the centrifuge tube of step 2, and the mixing that is vortexed；

4) it slightly centrifuges, is placed in PCR instrument, 37 DEG C are reacted 30 minutes, and 85 DEG C are reacted 5 seconds；And cDNA is stored in -20 DEG C Refrigerator.

9 reverse transcription system of table

3、qRT-PCR

Primer is synthesized by Beijing Inventrogen bioengineering Co., Ltd, and primer is as shown in table 10：

10 primer sequence of table

The reaction system is as follows：

11 reaction system of table

Amplification program is：94 DEG C of reaction 5min；Denaturation and amplification and extension, 94 DEG C reaction 30s, 58 DEG C reaction 30s, 72 DEG C 40s is reacted, totally 40 cycles；72 DEG C of reaction 7min.

4th, result

According to the relative quantification formula of qRT-PCR：2^-ΔΔCt× 100%, compare ENST00000414894.1 and TRHDE- AS1 is in case group and the expression of control group, as a result：Tables of the ENST00000414894.1 and TRHDE-AS1 in case group It is less than control group up to level；This 2 lncRNAs are preferably verified in enlarged sample, the result and chip data of qPCR Trend is basically identical (Fig. 1).

It is verified in embodiment 4LncRNA paraspinal muscles

1st, the selection of paraspinal muscle

The relative position paraspinal muscle of paraspinal muscle and control group (4) at diseased region by collecting AIS patient (21), QPCR is carried out to the lncRNA screened and detects its expression in paraspinal muscle.

2nd, muscle Total RNAs extraction

1) musculature of preservation is taken out from liquid nitrogen, with liquid nitrogen in mortar by its grind into fine powder；

2) about 1.2mLTRIzol reagents are added in mortar, and the TRIzol grindings of solidification are made into itself and powdered muscle Tissue is uniformly mixed；

3) solid-states TRIzol melts at room temperature etc., and 1.5ml centrifuge tubes are transferred them to after mixing muscle powder and TRIzol In；

4) it is incubated 5 minutes at room temperature, ribosome is made to decompose completely；

5) 0.2ml chloroforms are added in each EP pipes (to add in the Trizol LS reagent reagent samples i.e. per 0.75ml 0.2ml- chloroforms), cover tightly EP pipe lids.Acutely rock 15 seconds；

6) 3 minutes are stood at room temperature, organic phase and inorganic phase is made quickly and effectively to detach；

7) it with refrigerated centrifuge at 4 DEG C, is centrifuged 10 minutes under conditions of 12000G；

8) it is carefully taken out in EP pipes after centrifuging, it is seen that mixing liquid therein is divided into three layers：The red phenol chloroform phase of lower floor, Middle layer white egg white and the colourless aqueous layer on upper strata.RNA is all present in aqueous layer needed for this experiment.

9) aqueous layer is carefully transferred to another EP pipes (being careful not to be drawn onto middle layer) with micropipettor；

10) 0.6ml isopropanols are added in aqueous layer, is incubated 10 minutes for 15-30 DEG C after mixing, allows RNA in aqueous layer Effectively precipitate (hydrophobic effect that isopropanol passes through-OH so that the hydrophilic radical in RNA chains is protected)；

11) it with refrigerated centrifuge at 4 DEG C, is centrifuged 10 minutes under conditions of 12000G；

12) supernatant is removed, lmL75% ethyl alcohol is added in each EP pipes (per the sample of 0.75mLTRIzol reagents homogenate Middle addition at least 1mL75% ethyl alcohol), gently turn upside down washing EP tube walls；

13) it with refrigerated centrifuge at 4 DEG C, is centrifuged 5 minutes under conditions of 12000G, carefully discards ethyl alcohol：

14) above-mentioned 10-11 steps are repeated, wash RNA precipitate again；

15) after removing ethanol solution, EP pipes are placed in air at room temperature drying RNA precipitate (cannot centrifuge for 5-10 minutes Or heat drying, otherwise RNA will be difficult dissolving)；

16) it is added in EP pipes with micropipettor without RNA enzyme water 20-40 μ L (the RNA solution concentration according to required preparation Adjust DEPC water), it flicks and is softly blown and beaten repeatedly with suction pipe, room incubation 10 minutes dissolves RNA；

17) gained RNA can be used for experiment in next step or in -80 DEG C of preservation；

18) RNA concentration and purity are measured using NanoDrop ND.1000 types ultraviolet specrophotometer.

3rd, the process of reverse-transcription of cDNA synthesis：

Step is the same as shown in embodiment 3.

4、qRT-PCR

Step is the same as shown in embodiment 3.

5th, experimental result

The detection of expression is carried out to the lncRNA screened in AIS patient and control group paraspinal muscle, is found The expression of ENST00000414894.1, TRHDE-AS1 have different degrees of reduction compared with control group in AIS patient.

Prompting, the low expression level of ENST00000414894.1, TRHDE-AS1 in paraspinal muscle play the morbidity of AIS Important function.

The preparation of 5 kit of embodiment

Based on the primer sets that embodiment 3 obtains, detection AIS diagnostic kits of the present invention, specific amplified are assembled The primer pair of ENST00000414894.1, TRHDE-AS1 such as SEQ ID NO:1-2 and SEQ ID NO:It is shown in 3-4 and special Expand the primer pair such as SEQ ID NO of house-keeping gene (GAPDH):Shown in 5-6；Further include SYBR Green PCRs System, such as PCR buffer solutions, SYBR Green fluorescent dyes, dNTPs, polymerase.The ingredient of the PCR buffer solutions is 25mM KCl, 2.5mM MgCl₂, 200mM (NH₄)₂SO₄。

By the optimization to primer concentration and annealing temperature, the composition of final determining diagnostic kit includes：(1) cell is total RNA extracts reagents；(2) Reverse Transcription；(3) quantitative PCR reagent；(4) neoblast cDNA:As negative control and detection The common quantitative PCR detections of sample cDNA, each reaction system use is with detecting sample cDNA equal amounts.Cell total rna extraction examination Agent is as shown in table 12, and the specific ingredient and dosage of Reverse Transcription are as shown in table 13, the specific ingredient and dosage of quantitative PCR reagent As shown in table 14.

12 total RNA extraction reagent of table

Component	Usage amount
		Trizol	1mL
Chloroform	0.2mL
		Isopropanol	0.5mL
75% ethyl alcohol	1mL

13 Reverse Transcription of table

14 quantitative PCR reagent of table

Component	Each reaction system usage amount
		SYBRGreen PCR systems	12.5μL
ForwardPrimer(1μM)	1μL
		ReversePrimer(1μM)	1μL
RNaseFreedH₂O	To 25 μ L

Optimum reaction condition is：95 DEG C of pre-degeneration 5min, (95 DEG C of denaturation 15sec, 60 DEG C of annealing 45sec, 72 DEG C extend 35sec) × 40 cycle, 72 DEG C of extension 15min.

Although above the present invention is described in detail with a general description of the specific embodiments, On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause This, these modifications or improvements, belong to the scope of protection of present invention without departing from theon the basis of the spirit of the present invention.

Sequence table

<110>Chinese Academy of Medical Sciences Beijing Union Medical College Hospital

<120>Applications of the lncRNA in diagnosis or indication adolescent idiopathic scoliosis product is prepared

<130> P17154

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 1

agccgcccta ttcagttcac 20

<210> 2

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 2

tccaagttcc gagttgtggg 20

<210> 3

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 3

ggtcctctgg gtggaatgtg 20

<210> 4

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 4

ggccggacac ttctttctca 20

<210> 5

<211> 21

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 5

ctataaattg agcccgcagc c 21

<210> 6

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 6

gcgcccaata cgaccaaatc 20

Claims

1.ENST00000414894.1 and/or TRHDE-AS1 is preparing diagnosis or indication adolescent idiopathic scoliosis product In application.

2. application as described in claim 1, which is characterized in that the ENST00000414894.1 and TRHDE-AS1 is few in blueness It expresses and lowers in year adolescent idiopathic scoliosis.

3. application as described in claim 1, which is characterized in that the diagnosis or indication adolescent idiopathic scoliosis product Including genetic chip, reagent or kit.

4. a kind of reagent for being used to measure ENST00000414894.1 and TRHDE-AS1 expressions, which is characterized in that described Reagent includes specific amplification adolescent idiopathic scoliosis correlation lncRNAENST00000414894.1 and/or TRHDE- The primer of AS1.

5. reagent as claimed in claim 4, which is characterized in that the primer includes following nucleotide sequence：

Specific amplification ENST00000414894.1 primers：

Sense primer SEQID NO.1：AGCCGCCCTATTCAGTTCAC；

Downstream primer SEQID NO.2：TCCAAGTTCCGAGTTGTGGG；

Specific amplification TRHDE-AS1 primers：

Sense primer SEQID NO.3：GGTCCTCTGGGTGGAATGTG；

Downstream primer SEQID NO.4：GGCCGGACACTTCTTTCTCA.

6. prepared by the reagent for measuring ENST00000414894.1 and/or TRHDE-AS1 expressions in subject's sample Application in the kit of diagnosis or indication adolescent idiopathic scoliosis.

7. application as claimed in claim 6, which is characterized in that the sample of the subject includes serum, urine or tissue sample This.

8. application as claimed in claim 6, which is characterized in that in subject's sample ENST00000414894.1 and The measure of TRHDE-AS1 expressions is carried out by fluorescence quantitative PCR method.

9. application as claimed in claim 6, which is characterized in that the kit further includes following components：

(1) total RNA extraction reagent in sample；

(2) Reverse Transcription；

(3) quantitative PCR reagent；

(4) normal control sample cDNA.