CN108085331B

CN108085331B - DNA framework for circular RNA overexpression and application thereof

Info

Publication number: CN108085331B
Application number: CN201711428211.5A
Authority: CN
Inventors: 罗卫峰; 张腾; 谭圆圆; 吴翠芳; 韩慧
Original assignee: Zhejiang Free Trade Zone Ruisai Biomedical Technology Co ltd
Current assignee: Zhejiang free trade zone ruicai biological medicine technology Co., Ltd.
Priority date: 2017-12-26
Filing date: 2017-12-26
Publication date: 2021-06-25
Anticipated expiration: 2037-12-26
Also published as: CN108085331A

Abstract

The invention relates to a DNA frame for circular RNA overexpression and application thereof, wherein the artificially synthesized DNA frame sequence is inserted into eukaryotic expression vectors, lentiviral vectors, adenoviral vectors and adeno-associated viral vectors to form a circRNA special expression vector. The DNA framework sequence and the corresponding expression vector thereof can be widely applied to the expression of various circRNAs, and provide a favorable tool for researching the function and mechanism of the circRNAs and further developing gene therapy medicaments based on the circRNAs.

Description

DNA framework for circular RNA overexpression and application thereof

[ technical field ]

The present invention relates to a DNA framework for the overexpression of circular RNA and uses thereof.

[ background art ]

Circular RNA (circular RNA) is a new class of RNA distinguished from conventional linear RNA by not having the 5 'terminal cap and 3' terminal poly (a) tail of conventional linear RNA, but existing as a closed circular structure. Research shows that the circular RNA is mainly generated through atypical variable shearing processing, widely exists in various biological cells, has the characteristics of stable structure, difficult degradation by RNA enzyme, high expression abundance, good conservation among species, tissue and space specificity and the like. Research on circRNA and diseases shows that the circRNA is related to the occurrence and the progression of diseases such as tumors, neurodevelopmental diseases, atherosclerosis, myotonic dystrophy and the like. In addition, research finds that stable circRNA can be detected in human saliva and blood, and the characteristics enable the circular RNA to have wide prospects in development and application of novel disease diagnosis and treatment methods.

Research on circRNA is not deep, and the biological function and regulation mechanism of circRNA are still unknown. Although the existing research suggests that circRNA can be used as "sponge" to adsorb microRNA in cells and block the inhibition effect of the microRNA on target genes of the microRNA; the circRNA can also directly regulate and control other RNA levels through base complementary pairing; in addition, research suggests that circRNA may have the functions of binding with protein, regulating protein activity and the like. However, the biological activity of circRNA and its mechanism of action in the cell requires extensive research.

As with conventional gene function and mechanism studies, an important research approach to study the biological function and mechanism of circRNA is to overexpress circRNA intracellularly, observe its effects on cellular function and elucidate its molecular mechanisms involved in regulating cellular function. Then, a stable and reliable means for circRNA overexpression is necessary for intracellular introduction of overexpressed circRNA. The existing method for over-expressing circular RNA usually uses genome DNA as a template, a target circRNA sequence and sequences of 1000bp upstream and 200bp downstream are amplified, then a reverse complementary sequence of 800bp upstream is inserted into the downstream by means of PCR splicing, and then the obtained complete sequence is inserted into a commercial over-expression vector such as pCDNA3.1 by means of enzyme digestion connection to express the target circRNA. This method is not suitable for the overexpression of artificially designed circular RNAs. In 2014, Liang optimally constructs a circRNA expression frame by utilizing upstream and downstream sequence research on hsa _ circ _0001727, but the expression frame has limitations, is only effective for overexpression of endogenous circRNA, and has low overexpression efficiency.

[ summary of the invention ]

The invention aims to provide a DNA sequence suitable for circRNA expression and a vector thereof, wherein the sequence is generally suitable for the expression of various circRNAs, and has high and stable expression efficiency; the sequence can be integrated into various expression vectors, and can be applied to various expression systems such as common eukaryotic expression, lentivirus expression, adenovirus expression, adeno-associated virus expression, retrovirus expression and the like; the circRNA expression by using the vector containing the sequence is simple and easy to operate and easy to popularize.

In order to achieve the above object, a DNA framework for the overexpression of circular RNAs of the sequence of formula I was invented,

US-[N]_n-DS

I

wherein the content of the first and second substances,

US is an upstream sequence shown as SEQ ID NO.1,

DS is a downstream sequence shown as SEQ ID NO.2,

[N]_nas an intermediate sequence, N represents A, T, G, C any one of four deoxyribonucleotides, and N identical or different N are connected in sequence to form the intermediate sequence.

The above-described DNA framework for circular RNA overexpression also has the following optimized structure:

said [ N ]]_nPreferably the linear DNA sequence of the circRNA to be expressed. Further preferred are linear DNA sequences of endogenous circRNA, further comprising linear DNA sequences of hsa _ circ _0001727, hsa _ circ _0001756, hsa _ circ _0000284, hsa _ circ _0000711 or hsa _ circ _ 0000268.

The optimal range of n is more than or equal to 150 and less than or equal to 3000.

The invention also comprises a DNA framework for the overexpression of the circular RNA, and the DNA sequence of the DNA framework is shown as SEQ ID NO. 4.

The invention also comprises an expression vector which is formed by inserting the DNA framework sequence for the circular RNA overexpression into a eukaryotic expression vector, a lentiviral vector, an adenoviral vector and an adeno-associated viral vector.

The DNA framework for circular RNA overexpression of the invention can be used for overexpression of circRNA.

The circRNA overexpression DNA framework sequence can be integrated into various expression vectors, and can be applied to various expression systems such as common eukaryotic expression, lentivirus expression, adenovirus expression, adeno-associated virus expression, retrovirus expression and the like.

A plurality of DNA sequences are designed in the experimental process, and reliable experimental results prove that the circRNA overexpression DNA framework sequence related to the invention has simple design, various expression vector choices, simple and convenient vector construction operation and stable and efficient circRNA overexpression (the circRNA overexpression multiple is more than hundreds of times). The sequence and the corresponding vector can be widely applied to the expression of various circRNAs, and a powerful tool is provided for the function and mechanism research of the circRNAs.

[ description of the drawings ]

FIG. 1 is a schematic representation of the universal overexpression framework for circular RNA in the examples.

FIG. 2 is a diagram showing the overexpression effect of the circRNAs after 293T cells are transfected by a plurality of circRNA overexpression plasmids constructed by the invention.

[ detailed description of the invention ]

The present invention is further explained with reference to the following examples, which are not intended to limit the present invention in any way.

In this example, the GT-AG rule of eukaryotic gene splicing was used, and based on the upstream and downstream flanking sequences of hsa _ circ _0001727, the flanking inverted repeat sequences were simplified and optimized, respectively, and optimized and designed simultaneously on both sides of the 5 'and 3' cleavage sites to obtain a universal circRNA overexpression framework (upstream sequence + middle sequence + downstream sequence). According to the general over-expression frame sequence design principle, a plurality of circRNA over-expression frame DNA sequences are designed and synthesized by a chemical synthesis mode, and then the artificial circular RNA over-expression frame sequences are constructed on commercial expression vectors (eukaryotic expression vectors, lentivirus vectors, adenovirus vectors and the like) by an enzyme digestion linking mode. Then, the constructed circRNA overexpression vector is transfected into 293T cells, and the overexpression efficiency of the circRNA overexpression framework is verified.

The technology related by the invention is conventional technical means such as gene synthesis, vector construction, cell culture, plasmid transfection, qPCR and the like, wherein related enzymes, primers, reagents, cell culture reaction conditions and cell transfection conditions can be reasonably selected according to the experience of technicians in the field under the condition of no description, related reagent consumables belong to common products sold in the market, and cells are from ATCC. The means and instruments involved are well known and well understood by those skilled in the art.

The technical solutions of the present invention are further illustrated by the following examples and test examples, but should not be construed as limiting the present invention.

The first embodiment is as follows: construction of has _ circ _0001727 overexpression vector

Hsa _ circ _0001727 overexpression framework sequence design:

linear DNA sequences encoding hsa _ circ _0001727 circular RNA were obtained from a circBase database query. The sequence is shown as SEQ ID NO. 3.

According to the above general design principle of circRNA overexpression DNA framework sequence, the inquired DNA sequence of hsa _ circ _0001727 is replaced by [ N ] in the sequence of formula I]_nObtaining the special overexpression frame DNA sequence of hsa _ circ _0001727, and the sequence is shown in SEQ ID NO. 4.

Still further, in other embodiments, as shown in fig. 1, N may also be a multiple of 2, 3, 4, 5, 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 1000, 2000, 3000, or even more, which may be the same N or a different N.

2. The DNA sequence of hsa _ circ _0001727 for the proprietary overexpression framework was submitted to Kinshire, Nanjing for sequence synthesis.

3. Primer design Synthesis

Primer design was performed using Primer5 software:

Circ-F: shown as SEQ ID NO. 5.

Circ-R: as shown in SEQ ID NO. 6.

The primer sequences were synthesized by Shanghai Huada Gene.

PCR amplification of the specialized overexpression framework DNA sequence of hsa _ circ _0001727

And (3) taking a special overexpression frame DNA sequence of hsa _ circ _0001727 obtained by whole gene synthesis as a template, and carrying out PCR amplification on a target fragment, wherein an amplification system is as follows:

10×Buffer	10ul
		MgSO₄(50mM)	1ul
dNTP(10mM)	1.5ul
		transStart Fastpfu DNA polymerase(5U/ul)	0.5ul
Circ-F(10uM)	2ul
		Circ-R(10uM)	2ul
template DNA (50ng/ul)	1ul
		Add ddH₂To total volume of O	50ul

The PCR cycling program was as follows:

PCR product recovery

The PCR products were electrophoresed on agarose gel and recovered using a gel recovery kit (Axygen, AP-GX-50) following the detailed protocol of the kit instructions.

PCR recovery of Nhe I and HindIII products and recovery of products

Performing double enzyme digestion on the PCR recovery product by using Asc I and Pme I, wherein the enzyme digestion system is as follows:

10×Buffer	3ul
		PCR product/plasmid of interest	1ug
Restriction enzyme Nhe I	0.5ul
		Restriction enzyme Hind III	0.5ul
Complement ddH₂0 to total volume	30ul

After enzyme digestion for 4-5 hours at 37 ℃, the enzyme digestion fragments are separated by electrophoresis, and the target fragments are recovered by cutting gel.

pCDNA3.1 plasmid Nhe I and Hind III double digestion and digestion product recovery

Eukaryotic expression plasmid pCDNA3.1 was digested simultaneously with Nhe I and HindIII as follows:

After enzyme digestion for 4-5 hours at 37 ℃, enzyme digestion fragments are separated by electrophoresis, and linearized plasmids are recovered by gel cutting.

8. The target fragment was ligated to the linearized pCDNA3.1 plasmid

T4 DNA ligase is used for connecting the PCR product after enzyme digestion and a lentiviral vector, and the connection system is as follows:

the ligation was performed at room temperature for 1 h. At the same time, negative control is carried out, and water is used for replacing the gene to be connected with the vector.

9. Conversion of ligation products

1) The ligation products were added separately to 50. mu.l Tran 5. alpha. competent cells in an ice bath. Mix by gentle rotation and ice-bath for 30 min.

2) The water bath is heat-shocked for 90s at 42 ℃.

3) The tube was quickly transferred to an ice bath for 2 min.

4) Adding 500 μ l LB culture medium respectively, mixing, and shaking culturing at 37 deg.C and 150g for 40 min.

5) 150ul of the bacterial solution was applied to the surface of an LB plate containing ampicillin (Amp) (100. mu.g/ml), and left at room temperature until the liquid was absorbed. The plate was inverted and transferred to a 37 ℃ biochemical incubator overnight.

10. Positive clone PCR identification

The next day after transformation, single colony was picked for colony PCR, and PCR amplification system and cycle procedure were as follows: the amplification system was as follows:

10×Reaction Buffer	1.5ul
		MgCl₂(25mM)	1.5ul
dNTPs(10mM)	0.5ul
		Circ F(10mM)	0.5ul
Circ R(10mM)	0.5ul
		Taq(5U/ul)	0.1ul
bacterial colony suspension	1ul
		Complement ddH₂0 to total volume	15ul

The cycling conditions were as follows:

11. positive clone shake bacteria and plasmid extraction

The clones which are positive in PCR identification are cultured in 1ml LB liquid culture medium containing corresponding antibiotics, the bacteria are shaken overnight at 37 ℃, and plasmids are extracted by utilizing a plasmid miniprep kit (Axygen, AP-MN-P-50) on the next day according to the detailed steps of the instruction.

12. And (3) sending the extracted plasmid to Huada gene for sequencing, and performing sequence comparison on a sequencing result. The constructed specific overexpression plasmid for hsa _ circ _0001727 was obtained.

Example two: qPCR detection of the overexpression Effect of hsa _ circ _0001727 in 293T cells transfected with hsa _ circ _0001727 overexpression plasmid

1, qPCR primer design and Synthesis

divergent primer-F：CAGGTCAAGTTCATGGACCTG

divergent primer-R：ATTCAGACTTACCTGAAGTA

The primer sequences were synthesized by Shanghai Huada Gene.

2, before transfectionDigesting 293T cells in logarithmic growth phase with pancreatin for 24h, and subculturing the cells to a six-well plate, at 37 ℃ and 5% CO₂Culturing in an incubator. Can be used for transfection after the cell density reaches 70-80% in 24 h.

3, the cell culture medium was changed to serum-free medium before transfection.

4, add 25ug of the prepared hsa _ circ _0001727 overexpression plasmid DNA solution to a sterilized centrifuge tube, mix well with the corresponding volume of Opti-MEM, and adjust the total volume to 1.5 ml.

5, Lipofectamine 2000 was gently shaken, and 60. mu.l of Lipofectamine 2000 was mixed with 1.5ml of Opti-MEM in another tube and incubated at room temperature for 5 minutes.

6, the diluted DNA and the diluted Lipofectamine 2000 were mixed, and the mixture was gently inverted and mixed without shaking.

7, transferring the mixture of DNA and Lipofectamine 2000 to 293T cell culture medium, mixing, and culturing at 37 deg.C with 5% CO₂Culturing in a cell culture box.

8, after 6 hours of culture, the medium containing the transfection mixture was aspirated, 10ml of cell culture medium containing 10% serum was added to each flask of cells, and the mixture was incubated at 37 ℃ with 5% CO₂The incubator was allowed to incubate for 48 hours.

9, adding 1ml of Trizol into each hole of a 6-hole plate, repeatedly blowing and beating for 10 times by using a 1ml gun head, and collecting the Trizol into an EP (EP) tube; centrifuge at 12000g for 15 min and collect the supernatant.

10, 200ul of chloroform was added to the supernatant, the mixture was mixed by inverting the upper and lower forces for half a minute, and the mixture was left to stand for 3 minutes.

Centrifugation at 12000g for 15 minutes at 11,4 ℃ gave a lysate which was visualized as three layers: the upper layer is RNA of water phase; the middle layer is DNA, lipid, etc.; the lower layer is cell residue, protein, polysaccharide, etc.

12, taking 500ul of the supernatant into a new EP tube, and sucking 167ul of the supernatant for three times; adding isopropanol with the same volume, mixing uniformly, standing for 10 minutes, and centrifuging at 12000g for 10 minutes at 4 ℃.

13, carefully remove the supernatant, take care not to lose the RNA pellet, add 1ml 75% ethanol, upside down, and resuspend the pellet.

Centrifugation at 12000g for 10min at 14,4 ℃ takes care to remove the supernatant, aspirates the wall as dry as possible, takes care not to lose the RNA pellet, and can be centrifuged again if the pellet is loose. Air-dry for about 15 minutes until the tube wall is free of liquid.

15, adding a proper volume (20-30ul) of DEPC water to dissolve the RNA, and carrying out water bath at 58 ℃ for 10 minutes.

16, 2ul of the quantification was removed, buffer was measured at 10mM TrisCl (pH7.8), and reverse transcription was performed based on the quantification result. (1A 260. mu.g/ml, A260/A280. mu.g/ml, 1.8. mu.g/ml to 2.1.)

17, reverse transcription of RNA

Reverse transcription was performed according to the protocol as follows:

add to RNase-Free PCR tube (20 ul total)

RNA	3μg
		DEPC·H 2O	Make up to 11.0

Mixing, incubating at 65 deg.C for 10min, immediately ice-cooling, and adding

2.5U/μl Poly A Polymerase	1μl
		RTase Mix	1μl
5×PAP/RT Buffer	5μl
		dd H2O(RNase/Dnase free)	8μl

Incubating at 37 deg.C for 60min, 85 deg.C for 5 min; the cDNA was frozen at-20 ℃ or immediately subjected to PCR.

18, qPCR assay

1) Under the premise of finding out the optimal primer annealing temperature and template amount in an RT-PCR pre-experiment, 2 xSYBR Green Mix is used for preparing the PCR Mix, and the PCR Mix is calculated and prepared according to the number and the repetition number of samples needing to be loaded on a computer, wherein the system is as follows:

2×SYBR Green Mix	10μl
		qPCR primer Mix	1μl
Form panel	5μl
		Ultrapure water	4μl
Total volume	20μl

2) Subpackaging to PCR8 connecting tubes, and instantly centrifuging and mixing the PCR system by a miniature centrifuge.

3) Putting the sample into an IQ5 fluorescent quantitative PCR instrument, carrying out SYBR Green fluorescent quantitative PCR to analyze the expression of each gene, and setting the PCR program as follows:

the PCR reaction can be carried out in 3 steps: (the annealing temperature is set by itself according to the Tm value of the primer and the result of the RT-PCR preliminary experiment, and the melting curve can be set to 60-95 ℃.)

Pre-denatured Cycle 1 (1X)

Step 1:95.0℃for 02:00.

PCR Cycle 2 (40X)

Step 1:95.0℃for 00:15.

Step 2:60.0℃for 00:20.

Step 3:72.0℃for 00:20.

Data collection and real-time analysis enabled.

Dissolution curve Cycle 3 (71X)

Step 1:60.0℃-95.0℃for 00:30.

Increase set point temperature after cycle 2 by 0.5℃

Melt curve data collection and analysis enabled.

19, qPCR relative quantitative results analysis

The calculation formula of the relative expression quantity of the target gene is as follows:

the Ct target is the Ct value of the target gene, and the Ct internal reference is the Ct value of the housekeeping gene. Delta Ct (CtObjective-CtEngineer) represents the relative Ct value of the objective gene of each sample relative to housekeeping gene, delta Ct (delta Ct) Test- (. DELTA Ct) Control represents the normalization of the treated group relative to the Control group,

the expression level of the treated group relative to the control group is shown, and the relative expression fold of the target gene is shown.

Overexpression vectors of has _ circ _0001756, has _ circ _0000284, has _ circ _0000711 or has _ circ _0000268 were constructed in the same manner as described above, and the expression effect in 293T cells after transfection of these overexpression plasmids was examined by qPCR. The effect diagram is shown in fig. 1.

Sequence listing

<110> Shanghai Ruishi Biotechnology Ltd

<120> DNA framework for circular RNA overexpression and use thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 89

<212> DNA

<213> artificial sequence

<400> 1

tgagattaca ggtgtgagcc accacccccg gcctcacttt ttgtaaaggt acgtactaat 60

gacttttttt ttatacttca ggtaagtct 89

<210> 2

<211> 70

<212> DNA

<213> artificial sequence

<400> 2

tctctctctc ttcaggtaag tagcaaggaa aagagttagg cccggcacgg tagctcacac 60

ctgtaatccc 70

<210> 3

<211> 889

<212> DNA

<213> artificial sequence

<400> 3

gaatagtaaa gaaacacatc ataaaacctc ccaggacata aaggtgagca cagaccctgt 60

ttggatcaag tcagttcctg gagcctgaat gatgactgct gaatcacggg aagccacggg 120

tctgtcccca caggctgcac aggagaagga tggtatcgta atagtgaagg tggaagagga 180

agatgaggaa gaccacatgt gggggcagga ttccacccta caggacacgc ctcctccaga 240

cccagagata ttccgccaac gcttcaggcg cttctgttac cagaacactt ttgggccccg 300

agaggctctc agtcggctga aggaactttg tcatcagtgg ctgcggccag aaataaacac 360

caaggaacag atcctggagc ttctggtgct agagcagttt ctttccatcc tgcccaagga 420

gctccaggtc tggctgcagg aataccgccc cgatagtgga gaggaggccg tgacccttct 480

agaagacttg gagcttgatt tatcaggaca acaggtaaaa agaggtgaaa cctattatgt 540

gtgagcaggg cacagacgtt gaaactggag ccaggagaag tattggcagg ctttaggtta 600

ttaggtggtt actctgtctt aaaaatgttc tggctttctt cctgcatcca ctggcatact 660

catggtctgt ttttaaatat tttaattccc atttacaaag tgatttaccc acaagcccaa 720

cctgtctgtc ttcaggtccc aggtcaagtt catggacctg agatgctcgc aagggggatg 780

gtgcctctgg atccagttca ggagtcctcg agctttgacc ttcatcacga ggccacccag 840

tcccacttca aacattcgtc tcggaaaccc cgcctcttac agtcacgag 889

<210> 4

<211> 1048

<212> DNA

<213> artificial sequence

<400> 4

tgagattaca ggtgtgagcc accacccccg gcctcacttt ttgtaaaggt acgtactaat 60

gacttttttt ttatacttca ggtaagtctg aatagtaaag aaacacatca taaaacctcc 120

caggacataa aggtgagcac agaccctgtt tggatcaagt cagttcctgg agcctgaatg 180

atgactgctg aatcacggga agccacgggt ctgtccccac aggctgcaca ggagaaggat 240

ggtatcgtaa tagtgaaggt ggaagaggaa gatgaggaag accacatgtg ggggcaggat 300

tccaccctac aggacacgcc tcctccagac ccagagatat tccgccaacg cttcaggcgc 360

ttctgttacc agaacacttt tgggccccga gaggctctca gtcggctgaa ggaactttgt 420

catcagtggc tgcggccaga aataaacacc aaggaacaga tcctggagct tctggtgcta 480

gagcagtttc tttccatcct gcccaaggag ctccaggtct ggctgcagga ataccgcccc 540

gatagtggag aggaggccgt gacccttcta gaagacttgg agcttgattt atcaggacaa 600

caggtaaaaa gaggtgaaac ctattatgtg tgagcagggc acagacgttg aaactggagc 660

caggagaagt attggcaggc tttaggttat taggtggtta ctctgtctta aaaatgttct 720

ggctttcttc ctgcatccac tggcatactc atggtctgtt tttaaatatt ttaattccca 780

tttacaaagt gatttaccca caagcccaac ctgtctgtct tcaggtccca ggtcaagttc 840

atggacctga gatgctcgca agggggatgg tgcctctgga tccagttcag gagtcctcga 900

gctttgacct tcatcacgag gccacccagt cccacttcaa acattcgtct cggaaacccc 960

gcctcttaca gtcacgagtc tctctctctt caggtaagta gcaaggaaaa gagttaggcc 1020

cggcacggta gctcacacct gtaatccc 1048

<210> 5

<211> 29

<212> DNA

<213> artificial sequence

<400> 5

ttagctagct gagattacag gtgtgagcc 29

<210> 6

<211> 30

<212> DNA

<213> artificial sequence

<400> 6

gctaagcttg ggattacagg tgtgagctac 30

<210> 7

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 7

caggtcaagt tcatggacct g 21

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 8

attcagactt acctgaagta 20

Claims

1. A DNA framework with a sequence shown in a formula I and used for circular RNA overexpression,

US-[N]_n-DS

I

wherein the content of the first and second substances,

US is an upstream sequence, the nucleotide sequence of which is shown as SEQ ID NO.1,

DS is a downstream sequence, the nucleotide sequence of the DS is shown as SEQ ID NO.2,

[N]_nfor the intermediate sequence, N represents A, T, G, C any one of four deoxyribonucleotides, N is the same or different and are connected in sequence to form the intermediate sequence, and the [ N ] is]_nIs the sequence of circRNA.

2. The DNA framework for overexpression of a circular RNA as claimed in claim 1, characterized in that [ N]_nIs the sequence of endogenous circRNA.

3. The DNA framework for circular RNA overexpression of claim 2, characterized in that the sequence of the endogenous circRNA is hsa _ circ _0001727, hsa _ circ _0001756, hsa _ circ _0000284, hsa _ circ _0000711 or hsa _ circ _ 0000268.

4. The DNA framework for overexpression of a circular RNA as claimed in claim 1, characterized in that 150. ltoreq. n.ltoreq.3000.

5. A DNA framework for the overexpression of circular RNA, characterized in that the DNA sequence is shown in SEQ ID NO. 4.

6. An expression vector which is a eukaryotic expression vector, a lentiviral vector, an adenoviral vector or an adeno-associated viral vector, characterized in that it carries a DNA framework sequence according to any one of claims 1 to 5 for the overexpression of circular RNA.

7. Use of a DNA framework for circular RNA overexpression according to any of claims 1 to 5 for the in vitro overexpression of circRNA.