CN108085331A - The DNA frames being overexpressed for circular rna and its application - Google Patents
The DNA frames being overexpressed for circular rna and its application Download PDFInfo
- Publication number
- CN108085331A CN108085331A CN201711428211.5A CN201711428211A CN108085331A CN 108085331 A CN108085331 A CN 108085331A CN 201711428211 A CN201711428211 A CN 201711428211A CN 108085331 A CN108085331 A CN 108085331A
- Authority
- CN
- China
- Prior art keywords
- dna
- circrna
- overexpressed
- sequence
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/67—General methods for enhancing the expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2330/00—Production
- C12N2330/50—Biochemical production, i.e. in a transformed host cell
- C12N2330/51—Specially adapted vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15041—Use of virus, viral particle or viral elements as a vector
- C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Virology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a kind of DNA frames being overexpressed for circular rna and its applications, by this artificial-synthetic DNA's Frame sequence insertion carrier for expression of eukaryon, slow virus carrier, adenovirus vector, gland relevant viral vector, can form circRNA dedicated expression vector therefors.DNA Frame sequences of the present invention and its corresponding expression vectors can be widely used in the expression of various circRNA, and a favourable instrument is provided to study the function of circRNA and mechanism and further developing the gene therapy medicament based on circRNA.
Description
[technical field]
The present invention relates to the DNA frames being overexpressed for circular rna and its applications.
[background technology]
Circular rna (circular RNA, circRNA) is the new RNA of one kind for being different from conventional linear RNA, is not had
There are the 5' ends cap and 3' ends poly (A) tail in conventional linear RNA, and exist with closed hoop structure.Research shows
Circular rna is mainly processed by atypia variable sheer and generated, and is widely present in various biological cells, has stable structure,
Be difficult to be degraded by RNase, gene expression abundance is high, conservative is good between species, expression has the features such as tissue and Space-time speciality.It is right
Show circRNA with tumour, neurodevelopment, atherosclerosis, tatanic myotrophy not in the research of circRNA and disease
The generation of the diseases such as good is related to progress.In addition, research find be able to detect that in people's saliva and blood it is stable
The presence of circRNA, it is wide that these features so that circular rna has in the development and application of New Type of Diseases Clinics and Practices method
Wealthy prospect.
Do not go deep into still for the research of circRNA at present, circRNA is still not very bright in biological function and regulatory mechanism
.Although existing research is thought, circRNA can be blocked as the microRNA in " sponge " sponge adherent cell
MicroRNA is to the inhibitory action of its target gene；CircRNA can also pass through other RNA water of base pair complementarity direct regulation and control
It is flat；It is combined in addition, research thinks that circRNA may have with protein, the functions such as activity of modulin.However,
The biological activity of circRNA and its mechanism to play a role in intracellular need in-depth study.
As conventional gene function is as Mechanism Study, the biological function of circRNA and a weight of mechanism are studied
It is exactly to be overexpressed circRNA in intracellular to want research means, observes its influence to cell function and illustrates its participation regulating cell
The molecular mechanism of function.So, the circRNA that introduce overexpression in intracellular just must have reliable and stable circRNA to cross table
Up to instrument.At present be overexpressed circular rna method usually using genomic DNA as template, expand purpose circRNA sequences and its
Then the sequence of upstream 1000bp and downstream 200bp are inserted the reverse complementary sequence of upstream 800bp by way of PCR splicings
Enter to downstream, obtained complete sequence is then inserted into commercialized over-express vector such as by way of digestion connection
Purpose circRNA is expressed on pCDNA3.1.Such method is not suitable for the overexpression of the circular rna of engineer.2014
For Liang using the upstream and downstream sequence research to hsa_circ_0001727, optimization constructs a circRNA expression frame,
But the expression frame has limitation, it is only effective to the overexpression of part endogenous circRNA, and be overexpressed less efficient.
[content of the invention]
The purpose of the invention is to provide a kind of DNA sequence dna and its carrier suitable for circRNA expression, the sequences
The expression of various circRNA is generally applicable to, expression efficiency is efficient, stablizes；The sequence can be integrated into various types of expression and carry
Body can apply to general eukaryotic expression, slow virus expression, gland virus expression, adeno-associated virus expression, retrovirus expression
Etc. in various expression systems；Using the carrier expression circRNA containing the sequence, operation is simple, easy to spread.
To achieve these goals, a kind of DNA frames being overexpressed for circular rna of Formulas I sequence are invented,
US-[N]n-DS
I
Wherein,
US is upstream sequence, as shown in SEQ ID NO.1,
DS is downstream sequence, as shown in SEQ ID NO.2,
[N]nFor intermediate sequence, N represents any one in tetra- kinds of deoxyribonucleotides of A, T, G, C, n it is identical or
Different N are in turn connected to form intermediate sequence.
The above-mentioned DNA frames being overexpressed for circular rna also have following optimization structure：
[N]nIt is preferred that the linear DNA molecule of the circRNA of required expression.It is further preferably endogenic
The linear DNA molecule of circRNA, further including has_circ_0001727, has_circ_0001756, has_circ_
0000284th, the linear DNA molecule of has_circ_0000711 or has_circ_0000268.
The optimum range of n is 150≤n≤3000.
Present invention additionally comprises a kind of DNA frames being overexpressed for circular rna, DNA sequence dna such as SEQ ID NO.4 institutes
Show.
Present invention additionally comprises a kind of expression vectors, are inserted by the above-mentioned DNA Frame sequences being overexpressed for circular rna
Carrier for expression of eukaryon, slow virus carrier, are formed on gland relevant viral vector adenovirus vector.
The DNA frames being overexpressed for circular rna of the present invention may be used as the overexpression of circRNA.
The circRNA, which is overexpressed DNA Frame sequences, can be integrated into various types of expression vectors, can apply to common true
In the various expression systems such as nuclear expression, slow virus expression, gland virus expression, adeno-associated virus, retrovirus expression.
The present invention experimentation in devise a variety of DNA sequence dnas, by reliable experimental result confirm the present invention relates to
CircRNA be overexpressed that the design of DNA Frame sequences is simple, and the selection of expression vector is various, vector construction is easy to operate,
CircRNA is overexpressed stability and high efficiency (circRNA is overexpressed multiple up to more than hundreds times).The sequence and corresponding carrier can be wide
The general expression applied to various circRNA provides a strong instrument for the function and Mechanism Study of circRNA.
[description of the drawings]
Fig. 1 is the general overexpression block schematic illustration of circular rna in embodiment.
Fig. 2 is the mistake that multiple circRNA that the present invention is built are overexpressed corresponding circRNA after plasmid transfection 293T cells
Expression effect figure.
[specific embodiment]
It is explained further the present invention with reference to embodiments, but embodiment is not the present invention any type of limit
It is fixed.
The present embodiment utilizes the GT-AG rules of eukaryotic gene montage, in the upstream and downstream side of hsa_circ_0001727
On the basis of wing sequence, flank inverted repeats is simplified and optimized respectively, and it is same in 5' and 3' shearing sites both sides
When optimize, obtain universal circRNA and be overexpressed frame (upstream sequence+intermediate sequence+downstream sequence).Root
General overexpression Frame sequence design principle accordingly designs a plurality of circRNA and is overexpressed framework DNA sequences and utilizes chemistry
The mode of synthesis is synthesized, and is then built artificial circular rna overexpression Frame sequence to business using the mode of digestion link
On the expression vector (carrier for expression of eukaryon, slow virus carrier, adenovirus vector etc.) of industry.Then built above-mentioned
CircRNA over-express vectors are transfected into 293T cells, and verification circRNA is overexpressed the overexpression efficiency of frame.
Technology according to the present invention is the conventional skill such as gene chemical synthesis, vector construction, cell culture, plasmid transfection, qPCR
Art means, the enzyme being directed to, primer, reagent, cell culture reaction condition, Cell Transfection Conditions not specified (NS) situation
It can be reasonably selected according to the experience of those skilled in the art down, be directed to reagent consumptive material and belong to commercially available common production
Product, cell are ATCC sources.The detection means and instrument being directed to also are well known to the skilled person simultaneously skilled
It grasps.
Technical scheme is described further below by embodiment and test example, but should not be construed as
Limitation of the present invention.
Embodiment one：Has_circ_0001727 over-express vectors are built
1.hsa_circ_0001727 is overexpressed Frame sequence design：
The linear DNA sequence of coding hsa_circ_0001727 circular rnas is obtained from circBase data base queryings.Sequence
Row are as shown in SEQ ID NO.3.
DNA Frame sequence design principles, the hsa_circ_ that will be inquired are overexpressed according to above-mentioned general circRNA
[N] in 0001727 DNA sequence dna difference alternate form I sequencen, obtain the special overexpression frame of hsa_circ_0001727
DNA sequence dna, sequence is as shown in SEQ ID NO.4.
And it is further, in other embodiments, as shown in Figure 1, n can also use 2,3,4,5,10,20,30,40,50,
100th, 200,300,400,500,1000,2000,3000 even more multiple can be identical N or different N.
2. Nanjing Jin Sirui companies is transferred to carry out sequence the special overexpression framework DNA sequences of hsa_circ_0001727
Row synthesis.
3. design of primers synthesizes
Design of primers is carried out with Primer5 softwares：
Circ-F：As shown in SEQ ID NO.5.
Circ-R：As shown in SEQ ID NO.6.
Primer sequence is synthesized by Shanghai Huada gene company.
4.PCR expands the special overexpression framework DNA sequences of hsa_circ_0001727
The special overexpression framework DNA sequences of the hsa_circ_0001727 synthesized using full genome is templates, PCR
Target fragment is expanded, amplification system is as follows：
| 10×Buffer | 10ul |
| MgSO4(50mM) | 1ul |
| dNTP(10mM) | 1.5ul |
| transStart Fastpfu DNA polymerase(5U/ul) | 0.5ul |
| Circ-F(10uM) | 2ul |
| Circ-R(10uM) | 2ul |
| Template DNA (50ng/ul) | 1ul |
| Add ddH2O is to total volume | 50ul |
PCR cycle program is as follows：
5.PCR products recycle
Agarose gel electrophoresis PCR product, and using plastic recovery kit (Axygen, AP-GX-50), according to kit
The Detailed operating procedures recycling PCR product of specification.
III double digestion of 6.PCR recovery product Nhe I and Hind and digestion products recycling
PCR recovery products are subjected to double digestion with Asc I and Pme I, digestion system is as follows：
| 10×Buffer | 3ul |
| PCR product/purpose plasmid | 1ug |
| Restriction enzyme Nhe I | 0.5ul |
| Restriction enzyme Hind III | 0.5ul |
| Mend ddH20 to total volume | 30ul |
After when 37 DEG C of digestion 4-5 are small, endonuclease bamhi, gel extraction target fragment is separated by electrophoresis.
III double digestion of 7.pCDNA3.1 plasmid Nhe I and Hind and digestion products recycling
Eukaryon expression plasmid pCDNA3.1 is subjected to double digestion with Nhe I and Hind III, digestion system is as follows：
| 10×Buffer | 3ul |
| PCR product/purpose plasmid | 1ug |
| Restriction enzyme Nhe I | 0.5ul |
| Restriction enzyme Hind III | 0.5ul |
| Mend ddH20 to total volume | 30ul |
After when 37 DEG C of digestion 4-5 are small, endonuclease bamhi, gel extraction linearization plasmid is separated by electrophoresis.
8. target fragment is linked with linearisation pCDNA3.1 plasmids
It is as follows using the PCR product after the above-mentioned digestion of T4DNA ligase connections and slow virus carrier, linked system：
Room temperature connects 1h.Negative control is done simultaneously, is connected with water instead of gene with carrier.
9. the conversion of connection product
1) connection product is added separately in 50 μ l Tran5 α competent cells in ice bath.Gently rotate mixing, ice
Bathe 30min.
2) 42 DEG C of water-bath heat shock 90s.
3) quickly pipe is transferred in ice bath, ice bath 2min.
4) 500 μ l LB culture mediums, mixing, 37 DEG C, 150g shaken cultivations 40min are separately added into.
5) 150ul bacterium solutions are coated on the LB planar surfaces containing ampicillin (Amp) (100 μ g/ml), room temperature decentralization
It puts, until liquid absorption.Tablet is inverted, 37 DEG C of biochemical cultivation cases is transferred to and is incubated overnight.
10. positive colony PCR is identified
Next day after conversion, picking single bacterium colony carry out bacterium colony PCR, and PCR amplification system and cyclic program are as follows：
Amplification system is as follows：
| 10×Reaction Buffer | 1.5ul |
| MgCl2(25mM) | 1.5ul |
| dNTPs(10mM) | 0.5ul |
| Circ F(10mM) | 0.5ul |
| Circ R(10mM) | 0.5ul |
| Taq(5U/ul) | 0.1ul |
| Bacterium colony suspension | 1ul |
| Mend ddH20 to total volume | 15ul |
Cycling condition is as follows：
11. positive colony shakes bacterium and plasmid extraction
It is cultivated in the 1ml LB fluid nutrient mediums being cloned in containing corresponding antibiotic that PCR identifications are positive, 37 DEG C are shaken
Bacterium is stayed overnight, and next day utilizes small amount plasmid extraction kit (Axygen, AP-MN-P-50), and detailed step to specifications is taken out
Upgrading grain.
It is sequenced 12. sending the plasmid extracted to Hua Da gene, sequence alignment is carried out to sequencing result.Obtain structure
Build the special overexpression plasmid of the hsa_circ_0001727 of completion.
Embodiment two：Hsa_circ_ in 293T cells after qPCR detection hsa_circ_0001727 overexpression plasmid transfections
0001727 is overexpressed effect
1, qPCR design of primers and synthesis
divergent primer-F：CAGGTCAAGTTCATGGACCTG
divergent primer-R：ATTCAGACTTACCTGAAGTA
Primer sequence is synthesized by Shanghai Huada gene company.
2, before transfection for 24 hours, with the 293T cells of pancreatin digestion exponential phase, pass on to being seeded to six orifice plates, 37 DEG C,
5%CO2Culture in incubator.It can be used to transfect when cell density is up to 70%~80% for 24 hours.
3, cell culture medium is changed to serum free medium before transfection.
4, prepared hsa_circ_0001727 is added in into a sterile centrifugation tube and is overexpressed plasmid DNA solution 25ug,
It is uniformly mixed with the Opti-MEM of respective volume, adjustment total volume is 1.5ml.
5,2000 reagents of Lipofectamine are softly shaken up, take 60 μ l Lipofectamine, 2000 reagents another
It mixes with 1.5ml Opti-MEM in one pipe, incubates 5 minutes at room temperature.
6, the DNA after dilution with the Lipofectamine 2000 after dilution is mixed, lightly overturns mixing,
It not vibrate.
7, DNA and 2000 mixed liquors of Lipofectamine are transferred in the culture solution of 293T cells, mixing, in 37
DEG C, 5%CO2It is cultivated in cell incubator.
8, when culture 6 is small after suck the culture medium containing transfection mixture, add in every bottle of cell and contain the thin of 10% serum
Born of the same parents culture medium 10ml, in 37 DEG C, 5%CO2Continue in incubator culture 48 it is small when.
9,6 orifice plates add in 1ml Trizol per hole, are blown and beaten 10 times, are collected into EP pipes repeatedly with 1ml pipette tips； 12000g
Centrifugation 15 minutes, takes supernatant.
10,200ul chloroforms are added in into supernatant, firmly overturn mixing half a minute up and down, stand 3 minutes.
11,4 DEG C, 12000g centrifuges 15 minutes, at this time visible lysate points three layers：Upper strata is the RNA of water phase；Middle level is
DNA, lipid etc.；Lower floor is cell residue, albumen, polysaccharide etc..
12, taking supernatant 500ul, 167ul inhales three times in new EP pipes；Isometric isopropanol is added in, mixing is stood
After ten minutes, 4 DEG C, 12000g is centrifuged 10 minutes.
13, carefully remove supernatant, be careful not to lose RNA precipitate, add in 75% ethyl alcohol of 1ml, turn upside down, make precipitation
Block is resuspended.
14,4 DEG C, 12000g is centrifuged 10 minutes, is carefully removed supernatant, is blotted the liquid of tube wall as far as possible, is careful not to lose
RNA precipitate can centrifuge again if precipitation loosens.It dries about 15 minutes, until tube wall no liquid.
15, add in the DEPC water dissolutions RNA of appropriate volume (20-30ul), 58 DEG C of water-baths 10 minutes.
16, it takes out 2ul and quantifies, measure buffer:10mM TrisCl (pH7.8) carry out reverse transcription according to quantitative result.
(1A260=40 μ g/ml, A260/A280=1.8~2.1)
17, RNA reverse transcriptions
Reverse transcription is carried out according to operational manual, system is as follows：
(total system 20ul) is added in the PCR pipe of RNase-Free
Mixing, 65 DEG C of incubation 10min, ice bath, then adds at once
| 2.5U/μl Poly A Polymerase | 1μl |
| RTase Mix | 1μl |
| 5×PAP/RT Buffer | 5μl |
| dd H2O(RNase/Dnase free) | 8μl |
37 DEG C incubation 60min, 85 DEG C, 5min；CDNA freezes in -20 DEG C or PCR at once.
18, qPCR detections
1) on the premise of RT-PCR preliminary experiments find out optimal primer annealing temperature and template amount, 2 × SYBR is used
Green Mix prepare PCR Mix, and the sample number of upper machine and repeat number, calculate simultaneously as needed
PCR Mix are prepared, system is as follows：
| 2×SYBR Green Mix | 10μl |
| QPCR primers Mix | 1μl |
| Template | 5μl |
| Ultra-pure water | 4μl |
| Total volume | 20μl |
2) dispense to PCR8 connecting legs, micro centrifuge brief centrifugation mixing PCR system.
3) above-mentioned sample is put into IQ5 fluorescence quantitative PCR instruments, SYBR Green methods quantitative fluorescent PCRs are to analyze each gene
Expression, PCR programs set it is as follows：
PCR reactions can be set as 3 footworks：(the Tm values of annealing temperature combination primer and the result of RT-PCR preliminary experiments are voluntarily set
Fixed, melt curve analysis can set 60-95 DEG C)
Pre-degeneration Cycle 1:(1X)
Step 1:95.0℃ for 02:00.
PCR cycle Cycle 2:(40X)
Step 1:95.0℃ for 00:15.
Step 2:60.0℃ for 00:20.
Step 3:72.0℃ for 00:20.
Data collection and real-time analysis enabled.
Solubility curve Cycle 3:(71X)
Step 1:60.0℃-95.0℃ for 00:30.
Increase set point temperature after cycle 2by 0.5℃
Melt curve data collection and analysis enabled.
19, qPCR relative quantification interpretations of result
The relative expression quantity calculation formula of target gene is：2-△△Ct=2-【(△Ct)Test-(△Ct)Control】.Ct purposes are mesh
Gene C t values are marked, Ct internal references are house-keeping gene Ct values.△ Ct=Ct purpose-Ct house keepers represent that each sample target gene is opposite and manage
The opposite Ct values of family's gene, △ △ Ct=(△ Ct) Test- (△ Ct) Control represent that processing group relative comparison group is returned
One changes, and 2-△△CtIt represents the relative expression quantity of processing group relative comparison group, represents the relative fold expression of target gene.
Has_circ_0001756, has_circ_0000284, has_circ_ are built using above-mentioned identical method
The over-express vector of 0000711 or has_circ_0000268, and pass through qPCR and detect 293T after these overexpression plasmid transfections
Expression effect in cell.Design sketch is as shown in Figure 1.
Sequence table
<110>Shanghai Rui Sai Bioisystech Co., Ltd
<120>The DNA frames being overexpressed for circular rna and its application
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 89
<212> DNA
<213> artificial sequence
<400> 1
tgagattaca ggtgtgagcc accacccccg gcctcacttt ttgtaaaggt acgtactaat 60
gacttttttt ttatacttca ggtaagtct 89
<210> 2
<211> 70
<212> DNA
<213> artificial sequence
<400> 2
tctctctctc ttcaggtaag tagcaaggaa aagagttagg cccggcacgg tagctcacac 60
ctgtaatccc 70
<210> 3
<211> 889
<212> DNA
<213> artificial sequence
<400> 3
gaatagtaaa gaaacacatc ataaaacctc ccaggacata aaggtgagca cagaccctgt 60
ttggatcaag tcagttcctg gagcctgaat gatgactgct gaatcacggg aagccacggg 120
tctgtcccca caggctgcac aggagaagga tggtatcgta atagtgaagg tggaagagga 180
agatgaggaa gaccacatgt gggggcagga ttccacccta caggacacgc ctcctccaga 240
cccagagata ttccgccaac gcttcaggcg cttctgttac cagaacactt ttgggccccg 300
agaggctctc agtcggctga aggaactttg tcatcagtgg ctgcggccag aaataaacac 360
caaggaacag atcctggagc ttctggtgct agagcagttt ctttccatcc tgcccaagga 420
gctccaggtc tggctgcagg aataccgccc cgatagtgga gaggaggccg tgacccttct 480
agaagacttg gagcttgatt tatcaggaca acaggtaaaa agaggtgaaa cctattatgt 540
gtgagcaggg cacagacgtt gaaactggag ccaggagaag tattggcagg ctttaggtta 600
ttaggtggtt actctgtctt aaaaatgttc tggctttctt cctgcatcca ctggcatact 660
catggtctgt ttttaaatat tttaattccc atttacaaag tgatttaccc acaagcccaa 720
cctgtctgtc ttcaggtccc aggtcaagtt catggacctg agatgctcgc aagggggatg 780
gtgcctctgg atccagttca ggagtcctcg agctttgacc ttcatcacga ggccacccag 840
tcccacttca aacattcgtc tcggaaaccc cgcctcttac agtcacgag 889
<210> 4
<211> 1048
<212> DNA
<213> artificial sequence
<400> 4
tgagattaca ggtgtgagcc accacccccg gcctcacttt ttgtaaaggt acgtactaat 60
gacttttttt ttatacttca ggtaagtctg aatagtaaag aaacacatca taaaacctcc 120
caggacataa aggtgagcac agaccctgtt tggatcaagt cagttcctgg agcctgaatg 180
atgactgctg aatcacggga agccacgggt ctgtccccac aggctgcaca ggagaaggat 240
ggtatcgtaa tagtgaaggt ggaagaggaa gatgaggaag accacatgtg ggggcaggat 300
tccaccctac aggacacgcc tcctccagac ccagagatat tccgccaacg cttcaggcgc 360
ttctgttacc agaacacttt tgggccccga gaggctctca gtcggctgaa ggaactttgt 420
catcagtggc tgcggccaga aataaacacc aaggaacaga tcctggagct tctggtgcta 480
gagcagtttc tttccatcct gcccaaggag ctccaggtct ggctgcagga ataccgcccc 540
gatagtggag aggaggccgt gacccttcta gaagacttgg agcttgattt atcaggacaa 600
caggtaaaaa gaggtgaaac ctattatgtg tgagcagggc acagacgttg aaactggagc 660
caggagaagt attggcaggc tttaggttat taggtggtta ctctgtctta aaaatgttct 720
ggctttcttc ctgcatccac tggcatactc atggtctgtt tttaaatatt ttaattccca 780
tttacaaagt gatttaccca caagcccaac ctgtctgtct tcaggtccca ggtcaagttc 840
atggacctga gatgctcgca agggggatgg tgcctctgga tccagttcag gagtcctcga 900
gctttgacct tcatcacgag gccacccagt cccacttcaa acattcgtct cggaaacccc 960
gcctcttaca gtcacgagtc tctctctctt caggtaagta gcaaggaaaa gagttaggcc 1020
cggcacggta gctcacacct gtaatccc 1048
<210> 5
<211> 29
<212> DNA
<213> artificial sequence
<400> 5
ttagctagct gagattacag gtgtgagcc 29
<210> 6
<211> 30
<212> DNA
<213> artificial sequence
<400> 6
gctaagcttg ggattacagg tgtgagctac 30
<210> 7
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 7
caggtcaagt tcatggacct g 21
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 8
attcagactt acctgaagta 20
Claims (8)
1. a kind of DNA frames being overexpressed for circular rna of Formulas I sequence,
US-[N]n-DS
I
Wherein,
US is upstream sequence, as shown in SEQ ID NO.1,
DS is downstream sequence, as shown in SEQ ID NO.2,
[N]nFor intermediate sequence, N represents any one in tetra- kinds of deoxyribonucleotides of A, T, G, C, n identical or different N
It is in turn connected to form intermediate sequence.
2. the DNA frames being overexpressed as described in claim 1 for circular rna, it is characterised in that [N]nIt is
The sequence of circRNA.
3. the DNA frames being overexpressed as claimed in claim 2 for circular rna, it is characterised in that [N]nIt is endogenous
The sequence of circRNA.
4. the DNA frames being overexpressed as claimed in claim 3 for circular rna, it is characterised in that the endogenous circRNA
Sequence include has_circ_0001727, has_circ_0001756, has_circ_0000284, has_circ_0000711
Or has_circ_0000268.
5. the DNA frames being overexpressed as described in claim 1 for circular rna, it is characterised in that 150≤n≤3000.
6. a kind of DNA frames being overexpressed for circular rna, it is characterised in that its DNA sequence dna is as shown in SEQ ID NO.4.
7. a kind of expression vector, it is characterised in that pass through any DNA being overexpressed for circular rna of claim 1~6
Frame sequence insertion carrier for expression of eukaryon, slow virus carrier, are formed on gland relevant viral vector adenovirus vector.
8. the purposes of any DNA frames being overexpressed for circular rna of a kind of claim 1~6, it is characterised in that be used as
The overexpression of circRNA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711428211.5A CN108085331B (en) | 2017-12-26 | 2017-12-26 | DNA framework for circular RNA overexpression and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711428211.5A CN108085331B (en) | 2017-12-26 | 2017-12-26 | DNA framework for circular RNA overexpression and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108085331A true CN108085331A (en) | 2018-05-29 |
| CN108085331B CN108085331B (en) | 2021-06-25 |
Family
ID=62179408
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711428211.5A Active CN108085331B (en) | 2017-12-26 | 2017-12-26 | DNA framework for circular RNA overexpression and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108085331B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112852946A (en) * | 2021-01-15 | 2021-05-28 | 中国农业大学 | Diagnostic biomarker and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105087570A (en) * | 2015-09-07 | 2015-11-25 | 广州吉赛生物科技有限公司 | Annular RNA artificial over-expression frame as well as expression vector and construction method thereof |
| CN105176981A (en) * | 2015-09-17 | 2015-12-23 | 广州永诺生物科技有限公司 | DNA (deoxyribonucleic acid) sequence used for circular RNA (ribonucleic acid) expression, expression vector and applications of DNA sequence and expression vector |
| CN107058360A (en) * | 2017-04-04 | 2017-08-18 | 杨展 | A kind of circular rna expression vector establishment method and its application based on quick clone technology |
-
2017
- 2017-12-26 CN CN201711428211.5A patent/CN108085331B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105087570A (en) * | 2015-09-07 | 2015-11-25 | 广州吉赛生物科技有限公司 | Annular RNA artificial over-expression frame as well as expression vector and construction method thereof |
| CN105176981A (en) * | 2015-09-17 | 2015-12-23 | 广州永诺生物科技有限公司 | DNA (deoxyribonucleic acid) sequence used for circular RNA (ribonucleic acid) expression, expression vector and applications of DNA sequence and expression vector |
| CN107058360A (en) * | 2017-04-04 | 2017-08-18 | 杨展 | A kind of circular rna expression vector establishment method and its application based on quick clone technology |
Non-Patent Citations (4)
| Title |
|---|
| DONGMING LIANG等: "Short intronic repeat sequences facilitate circular RNA production", 《GENES & DEVELOPMENT》 * |
| ZHICHENG YAO等: "ZKSCAN1 gene and its related circular RNA (circZKSCAN1) both inhibit hepatocellular carcinoma cell growth, migration, and invasion but through different signaling pathways", 《MOLECULAR ONCOLOGY》 * |
| 曹洋等: "环状RNA mmu-circ-Pax3.1表达载体的构建及初步验证", 《中国畜牧兽医》 * |
| 樊代明: "《肿瘤研究前沿 第16卷》", 31 December 2016, 西安交通大学出版社 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112852946A (en) * | 2021-01-15 | 2021-05-28 | 中国农业大学 | Diagnostic biomarker and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108085331B (en) | 2021-06-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105176981B (en) | DNA sequence and expression vector and its application for circular rna expression | |
| CN106754904B (en) | The specific molecular label of cDNA a kind of and its application | |
| CN107502608A (en) | Construction method and application for sgRNA, ALDH2 gene delection cell line for knocking out people's ALDH2 genes | |
| CN108165549B (en) | Universal expression framework of artificial circular RNA and application thereof | |
| CN105087570A (en) | Annular RNA artificial over-expression frame as well as expression vector and construction method thereof | |
| CN108018301A (en) | The method for determining the core promoter and its interior transcription factor Myod binding sites of miR-27a genes | |
| CN106987640A (en) | PIK3CA detection in Gene Mutation primed probe and its kit | |
| CN110886021A (en) | Method for constructing single cell DNA library | |
| CN106636162A (en) | Enterovirus 68 type micro-replicon system based on human RNA polymerase I system and construction method of enterovirus 68 type micro-replicon system | |
| CN107663539A (en) | Circular rna circ PTGR1 purposes | |
| CN108588246A (en) | A kind of primer, probe, method and the kit of detection lower respiratory tract bacterium specific gene | |
| CN107287320A (en) | The LAMP detections of GAPDH genes are combined and kit with primer | |
| CN107338292A (en) | Method and kit based on high-flux sequence detection human genome mutational load | |
| CN109487005A (en) | For expanding the primer of the intranasal tumour virus whole genome sequence of goat region | |
| CN107653308B (en) | One group is combined and kit for distinguishing active tuberculosis patient with the primer pair of non-tuberculous pneumonia patient | |
| CN109251964A (en) | Recycle the method and application of microRNAs detection kit and specific detection circulation microRNAs | |
| CN109355290A (en) | A kind of plant circular rna expression frame and its application | |
| CN108085331A (en) | The DNA frames being overexpressed for circular rna and its application | |
| CN107022620A (en) | N RAS detection in Gene Mutation primed probes and its kit | |
| CN106244688A (en) | A kind of mark assessing adenocarcinoma of colon risk | |
| CN110317878A (en) | A kind of long-chain non-coding RNA and its application for bladder cancer diagnosis and treatment monitoring | |
| CN110144386A (en) | For detecting the primer, probe and kit of POLE gene mutation | |
| CN112251515A (en) | Primer and kit for detecting thyroid cancer targeted medication related gene variation | |
| CN109988825A (en) | Construct the method and its application of the full transcript amplified production of cell | |
| CN110343743A (en) | For identifying primer sets, reagent, kit, application and the identification method of tip of a root dental papilla stem cell |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20180904 Address after: Room 1501-312, Putuo Chamber of Commerce Building, 66 Shatian Street, Donggang Street, Putuo District, Zhoushan City, Zhejiang Province Applicant after: Zhejiang free trade zone ruicai biological medicine technology Co., Ltd. Address before: 201315 room 1701, 25 building, 3399 lane, Kang Xin Road, Pudong New Area, Shanghai. Applicant before: Shanghai Rui Sai Bioisystech Co., Ltd |
|
| TA01 | Transfer of patent application right | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |