CN107974440A - Endoglucanase, its encoding gene cel5A-h15 and its application - Google Patents

Abstract

The present invention relates to genetic engineering field, and in particular to a kind of endoglucanase, its encoding gene cel5A h15 and its application.A kind of gene cel5A h15 for encoding the endoglucanase, its nucleotide sequence is as shown in SEQ ID No.1.Bioinformatic analysis shows that the endoglucanase of the gene code belongs to the 5th family of glycoside hydrolase.Inventor is successfully cloned by designing primer, and the successful expression in prokaryotic expression system, and the most suitable action pH of the recombined endo dextranase through induced ultrasonic purifying gained is 6.0, and optimum temperature is 50 °C, and relatively stable enzymatic activity can be kept under 40 °C.The enzyme has stronger pH tolerances, and more than 70% enzymatic activity can be kept for 10.0 times in pH5.0.The recombined endo dextranase has larger research and commercial application potentiality.

Description

Endoglucanase, its encoding gene cel5A-h15 and its application

Technical field

The present invention relates to genetic engineering field, and in particular to a kind of endoglucanase, its encoding gene cel5A-h15 and It is applied.

Background technology

Main constituents of the cellulose as plant cell wall, are renewable resources most abundant in current nature, But its obstinate structure limits its utilization.The process of cellulose degradation into glucose needs endoglucanase (Endoglucanase, EC3.2.1.4), exoglucanase (exoglucanase, E.C.3.2.1.91) and beta-glucosidase The system same-action of enzyme (β-glucosidase, E.C.3.2.1.21) three kinds of cellulases.Wherein, endoglucanase is fine The plain most important component of enzyme system of dimension, it mainly acts on the noncrystalline domain of cellulose, β-Isosorbide-5-Nitrae sugar in random hydrolysis cellulose chain Glycosidic bond, cut staple element long-chain, is converted into the short chains of a large amount of different polymerization degrees, the degree of polymerization of cellulose is reduced, in degradation process It is middle to play crucial effect.Therefore, its Commercial cultivation is most important for the degradation efficiency of cellulose.At present, the enzyme has been It is widely used in the industries such as papermaking, weaving, food, bio-fuel, animal feeding.Being produced into using needs in these industries This is low, has different optimal pH and temperature, and the endoglucanase of better stability.In the past few decades, largely grind Study carefully the cost for concentrating on and how reducing fungi production cellulase, the main random mutagenesis including bacterium, industry optimization, foreign protein The methods of addition.However, being fully understood by due to lacking to complicated enzyme system and zymogenic bacteria, this process is relatively slow.Therefore, seek It is particularly important that looking for a large amount of new endoglucanase.

With group appearance learned, the microbial genome sequencing of some production lignocellulolyticenzymes is completed successively, is further Research provide clearly genetic background, more and more cellulose enzyme gene nucleotide sequences are determined, and in large intestine Expressed in bacillus and yeast, effectively supplemented with traditional enzyme system.And transcript profile sequencing is capable of providing gene cDNA The expression of sequence and gene, can truly reflect the expression of albumen in vivo, therefore, from environmental microorganism transcript profile It is relatively new that endo glucanase gene is excavated in information, while is also effective research direction.

The content of the invention

The present invention provides a kind of new endo glucanase gene cel5-h15, recombinase Cel5- after its prokaryotic expression H15 is thermophilic medium temperature enzyme, and stable enzymatic activity can be kept at 40 DEG C；Optimal reaction pH is 6.0, and optimal reactive temperature is 50 DEG C；Tool There are stronger pH tolerances, greater activity can be kept under pH5.0-10.0.

The technical solution adopted by the present invention to solve the technical problems is：

A kind of endoglucanase, its amino acid sequence is as shown in SEQ ID No.2.

A kind of endo glucanase gene cel5A-h15, its nucleotide sequence such as SEQ for encoding the endoglucanase Shown in ID No.1.Endo glucanase gene cel5A-h15 of the present invention comes from sheep rumen microorganism transcript profile data.

A kind of recombinant vector for including the endo glucanase gene cel5A-h15.

A kind of recombinant bacterium for including the xylanase gene cel5A-h15.

A kind of method for preparing endoglucanase, is the recombinant bacterium described in fermented and cultured, obtains endoglucanase.

The specific primer that the endo glucanase gene cel5A-h15 is used is expanded, the specific primer is： H15-F：5’ACAGCAAATGGGTCGCGGATCCATGAGCAAAAATGCAAAAATAGCTG 3 ', its nucleotide sequence such as SEQ Shown in ID No.3；H15-R：5’CTTGTCGACGGAGCTCGAATTCTTAATAGTTTCCGAATGAGTCGAAAAC 3 ', its core Nucleotide sequence is as shown in SEQ ID No.4.

The acquisition methods of endo glucanase gene cel5A-h15 of the present invention are as follows：

A, the structure of the clone of cel5A-h15 endo glucanase genes and recombinant plasmid pET-28a/cel5A-h15；

B, expression of the recombinant plasmid pET-28a/cel5A-h15 in e. coli bl21 (DE3)；

C, induction, purifying and the enzymatic property analysis of recombinant protein；

Preferably, clone and the recombinant plasmid pET-28a/ of step a cel5A-h15 endo glucanase genes The building process of cel5A-h15 is specific as follows：

1. PCR amplification endo-glucanase enzyme coding gene cel5A-h15；

2. Inverse PCR amplification prepares linearisation pET-28a plasmids；

Experience 3. homologous recombination method construction recombination plasmid pET-28a/cel5A-h15 is converted to e. coli bl21 (DE3) State cell.

Application in terms of cellulose degradation of the endoglucanase of the present invention under strong basicity environment, as alkalescence is washed Wash the industrial productions such as agent, textile industry.

The present invention has following advantages and good effect：

1. the gene cloned in the present invention comes from sheep rumen microorganism transcript profile data, ensure the novelty of gene.

2. select prokaryotic expression system in the present invention, there is genetic background to understand, is easy to operate and with short production cycle etc. excellent Point.

3. what is taken in the present invention during PCR amplification purpose fragment is the specific primer of designed, designed, can be effectively ensured Amplification efficiency and product specificities.

4. the endoglucanase of the present invention has wider pH accommodations, in the range of pH5.0-10.0, can protect Holding greater activity (in the range of pH5.0-9.0, can keep more than 90% enzymatic activity, more than 70% can be kept under pH10.0 Enzymatic activity).Therefore it can be used for the cellulose industry degraded under strong alkali environment, such as in detergent, weaving industry, compared to biography The textile of system acid endoglucanase processing can produce phenomenon of fading, and endoglucanase can be in alkaline ring in the present invention Handled in border, avoid this phenomenon from occurring.

Brief description of the drawings

Fig. 1 is clone and the expression strategy of cel5A-h15 endo glucanase genes；

Fig. 2 is clone's cel5A-h15PCR products；

Fig. 3 is the SDS-PAGE analysis charts of recombinant protein c el5A-H15；

Fig. 4 is influences of the pH to Cel5A-H15 enzymatic activitys；

Fig. 5 is the pH stability of Cel5A-H15 enzymes；

Fig. 6 is influence of the temperature to Cel5A-H15 enzymatic activitys；

Fig. 7 is the heat endurance of Cel5A-H15 enzymes.

Embodiment

Below by specific embodiment, technical scheme is described in further detail.It should be appreciated that this hair Bright implementation is not limited to the following examples, the accommodation in any form of makeing the present invention and/or changes all fall Enter the scope of the present invention.

In the present invention, if not refering in particular to, all parts, percentage are unit of weight, used equipment and raw material etc. It is commercially available or commonly used in the art.Method in following embodiments, is the normal of this area unless otherwise instructed Rule method.

Embodiment：

First, sheep rumen content Total RNAs extraction

Take rumen content sample extraction total serum IgE (following lysate RL, adsorption column RA, the deproteinized of -80 DEG C of freezen protectives Liquid RE, rinsing liquid RW, RNase Free Water are purchased from Ai Delai bio tech ltd) it is ground into rapidly in liquid nitrogen Powder, every 50~100mg samples are homogenized after adding the lysate RL of 1ml, and acutely concussion is mixed with cell lysis.Incubated at 15-30 DEG C Educating 5 minutes makes ribosome decompose completely.12000rpm, 4 DEG C of centrifugation 10min remove insoluble matter.Supernatant is transferred to one to do Net centrifuge tube, 0.2ml chloroforms are added per 1ml lysates RL, acutely vibrate 15s, 12000rpm, 4 DEG C of centrifugation 10min.Take Layer colourless aqueous phase is transferred in new pipe, adds the absolute ethyl alcohol of water phase volume half, is added after mixing in adsorption column RA, at room temperature 12000rpm centrifuges 45s, abandons supernatant.500 μ l protein liquid removal RE are added, 12000rpm centrifuges 45s at room temperature, abandons supernatant.Add 500 μ l rinsing liquid RW, 12000rpm centrifugations 45s, abandons supernatant at room temperature.500 μ l rinsing liquid RW are added again, at room temperature 12000rpm centrifuges 45s, abandons supernatant.13000rpm centrifuges 2min and removes rinsing liquid as far as possible at room temperature.Adsorption column RA is put into In RNase free centrifuge tubes, 50-80 μ l RNase Free Water are added in adsorbed film middle part, room temperature places 2min, 12000rpm centrifuges 1min, obtains total serum IgE, -80 DEG C of preservations.

2nd, the clone of cel5A-h15 genes

The clone of cel5A-h15 endo glucanase genes and expression strategy are shown in Fig. 1.

(1) using rumen content total serum IgE as template, the first chain cDNA (following Random are synthesized using reverse transcription Primer、RNase Free Water、5×RT Buffer、dNTP Mixture、RNase Inhibitor、ReverTra Ace is purchased from mill bio tech ltd of Japan)

1. following mixed liquor is prepared in microcentrifugal tube：

3. reaction solution is incubated 10min in 30 DEG C successively；42 DEG C of incubation 20min；99 DEG C of incubation 5min；4 DEG C of incubation 5min, Then brief centrifugation obtains the first chains of cDNA.

(2) cel5A-h15 gene magnifications

1. design the primer containing pet28a Component Vectors homologous sequences and carrier Inverse PCR amplification primer:

H15-F：5’ACAGCAAATGGGTCGCGGATCCATGAGCAAAAATGCAAAAATAGCTG 3 ', nucleotide sequence As shown in SEQ ID No.3,

H15-R：5’CTTGTCGACGGAGCTCGAATTCTTAATAGTTTCCGAATGAGTCGAAAAC 3 ', nucleotides sequence Row are as shown in SEQ ID No.4.

2. using the cDNA of synthesis as template PCR amplifications cel5A-h15 genes, the following (wherein 2 × Hide- of amplification system Fidelity Master Mix are purchased from Beijing Qing Kexin industry Bioisystech Co., Ltd)：

Vortex oscillation mixes, and is put into after slightly centrifuging in PCR instrument.The amplification condition of cel5A-h15 genes is as follows：

For PCR the result is shown in Fig. 2, amplification obtains the band of 1539bp, occurs in swimming lane without other miscellaneous bands, illustrates to design primer It is specific good.

3rd, the structure of recombinant plasmid pET-28a/cel5A-h15

(1) pET-28a carriers are linearized to prepare

PCR reversely expands pET-28a vector plasmids, prepares linearisation cloning vector.PCR amplification system is as follows：

Vortex oscillation mixes, and is put into after slightly centrifuging in PCR instrument.The amplification condition for linearizing pET-28a carriers is as follows：

(2) target gene is connected with pET-28a carriers

Using the principle of homologous recombination, by SoSoo recombinant clones kit, (holding up the new industry biotechnology of section purchased from Beijing has Limit company) quickly by target gene directed cloning into linearisation pET-28a carriers.Reaction system is as follows：

10 μ l systems, target gene are 5 with expression vector molar ratio:1,50 DEG C of reaction 30min.

4th, expression of the recombinant plasmid in Escherichia coli

It is heat-shock transformed to take 10 μ l connection products carefully to be mixed with E. coli competent BL21 (DE3), ice bath 30min；42 DEG C water-bath heat shock 50s, takes out ice bath 2min immediately；Add the SOC solution of 500 μ l, 37 DEG C of preheatings, 150rpm constant temperature incubations 1h； The bacterium solution after conversion is drawn, is coated in the LB screening and culturing mediums containing kanamycins, 37 DEG C of constant temperature incubation 12-16h；Picking bacterial plaque PCR identifications are carried out, the clone for confirming as the positive is transferred to expansion culture in the LB fluid nutrient mediums containing kanamycins.

5th, induction, purifying and the enzymatic property analysis of positive strain

(1) induction of positive strain

1. draw 10 μ l positive bacterium solutions to be forwarded in LB fluid nutrient mediums of the 5mL containing kanamycins (50 μ g/mL), 37 DEG C, 220rpm cultivates 12-16h；

2. 5mL bacterium solutions are forwarded in 200mL LB fluid nutrient mediums, 37 DEG C, 220rpm continues culture to OD=0.5- 1.0 (when about 3-4 is small)；

3. 2ml IPTG (final concentration 1mmol/L) are added, 20 DEG C, 150rpm low temperature induction cultures 6h；

4. the bacterium solution of induced expression is transferred in 50mL centrifuge tubes, 12000rpm, 4 DEG C of centrifugation 15min, discard supernatant, Add 30mL PBS buffer (pH7.4) and thalline is fully resuspended；

5. be put into the beaker for filling ice cube, ultrasonic wave crush repeatedly 3 times (each ultrasound 15min, working time 3s, Intermittent time 5s, No. 6 ultrasonic transformers, crush power 195W)；

6. broken bacterium solution 12000rpm, 4 DEG C of centrifugation 15min, gained supernatant is crude protein liquid (CP), use immediately or 4 DEG C Preserve.

(2) destination protein affinity chromatography

The crude protein liquid that step is obtained on 30mL is taken, Ni-NTA resin extender 2mL are added, after fully mixing, by mixed liquor Chromatography pillar is transferred to, upper prop is collected and penetrates liquid (flow-through) repeatedly, is denoted as FT.

When albumen sample liquid liquid level to be mixed is close to Ni-NTA resin extenders, with the Washing of 40 times of bed volumes (40mL) Buffer 1 (imidazoles containing 20mmol/L) washs pillar, except foreigh protein removing, collects cleaning solution with 1.5mL centrifuge tubes, is denoted as W1.

Pillar is washed with the washing buffer 2 (imidazoles containing 50mmol/L) of 1 times of bed volume (1mL) 2 times, is used 1.5mL centrifuge tubes collect cleaning solution, are denoted as W2, W3.

Destination protein, elution 4 are eluted with the Elution buffer (imidazoles containing 250mmol/L) of 1 times of bed volume (1mL) It is secondary, eluent is collected with 1.5mL centrifuge tubes, is denoted as E1, E2, E3, E4.

Purified product is subjected to SDS-PAGE analyses (Fig. 3), the results show：The albumen of recombinase Cel5A-H15 is a small amount of greatly For 60kDa or so.

(3) enzymatic property is analyzed

Endo-glucanase enzyme activity unit defines：The enzyme amount per minute for producing 1 μm of ol reduced sugar is 1 unit of activity (U), Calculation formula：Enzyme activity

A:Produce the concentration (μm ol/mL) of reduced sugar

K:Pure enzyme extension rate

T:The enzyme digestion reaction time (min)

C:Pure enzyme protein concentration (mg/mL)

Influences of the pH to enzymatic activity

Optimal pH:Be respectively adopted pH 3.0-10.0 buffer solution (wherein pH3.0-8.0 using McIlvaine ' s buffer Liquid, pH8.0-9.0 use Tris-HCl buffer solutions, and pH9.0-10.0 uses Glycine-NaOH buffer solutions) 1% carboxymethyl of configuration Sodium cellulosate (CMC) reaction substrate, takes 450 μ l substrates to preheat 5min in 50 DEG C, adds 50 μ l enzyme liquids, is reacted under the conditions of 50 DEG C 10min, adds 500 μ l DNS solution, relative activity is measured respectively using DNS methods.The results show (Fig. 4)：Recombinase Cel5A- The optimal pH of H15 is 6.0.

PH stability：Endoglucanase is incubated 30min under the conditions of pH 3.0-10.0,37 DEG C respectively, then most Enzyme activity is detected under the conditions of suitable.Using enzyme activity of the untreated endoglucanase under optimum condition as control, remaining inscribe is calculated The relative activity of dextranase.The results show (Fig. 5)：Recombinase Cel5A-H15 has stronger pH tolerances, in pH5.0- Greater activity can be kept between 10.0.

Influence of the temperature to enzyme activity

Optimum temperature：With pH6.0 buffer 1%CMC substrates, endoglucanase is measured using DNS methods respectively and is existed Enzyme activity at 30 DEG C -70 DEG C, calculates relative activity.The results show (Fig. 6)：The optimal reactive temperature of recombinase Cel5A-H15 is 50℃。

Heat endurance：Endoglucanase is respectively placed under the conditions of 40,50 and 60 DEG C and is incubated 50min respectively, every 10min samplings measure enzyme activity under optimum condition.Using enzyme activity of the untreated endoglucanase under optimum condition as control, Calculate the relative activity of remaining endoglucanase.The results show (Fig. 7)：Recombinase Cel5A-H15 is thermophilic medium temperature enzyme, at 40 DEG C When can keep greater activity, but when temperature is higher than 50 DEG C, enzymatic activity gradually reduces, and when being especially more than 60 DEG C, enzymatic activity drops rapidly It is low.

Conclusion：According to above-mentioned experiment conclusion, it was demonstrated that endoglucanase of the invention has wider pH tolerances, in height Remain to keep good enzymatic activity (in the range of pH5.0-9.0, can keep more than 90% enzyme activity under the particular surroundings of pH value Property, more than 70% enzymatic activity can be kept under pH10.0), there are larger industrialized production and application potential, can be applied to highly basic Cellulose degradation under property environment, such as alkaline detergent, textile industry industrial production.

Embodiment described above is the preferred version that the present invention excavates gene and external preparation endo-glucanase enzyme method, Not make limitation in any form to the present invention, also have it on the premise of without departing from the technical solution described in claim Its variation and remodeling.

Sequence table

<110>Zhejiang University

<120>Endoglucanase, its encoding gene cel5A-h15 and its application

<130> ZJDX-WJK001

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1539

<212> DNA

<213>Endo glucanase gene cel5A-h15 (Endoglucanase)

<400> 1

atgagcaaaa atgcaaaaat agctgtgata gcagctttcg ccgtgcttgc gacgatgatg 60

ggtatgcttt ttgcaaaaat aaatgccttg gaagcacaaa attctgccgg cggttcgccg 120

tctgttccgg ctgcagcgat gcaaaagaat gcctctcaaa ataatgaatc ttctgattct 180

tcgaatgtaa cacaaaatca ggacgatgaa attgttcttg atatatccta cggcgaaagt 240

tggggtgaaa tgggagaata ctatacaaac gtaactttga atttgaaaaa tacatcagat 300

aaagccgttt caaattggga agtgcttctt tcatcggcag aaggaacgag aattgaacaa 360

atttggaacg gagaaaaatc acaggaggga aatattatcc atataactcc cgtagaatac 420

aataaagaga ttgctccgct tgcccatttg caggcagctc ccggaatgat tgttgtatcg 480

agagagaagc ttttatttga aagcttctcg gcaaaggctg ttattgatgg cagtgatatt 540

ttgataaaat cttccgagaa caatatttct cctcaagaaa acaatgtagt ttcccttcct 600

gctgagcagg atttacctat ttcaaacggc agcggagttt cggctctcgg acaactcaaa 660

gtgataggta caaagctttg tgccgaagat ggaagtgtag ttgtgctgga aggaatgagt 720

tcacatgggc ttgcttggta tcccgaattt tctgccaaat attccgtaaa aaaaacaaag 780

gaatatggag ctaatgtata tagagctgct atgtatacgg aagaatacgg aggatataca 840

acaggtgaga atttcaggca ggaagcggaa aaaattctta taaatgctgt tgataccgca 900

aaaagtctcg atatgtatgc cataatagat tggcatatac tttctgatgg ttcaccttca 960

aaacataaaa atgaagcaat agattttttt gataggatat cgcaaaaata tgccaacgat 1020

cctgctgtta tttacgaaat atgtaatgaa cccaatggct cggactggag cagcgatata 1080

aagccgtatg caaatgaaat tatacccgta ataagaaaaa attcgccaaa tgccattgtg 1140

atagtgggta cgaatacatg gagtcaagat gtggataagg catccgaaga taaattatct 1200

tttgacaaca ttatgtattc tttccatttt tatgcgggaa ctcataaact tgatgtattt 1260

aagcaaaaaa tagaaaaagc tctcgcaaat ggatgtgccg tatttgttac agaatgggga 1320

acatctgcgg cagacggaaa caatggtgta tacattaaag aaagcggaga atggcttaaa 1380

tatctttctt caaaacaaat aagccgcata aattggtcac tttcaaataa aaatgaatct 1440

tcggcggctg ttttgccgag tgcctcggca gagaactttt cttatgaaga tttgagcgaa 1500

tcgggaaagt ttgttttcga ctcattcgga aactattga 1539

<210> 2

<211> 512

<212> PRT

<213>Endoglucanase (Endoglucanase)

<400> 2

Met Ser Lys Asn Ala Lys Ile Ala Val Ile Ala Ala Phe Ala Val Leu

1 5 10 15

Ala Thr Met Met Gly Met Leu Phe Ala Lys Ile Asn Ala Leu Glu Ala

20 25 30

Gln Asn Ser Ala Gly Gly Ser Pro Ser Val Pro Ala Ala Ala Met Gln

35 40 45

Lys Asn Ala Ser Gln Asn Asn Glu Ser Ser Asp Ser Ser Asn Val Thr

50 55 60

Gln Asn Gln Asp Asp Glu Ile Val Leu Asp Ile Ser Tyr Gly Glu Ser

65 70 75 80

Trp Gly Glu Met Gly Glu Tyr Tyr Thr Asn Val Thr Leu Asn Leu Lys

85 90 95

Asn Thr Ser Asp Lys Ala Val Ser Asn Trp Glu Val Leu Leu Ser Ser

100 105 110

Ala Glu Gly Thr Arg Ile Glu Gln Ile Trp Asn Gly Glu Lys Ser Gln

115 120 125

Glu Gly Asn Ile Ile His Ile Thr Pro Val Glu Tyr Asn Lys Glu Ile

130 135 140

Ala Pro Leu Ala His Leu Gln Ala Ala Pro Gly Met Ile Val Val Ser

145 150 155 160

Arg Glu Lys Leu Leu Phe Glu Ser Phe Ser Ala Lys Ala Val Ile Asp

165 170 175

Gly Ser Asp Ile Leu Ile Lys Ser Ser Glu Asn Asn Ile Ser Pro Gln

180 185 190

Glu Asn Asn Val Val Ser Leu Pro Ala Glu Gln Asp Leu Pro Ile Ser

195 200 205

Asn Gly Ser Gly Val Ser Ala Leu Gly Gln Leu Lys Val Ile Gly Thr

210 215 220

Lys Leu Cys Ala Glu Asp Gly Ser Val Val Val Leu Glu Gly Met Ser

225 230 235 240

Ser His Gly Leu Ala Trp Tyr Pro Glu Phe Ser Ala Lys Tyr Ser Val

245 250 255

Lys Lys Thr Lys Glu Tyr Gly Ala Asn Val Tyr Arg Ala Ala Met Tyr

260 265 270

Thr Glu Glu Tyr Gly Gly Tyr Thr Thr Gly Glu Asn Phe Arg Gln Glu

275 280 285

Ala Glu Lys Ile Leu Ile Asn Ala Val Asp Thr Ala Lys Ser Leu Asp

290 295 300

Met Tyr Ala Ile Ile Asp Trp His Ile Leu Ser Asp Gly Ser Pro Ser

305 310 315 320

Lys His Lys Asn Glu Ala Ile Asp Phe Phe Asp Arg Ile Ser Gln Lys

325 330 335

Tyr Ala Asn Asp Pro Ala Val Ile Tyr Glu Ile Cys Asn Glu Pro Asn

340 345 350

Gly Ser Asp Trp Ser Ser Asp Ile Lys Pro Tyr Ala Asn Glu Ile Ile

355 360 365

Pro Val Ile Arg Lys Asn Ser Pro Asn Ala Ile Val Ile Val Gly Thr

370 375 380

Asn Thr Trp Ser Gln Asp Val Asp Lys Ala Ser Glu Asp Lys Leu Ser

385 390 395 400

Phe Asp Asn Ile Met Tyr Ser Phe His Phe Tyr Ala Gly Thr His Lys

405 410 415

Leu Asp Val Phe Lys Gln Lys Ile Glu Lys Ala Leu Ala Asn Gly Cys

420 425 430

Ala Val Phe Val Thr Glu Trp Gly Thr Ser Ala Ala Asp Gly Asn Asn

435 440 445

Gly Val Tyr Ile Lys Glu Ser Gly Glu Trp Leu Lys Tyr Leu Ser Ser

450 455 460

Lys Gln Ile Ser Arg Ile Asn Trp Ser Leu Ser Asn Lys Asn Glu Ser

465 470 475 480

Ser Ala Ala Val Leu Pro Ser Ala Ser Ala Glu Asn Phe Ser Tyr Glu

485 490 495

Asp Leu Ser Glu Ser Gly Lys Phe Val Phe Asp Ser Phe Gly Asn Tyr

500 505 510

<210> 3

<211> 47

<212> DNA

<213>Artificial sequence (H15-F)

<400> 3

acagcaaatg ggtcgcggat ccatgagcaa aaatgcaaaa atagctg 47

<210> 4

<211> 54

<212> DNA

<213>Artificial sequence (H15-R)

<400> 4

cttgtcgacg gagctcgaat tcttatctta atagtttccg aatgagtcga aaac 54

Claims (9)

1. A kind of 1. endoglucanase, it is characterised in that：Its amino acid sequence is as shown in SEQ ID No.2.
2. 2. a kind of endo glucanase gene cel5A-h15 for encoding endoglucanase described in claim 1, its feature exist In：Its nucleotide sequence is as shown in SEQ ID No.1.
3. A kind of 3. recombinant vector for including endo glucanase gene cel5A-h15 described in claim 2.
4. A kind of 4. recombinant bacterium for including endo glucanase gene cel5A-h15 described in claim 2.
5. 5. a kind of method for preparing endoglucanase, is the recombinant bacterium described in fermented and cultured claim 4, obtains inscribe Portugal and gather Carbohydrase.
6. 6. expand the specific primer that endo glucanase gene cel5A-h15 described in claim 2 is used, it is characterised in that institute The specific primer stated is：

   H15-F：5’ACAGCAAATGGGTCGCGGATCCATGAGCAAAAATGCAAAAATAGCTG 3 ', its nucleotide sequence As shown in SEQ ID No.3,

   H15-R： 5’CTTGTCGACGGAGCTCGAATTCTTAATAGTTTCCGAATGAGTCGAAAAC 3 ', its nucleotides sequence Row are as shown in SEQ ID No.4.
7. A kind of 7. application in terms of cellulose degradation of the endoglucanase under strong basicity environment described in claim 1.
8. 8. application according to claim 7, it is characterised in that：The strong basicity environment is that pH is more than 7.0.
9. 9. application according to claim 7, it is characterised in that：The strong basicity environment is pH8.0-10.0.