CN107828762B - Endoglucanase, its encoding gene cel5A-h50 and its application - Google Patents

Abstract

The invention belongs to genetic engineering fields, and in particular to a kind of endoglucanase, its encoding gene cel5A-h50 and its application.A kind of gene cel5A-h50 encoding the endoglucanase, nucleotide sequence is as shown in SEQ ID No.1.Bioinformatic analysis shows that the endoglucanase of gene coding belongs to the 5th family of glycoside hydrolase.Inventor is successfully cloned by design primer, and the successful expression in prokaryotic expression system, the most suitable action pH for purifying resulting recombined endo dextranase through induced ultrasonic is 5.0, optimum temperature is 45 °C, metastable enzymatic activity is able to maintain at 40 °C or less, there is stronger pH tolerance at pH5.0-8.0, be able to maintain higher enzymatic activity.The recombined endo dextranase has biggish research and commercial application potentiality.

Description

Endoglucanase, its encoding gene cel5A-h50 and its application

Technical field

The invention belongs to genetic engineering fields, and in particular to a kind of endoglucanase, its encoding gene cel5A-h50 and It is applied.

Background technique

Main constituents of the cellulose as plant cell wall are the most abundant renewable resources in current nature, However its obstinate structure limits its utilization.Cellulose degradation needs endoglucanase at the process of glucose (endoglucanase, EC3.2.1.4), exoglucanase (exoglucanase, E.C.3.2.1.91) and beta-glucosidase The system same-action of enzyme (β-glucosidase, E.C.3.2.1.21) three kinds of cellulases.Wherein, endoglucanase is fine The most important ingredient of plain enzyme system is tieed up, it mainly acts on the noncrystalline domain of cellulose, the β in random hydrolysis cellulose chain-Isosorbide-5-Nitrae sugar Glycosidic bond, cut staple element long-chain are converted into the short chain of a large amount of different polymerization degrees, the degree of polymerization of cellulose are reduced, in degradation process It is middle to play crucial effect.Therefore, its Commercial cultivation is most important for the degradation efficiency of cellulose.Currently, the enzyme is It is widely used in the industries such as papermaking, weaving, food, bio-fuel, animal feeding.Being produced into using needs in these industries This is low, the endoglucanase with different optimal pH and temperature and better stability.In the past few decades, it largely grinds Study carefully the cost for concentrating on how reducing fungi production cellulase, the main random mutagenesis including bacterium, industry optimization, foreign protein The methods of addition.However, fully understanding due to lacking to complicated enzyme system and zymogenic bacteria, this process is relatively slow.Therefore, it seeks Look for a large amount of novel endoglucanases particularly important.

With group appearance learned, it is further that some microbial genome sequencings for producing lignocellulolyticenzymes are completed successively Research provide clearly genetic background, more and more cellulose enzyme gene nucleotide sequences are determined, and in large intestine It is expressed in bacillus and yeast, effectively supplements traditional enzyme system.And transcript profile sequencing is capable of providing gene cDNA The expression of sequence and gene can really reflect the expression of albumen in vivo, therefore, from environmental microorganism transcript profile It is relatively new that endo glucanase gene is excavated in information, while being also effective research direction.

Summary of the invention

The present invention provides a kind of novel endo glucanase gene cel5-h50, recombinase Cel5- after prokaryotic expression H50 is thermophilic medium temperature enzyme, is able to maintain stable enzymatic activity at 40 DEG C, and enzymatic activity reduces at any time at 50 DEG C or more；Optimal reaction temperature Degree is 45 DEG C, optimal pH 5.0；There is stronger tolerance at pH5.0-8.0, be able to maintain high enzyme activity.

The technical solution adopted by the present invention to solve the technical problems is:

A kind of endoglucanase, amino acid sequence is as shown in SEQ ID No.2.

A kind of endo glucanase gene cel5A-h50 encoding the endoglucanase, nucleotide sequence such as SEQ Shown in ID No.1.Endo glucanase gene cel5A-h50 of the present invention comes from sheep rumen microorganism transcript profile data.

A kind of recombinant vector comprising the endo glucanase gene cel5A-h50.

A kind of recombinant bacterium comprising the xylanase gene cel5A-h50.

A method of endoglucanase is prepared, is recombinant bacterium described in fermented and cultured, obtains endoglucanase.

Expand the specific primer that the endo glucanase gene cel5A-h50 is used, it is characterised in that the spy Specific primer are as follows: H50-F:5 'ACAGCAAATGGGTCGCGGATCCATGAGAGATGAAAGGAACGTTTTTATG 3 ', core Nucleotide sequence is as shown in SEQ ID No.3；H50-R:5 'CTTGTCGACGGAGCTCGAATTCTTATTTCTCCGGGAGAGAAT CG 3 ', nucleotide sequence such as SEQ ID N are o.4 shown.

The acquisition methods of endo glucanase gene cel5A-h50 of the present invention are as follows

A, the building of the clone of cel5A-h50 endo glucanase gene and recombinant plasmid pET-28a/cel5A-h50；

B, expression of the recombinant plasmid pET-28a/cel5A-h50 in e. coli bl21 (DE3)；

C, the induction, purifying of recombinant protein and enzymatic property analysis；

Preferably, clone and the recombinant plasmid pET-28a/ of step a cel5A-h50 endo glucanase gene The building process of cel5A-h50 is specific as follows:

1. PCR amplification endo-glucanase enzyme coding gene cel5A-h50；

2. Inverse PCR amplification preparation linearisation pET-28a plasmid；

Experience 3. homologous recombination method constitutes recombinant plasmid pET-28a/cel5A-h50 and converts to e. coli bl21 (DE3) State cell.

Application of the endoglucanase of the present invention in terms of the cellulose degradation under neutral and alkali environment, as alkalinity is washed Wash the industrial productions such as agent, textile industry.The strong basicity environment is that pH is greater than 7.0.Further, the strong basicity environment is pH7.0-8.0。

The present invention has following advantages and good effect:

1. the gene cloned in the present invention comes from sheep rumen microorganism transcript profile data, guarantee the novelty of gene.

2. select prokaryotic expression system in the present invention, there is genetic background to understand, is easy to operate and with short production cycle etc. excellent Point.

3. what is taken when PCR amplification target fragment in the present invention is the specific primer of designed, designed, can be effectively ensured Amplification efficiency and product specificities.

4. endoglucanase of the invention has stronger tolerance in pH5.0-8.0, it is able to maintain about 70% or more Enzymatic activity.Therefore it can be used for the cellulose industry degradation under middle alkali environment, such as in detergent, weaving industry, compared to tradition The textile of acid endoglucanase processing can generate phenomenon of fading, and endoglucanase can be in alkaline environment in the present invention In handled, avoid this phenomenon occur.

Detailed description of the invention

Fig. 1 is clone and the expression strategy of cel5A-h50 endo glucanase gene；

Fig. 2 is clone's cel5A-h50PCR product；

Fig. 3 is the SDS-PAGE analysis chart of recombinant protein c el5A-H50；

Fig. 4 is influence of the pH to Cel5A-H50 enzymatic activity；

Fig. 5 is the pH stability of Cel5A-H50 enzyme；

Fig. 6 is influence of the temperature to Cel5A-H50 enzymatic activity；

Fig. 7 is the thermal stability of Cel5A-H50 enzyme.

Specific embodiment

Below by specific embodiment, technical scheme of the present invention will be further explained in detail.It should be appreciated that this hair Bright implementation is not limited by the following examples, and the accommodation in any form made to the present invention and/or changed will all be fallen Enter the scope of the present invention.

In the present invention, if not refering in particular to, all parts, percentage are unit of weight, used equipment and raw material etc. It is commercially available or commonly used in the art.Method in following embodiments is unless otherwise instructed the normal of this field Rule method.

Embodiment:

One, sheep rumen content Total RNAs extraction

Take rumen content sample extraction total serum IgE (the following lysate RL, adsorption column RA, deproteinized of -80 DEG C of freezen protectives Liquid RE, rinsing liquid RW, RNase Free Water are purchased from Ai Delai Biotechnology Co., Ltd) it is ground into rapidly in liquid nitrogen Powder, every 50~100mg sample are homogenized after adding the lysate RL of 1ml, and acutely concussion is mixed with lytic cell.It is incubated at 15-30 DEG C Educating 5 minutes decomposes ribosome completely.12000rpm, 4 DEG C of centrifugation 10min remove insoluble matter.Supernatant is transferred to one to do Net centrifuge tube, every 1ml lysate RL are added 0.2ml chloroform, acutely vibrate 15s, 12000rpm, 4 DEG C of centrifugation 10min.It takes Layer colourless aqueous phase is transferred in new pipe, and the dehydrated alcohol of water phase volume half is added, and is added in adsorption column RA after mixing, at room temperature 12000rpm is centrifuged 45s, abandons supernatant.500 μ l protein liquid removal RE are added, 12000rpm is centrifuged 45s at room temperature, abandons supernatant.It is added 500 μ l rinsing liquid RW, 12000rpm is centrifuged 45s at room temperature, abandons supernatant.500 μ l rinsing liquid RW are added again, at room temperature 12000rpm is centrifuged 45s, abandons supernatant.13000rpm is centrifuged 2min and removes rinsing liquid as far as possible at room temperature.Adsorption column RA is put into In RNase free centrifuge tube, position adds 50-80 μ l RNase Free Water among adsorbed film, is placed at room temperature for 2min, 12000rpm is centrifuged 1min, obtains total serum IgE, -80 DEG C of preservations.

Two, the clone of cel5A-h50 gene

The clone of cel5A-h50 endo glucanase gene and expression strategy are shown in Fig. 1.

(1) using rumen content total serum IgE as template, the first chain cDNA (following Random is synthesized using reverse transcription Primer、RNase Free Water、5×RT Buffer、dNTP Mixture、RNase Inhibitor、ReverTra Ace is purchased from mill Biotechnology Co., Ltd, Japan)

1. preparing following mixed liquor in microcentrifugal tube:

65 DEG C of incubation 5min make RNA thermal denaturation, are immediately placed on ice.

2. preparing following reverse transcription reaction mixed liquor:

3. successively by reaction solution in 30 DEG C of incubation 10min；42 DEG C of incubation 20min；99 DEG C of incubation 5min；4 DEG C of incubation 5min, Then brief centrifugation obtains the first chain of cDNA.

(2) cel5A-h50 gene magnification

1. designing the primer containing pet28a Component Vectors homologous sequence and carrier Inverse PCR amplification primer:

H50-F:5 'ACAGCAAATGGGTCGCGGATCCATGAGAGATGAAAGGAACGTTTTTATG 3 ', nucleotides sequence It arranges as shown in SEQ ID No.3,

H50-R:5 'CTTGTCGACGGAGCTCGAATTCTTATTTCTCCGGGAGAGAATCG 3 ', nucleotide sequence is such as Shown in SEQ ID No.4.

2. using the cDNA of synthesis as template PCR amplifications cel5A-h50 gene, the following (wherein 2 × Hide- of amplification system Fidelity Master Mix is purchased from Beijing Qing Kexin industry Bioisystech Co., Ltd):

Vortex oscillation mixes, and is put into PCR instrument after being slightly centrifuged.The amplification condition of cel5A-h50 gene is as follows:

PCR result is shown in Fig. 2, and amplification obtains the band of 2073bp, occurs in swimming lane without other miscellaneous bands, illustrate design primer It is specific good.

Three, the building of recombinant plasmid pET-28a/cel5A-h50

(1) linearisation pET-28a carrier preparation

PCR reversely expands pET-28a vector plasmid, preparation linearisation cloning vector.PCR amplification system is as follows:

Vortex oscillation mixes, and is put into PCR instrument after being slightly centrifuged.The amplification condition for linearizing pET-28a carrier is as follows:

(2) target gene is connect with pET-28a carrier

Using the principle of homologous recombination, by SoSoo recombinant clone kit, (holding up the new industry biotechnology of section purchased from Beijing has Limit company) quickly by target gene directed cloning into linearisation pET-28a carrier.Reaction system is as follows:

10 μ l systems, target gene and expression vector molar ratio are 5:1,50 DEG C of reaction 30min.

Four, expression of the recombinant plasmid in Escherichia coli

It is heat-shock transformed that 10 μ l connection products and E. coli competent BL21 (DE3) is taken carefully to mix, ice bath 30min；42 DEG C water-bath heat shock 50s takes out ice bath 2min immediately；The SOC solution of 37 DEG C of 500 μ l preheatings, 150rpm constant temperature incubation 1h is added； Bacterium solution after drawing conversion, is coated in the LB screening and culturing medium containing kanamycins, 37 DEG C of constant temperature incubation 12-16h；Picking bacterial plaque PCR identification is carried out, positive clone is confirmed as and is transferred to expansion culture in the LB liquid medium containing kanamycins.

Five, the induction, purifying of positive strain and enzymatic property analysis

(1) induction of positive strain

1. it draws 10 μ l positive bacterium solutions to be forwarded in LB liquid medium of the 5mL containing kanamycins (50 μ g/mL), 37 DEG C, 220rpm cultivates 12-16h；

2. 5mL bacterium solution is forwarded in 200mL LB liquid medium, 37 DEG C, 220rpm continues culture to OD=0.5- 1.0 (about 3-4 hours)；

3. being added 2ml IPTG (final concentration 1mmol/L), 20 DEG C, 150rpm low temperature induction culture 6h；

4. the bacterium solution of inducing expression is transferred in 50mL centrifuge tube, 12000rpm, 4 DEG C of centrifugation 15min discard supernatant, 30mL PBS buffer solution (pH7.4) is added, thallus is sufficiently resuspended；

5. be put into the beaker for filling ice cube, ultrasonic wave be crushed repeatedly 3 times (each ultrasound 15min, working time 3s, Intermittent time 5s, No. 6 amplitude transformers are crushed power 195W)；

6. broken bacterium solution 12000rpm, 4 DEG C of centrifugation 15min, gained supernatant is crude protein liquid (CP), is used immediately or 4 DEG C It saves.

(2) destination protein affinity chromatography

It takes and walks crude protein liquid obtained on 30mL, Ni-NTA resin extender 2mL is added, after mixing well, by mixed liquor It is transferred to chromatography pillar, upper prop collection repeatedly penetrates liquid (flow-through), is denoted as FT.

When albumen sample liquid liquid level to be mixed is close to Ni-NTA resin extender, with the Washing of 40 times of bed volumes (40mL) Buffer 1 (imidazoles containing 20mmol/L) washs pillar, removes foreigh protein removing, collects cleaning solution with 1.5mL centrifuge tube, is denoted as W1.

It is washed pillar 2 times, is used with the washing buffer 2 (imidazoles containing 50mmol/L) of 1 times of bed volume (1mL) 1.5mL centrifuge tube collects cleaning solution, is denoted as W2, W3.

Destination protein, elution 4 are eluted with the Elution buffer (imidazoles containing 250mmol/L) of 1 times of bed volume (1mL) It is secondary, eluent is collected with 1.5mL centrifuge tube, is denoted as E1, E2, E3, E4.

Purified product is subjected to SDS-PAGE analysis (Fig. 3), as the result is shown: the albumen of recombinase Cel5A-H50 is a small amount of greatly For 80kDa or so.

(3) enzymatic property is analyzed

The definition of endo-glucanase enzyme activity unit: the enzyme amount for generating 1 μm of ol reduced sugar per minute is 1 unit of activity (U), Calculation formula:

A: the concentration (μm ol/mL) of reduced sugar is generated

K: pure enzyme extension rate

T: enzyme digestion reaction time (min)

C: pure enzyme protein concentration (mg/mL)

Influence of the pH to enzymatic activity

Optimal pH: be respectively adopted pH 3.0-10.0 buffer (wherein pH3.0-8.0 using McIlvaine ' s buffer Liquid, pH8.0-9.0 use Tris-HCl buffer, and pH9.0-10.0 uses Glycine-NaOH buffer) 1% carboxymethyl of configuration Sodium cellulosate (CMC) reaction substrate takes 450 μ l substrates in 50 DEG C of preheating 5min, 50 μ l enzyme solutions is added, react under the conditions of 50 DEG C 10min is added 500 μ l DNS solution, measures relative activity respectively using DNS method.As the result is shown (Fig. 4: recombinase Cel5A- The optimal pH of H50 is 5.0.

PH stability: endoglucanase is incubated for 30min under the conditions of pH 3.0-10.0,37 DEG C respectively, then most Enzyme activity is detected under the conditions of suitable.It is control with enzyme activity of the untreated endoglucanase under optimum condition, calculates remaining inscribe The relative activity of dextranase.As the result is shown (Fig. 5): recombinase Cel5A-H50 has stronger pH resistance between pH5.0-8.0 By property, it is able to maintain high enzyme activity.

Influence of the temperature to enzyme activity

Optimum temperature: pH6.0 buffer 1%CMC substrate is used, endoglucanase is measured using DNS method respectively and is existed Enzyme activity at 30 DEG C -70 DEG C calculates relative activity.As the result is shown (Fig. 6): the optimal reactive temperature of recombinase Cel5A-H50 is 45℃。

Thermal stability: endoglucanase being respectively placed under the conditions of 40,50 and 60 DEG C and is incubated for 50min respectively, every 10min sampling measures enzyme activity under optimum condition.It is control with enzyme activity of the untreated endoglucanase under optimum condition, Calculate the relative activity of remaining endoglucanase.As the result is shown (Fig. 7): recombinase Cel5A-H50 is thermophilic medium temperature enzyme, at 40 DEG C Under be able to maintain greater activity, but when temperature is higher than 50 DEG C, enzymatic activity is gradually decreased.

Conclusion: according to above-mentioned experiment conclusion, it was demonstrated that endoglucanase of the invention within the scope of pH5.0-8.0 have compared with High tolerance is able to maintain about 70% or more enzymatic activity, there is biggish industrialized production and application potential, can be applied to middle alkali Cellulose degradation under property environment, such as alkaline detergent, textile industry industrial production.

Embodiment described above is the preferred version that the present invention excavates gene and external preparation endo-glucanase enzyme method, It is not intended to limit the present invention in any form, there are also it on the premise of not exceeding the technical scheme recorded in the claims Its variant and remodeling.

Sequence table

<110>Zhejiang University

<120>endoglucanase, its encoding gene cel5A-h50 and its application

<130> ZJDX-WJK008

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2073

<212> DNA

<213>endo glucanase gene cel5A-h50 (endoglucanase)

<400> 1

atgagagatg aaaggaacgt ttttatgaat aaaaatttaa gaaaaaaact atcagctgct 60

atggctgcta ttacattatt ttcttctatc tcagctgcta cttgtgcttc aggcgtttat 120

gcagcacaga tcaatgctcc gacgcttgca gcaggtactg tatctgacag cacttctgat 180

acattcaata tacctgagct gagctttgat aagaagccgc ttcctgacaa ggcaagcatt 240

aagtttgttg aaaatatgcg tcttggctgg aacctcggca atactttcga tgcctatgac 300

gacacaggct gggtagacgg cgagatgaac atcgagacct gctggactca tacacctaaa 360

acatcaaaag aaatgataga cactgtaaag gcagcaggct tcaatacagt aagaatacct 420

gtttcatggc ataaccatgt tgacggtgat cttaaaataa gcaagcagtg gatcgacaga 480

gttcaggaag tagttgatta cgctgttgca gacggcctgt acgttatcat caacgttcat 540

catgataatg acaagagcaa tatgtacccc gatacagctc attatgaaag ttcaaagaag 600

tatatgactg caatctggaa gcaggttgct gagcgtttca aggattacga tgaaaagctc 660

gttttcgaga ctatgaacga accacgtctt acaggacaca ccaacgaatg gtggattgat 720

tacaataatg cagactgtat cgatgctata aagactatca ataagctcaa tcaggactgt 780

gttgatacta tccgtgcaac aggcggaaac aatggtgaaa gatatatagc tgttccgggt 840

tatgactgct cagttgacgg tgctaccaat aagtattttg aagtgccaaa ggacagcgct 900

aaggataagc ttatcgttgc agtacacgca tatgttcctt atggtttcgc actggctgaa 960

aaggatgatc cacagagcgt tgaaagattc aatatcaatt ctgatacaaa agatatcaca 1020

tgggctatag atacagttta tgataagtat gtatcaaagg gaatacctgt ttatgtaggt 1080

gagtatgctt cacttgacaa gaacaataat ctcaaggaca gagttgactg gacagcattc 1140

tatacagcat atgctgcatc aagaggagta acttgctgtt ggtgggatgc tcccggagat 1200

atgatgcttc ttgaaagagc aacatgcaca tggaaattcc cggctattgt tgctgctctc 1260

aataagtatg caggaaatgg aactgcacct gttataaaca caacagtacc cacagaaaca 1320

acaactacaa caactctcgc tcctcttgca gatggtgata agctctatgg taaaaaggac 1380

gctgaaggca tagttacatt ctctaaggct ataggcgata atgctttcat tgaggtaaag 1440

gcaggcgcag atacaggctt tatgaatggc tgtctcggct tctctgaaac agttgacggc 1500

aagaattact gggttgctta tgtatgggag gcaaagaagt catcaactat ctctttagat 1560

atggccattc cgggacagat agttgagatc aatggcgatg aaactctcga tgttaccgat 1620

aaggatacta tcaagaaggt aactgataag atcaagtcag agaaatcagc tatgcttcag 1680

gtatggtatg cttctgataa gtcaggtaag gagatcactc ctgcaagcag tgcagctgaa 1740

aacattgatg tctacattcc ggcagcaggc ggcgatgaca caacagtatc atcttctata 1800

gaaaccacaa ctactacttc agaaacaaca gtttcttctt cagagatcaa aaaagatatt 1860

ttctttggtg atgctaactg tgatggtaaa gtagatattt ctgatgctgt actcatcatg 1920

cagtcacttt caaatccttc aaaatataag cttactgagg atggaaaggc aaatgctgac 1980

tgtgcaggca acaatgatgg tataaccaac aatgatgcac ttgcgataca gaaatactgc 2040

ctcagtatta tcgattctct cccggagaaa taa 2073

<210> 2

<211> 690

<212> PRT

<213>endoglucanase (endoglucanase)

<400> 2

Met Arg Asp Glu Arg Asn Val Phe Met Asn Lys Asn Leu Arg Lys Lys

1 5 10 15

Leu Ser Ala Ala Met Ala Ala Ile Thr Leu Phe Ser Ser Ile Ser Ala

20 25 30

Ala Thr Cys Ala Ser Gly Val Tyr Ala Ala Gln Ile Asn Ala Pro Thr

35 40 45

Leu Ala Ala Gly Thr Val Ser Asp Ser Thr Ser Asp Thr Phe Asn Ile

50 55 60

Pro Glu Leu Ser Phe Asp Lys Lys Pro Leu Pro Asp Lys Ala Ser Ile

65 70 75 80

Lys Phe Val Glu Asn Met Arg Leu Gly Trp Asn Leu Gly Asn Thr Phe

85 90 95

Asp Ala Tyr Asp Asp Thr Gly Trp Val Asp Gly Glu Met Asn Ile Glu

100 105 110

Thr Cys Trp Thr His Thr Pro Lys Thr Ser Lys Glu Met Ile Asp Thr

115 120 125

Val Lys Ala Ala Gly Phe Asn Thr Val Arg Ile Pro Val Ser Trp His

130 135 140

Asn His Val Asp Gly Asp Leu Lys Ile Ser Lys Gln Trp Ile Asp Arg

145 150 155 160

Val Gln Glu Val Val Asp Tyr Ala Val Ala Asp Gly Leu Tyr Val Ile

165 170 175

Ile Asn Val His His Asp Asn Asp Lys Ser Asn Met Tyr Pro Asp Thr

180 185 190

Ala His Tyr Glu Ser Ser Lys Lys Tyr Met Thr Ala Ile Trp Lys Gln

195 200 205

Val Ala Glu Arg Phe Lys Asp Tyr Asp Glu Lys Leu Val Phe Glu Thr

210 215 220

Met Asn Glu Pro Arg Leu Thr Gly His Thr Asn Glu Trp Trp Ile Asp

225 230 235 240

Tyr Asn Asn Ala Asp Cys Ile Asp Ala Ile Lys Thr Ile Asn Lys Leu

245 250 255

Asn Gln Asp Cys Val Asp Thr Ile Arg Ala Thr Gly Gly Asn Asn Gly

260 265 270

Glu Arg Tyr Ile Ala Val Pro Gly Tyr Asp Cys Ser Val Asp Gly Ala

275 280 285

Thr Asn Lys Tyr Phe Glu Val Pro Lys Asp Ser Ala Lys Asp Lys Leu

290 295 300

Ile Val Ala Val His Ala Tyr Val Pro Tyr Gly Phe Ala Leu Ala Glu

305 310 315 320

Lys Asp Asp Pro Gln Ser Val Glu Arg Phe Asn Ile Asn Ser Asp Thr

325 330 335

Lys Asp Ile Thr Trp Ala Ile Asp Thr Val Tyr Asp Lys Tyr Val Ser

340 345 350

Lys Gly Ile Pro Val Tyr Val Gly Glu Tyr Ala Ser Leu Asp Lys Asn

355 360 365

Asn Asn Leu Lys Asp Arg Val Asp Trp Thr Ala Phe Tyr Thr Ala Tyr

370 375 380

Ala Ala Ser Arg Gly Val Thr Cys Cys Trp Trp Asp Ala Pro Gly Asp

385 390 395 400

Met Met Leu Leu Glu Arg Ala Thr Cys Thr Trp Lys Phe Pro Ala Ile

405 410 415

Val Ala Ala Leu Asn Lys Tyr Ala Gly Asn Gly Thr Ala Pro Val Ile

420 425 430

Asn Thr Thr Val Pro Thr Glu Thr Thr Thr Thr Thr Thr Leu Ala Pro

435 440 445

Leu Ala Asp Gly Asp Lys Leu Tyr Gly Lys Lys Asp Ala Glu Gly Ile

450 455 460

Val Thr Phe Ser Lys Ala Ile Gly Asp Asn Ala Phe Ile Glu Val Lys

465 470 475 480

Ala Gly Ala Asp Thr Gly Phe Met Asn Gly Cys Leu Gly Phe Ser Glu

485 490 495

Thr Val Asp Gly Lys Asn Tyr Trp Val Ala Tyr Val Trp Glu Ala Lys

500 505 510

Lys Ser Ser Thr Ile Ser Leu Asp Met Ala Ile Pro Gly Gln Ile Val

515 520 525

Glu Ile Asn Gly Asp Glu Thr Leu Asp Val Thr Asp Lys Asp Thr Ile

530 535 540

Lys Lys Val Thr Asp Lys Ile Lys Ser Glu Lys Ser Ala Met Leu Gln

545 550 555 560

Val Trp Tyr Ala Ser Asp Lys Ser Gly Lys Glu Ile Thr Pro Ala Ser

565 570 575

Ser Ala Ala Glu Asn Ile Asp Val Tyr Ile Pro Ala Ala Gly Gly Asp

580 585 590

Asp Thr Thr Val Ser Ser Ser Ile Glu Thr Thr Thr Thr Thr Ser Glu

595 600 605

Thr Thr Val Ser Ser Ser Glu Ile Lys Lys Asp Ile Phe Phe Gly Asp

610 615 620

Ala Asn Cys Asp Gly Lys Val Asp Ile Ser Asp Ala Val Leu Ile Met

625 630 635 640

Gln Ser Leu Ser Asn Pro Ser Lys Tyr Lys Leu Thr Glu Asp Gly Lys

645 650 655

Ala Asn Ala Asp Cys Ala Gly Asn Asn Asp Gly Ile Thr Asn Asn Asp

660 665 670

Ala Leu Ala Ile Gln Lys Tyr Cys Leu Ser Ile Ile Asp Ser Leu Pro

675 680 685

Glu Lys

690

<210> 3

<211> 49

<212> DNA

<213>artificial sequence (H50-F)

<400> 3

acagcaaatg ggtcgcggat ccatgagaga tgaaaggaac gtttttatg 49

<210> 4

<211> 49

<212> DNA

<213>artificial sequence (H50-R)

<400> 4

cttgtcgacg gagctcgaat tcttatctta tttctccggg agagaatcg 49

Claims (9)

1. a kind of endoglucanase, it is characterised in that: its amino acid sequence is as shown in SEQ ID No.2.

2. a kind of endo glucanase gene cel5A-h50 of endoglucanase described in coding claim 1, feature exist In: its nucleotide sequence is as shown in SEQ ID No.1.

3. a kind of recombinant vector comprising endo glucanase gene cel5A-h50 described in claim 2.

4. a kind of recombinant bacterium comprising endo glucanase gene cel5A-h50 described in claim 2.

5. a kind of method for preparing endoglucanase is fermented and cultured recombinant bacterium as claimed in claim 4, it is poly- to obtain inscribe Portugal Carbohydrase.

6. expanding the specific primer that endo glucanase gene cel5A-h50 described in claim 2 is used, it is characterised in that institute The specific primer stated are as follows:

H50-F:5 'ACAGCAAATGGGTCGCGGATCCATGAGAGATGAAAGGAACGTTTTTATG 3 ', nucleotides sequence It arranges as shown in SEQ ID No.3,

H50-R:5 'CTTGTCGACGGAGCTCGAATTCTTATTTCTCCGGGAGAGAATCG 3 ' its nucleotide sequence is such as Shown in SEQ ID No.4.

7. a kind of application of endoglucanase described in claim 1 in terms of the cellulose degradation under strong basicity environment.

8. application according to claim 7, it is characterised in that: the strong basicity environment is that pH is greater than 7.0.

9. application according to claim 7, it is characterised in that: the strong basicity environment is pH7.0-8.0.