CN107937371B - Endoglucanase, its encoding gene cel5A-h31 and its application - Google Patents

Abstract

The invention belongs to genetic engineering fields, and in particular to a kind of novel endoglucanase, its encoding gene cel5A-h31 and its application.A kind of gene cel5A-h31 encoding the endoglucanase, nucleotide sequence is as shown in SEQ ID No.1.Bioinformatic analysis shows that the endoglucanase of gene coding belongs to the 5th family of glycoside hydrolase.Inventor is successfully cloned by design primer, and the successful expression in prokaryotic expression system, the most suitable action pH for purifying resulting recombined endo dextranase through induced ultrasonic is 5.0, optimum temperature is 55 °C, metastable enzymatic activity is able to maintain at 50 °C or less, with stronger pH tolerance, 75% or more enzymatic activity is able to maintain at pH5.0-9.0.The recombined endo dextranase has biggish research and commercial application potentiality.

Description

Endoglucanase, its encoding gene cel5A-h31 and its application

Technical field

The invention belongs to genetic engineering fields, and in particular to a kind of novel endoglucanase, its encoding gene cel5A- H31 and its application.

Background technique

Main constituents of the cellulose as plant cell wall are the most abundant renewable resources in current nature, However its obstinate structure limits its utilization.Cellulose degradation needs endoglucanase at the process of glucose (endoglucanase, EC3.2.1.4), exoglucanase (exoglucanase, E.C.3.2.1.91) and beta-glucosidase The system same-action of enzyme (β-glucosidase, E.C.3.2.1.21) three kinds of cellulases.Wherein, endoglucanase is fine The most important ingredient of plain enzyme system is tieed up, it mainly acts on the noncrystalline domain of cellulose, the β in random hydrolysis cellulose chain-Isosorbide-5-Nitrae sugar Glycosidic bond, cut staple element long-chain are converted into the short chain of a large amount of different polymerization degrees, the degree of polymerization of cellulose are reduced, in degradation process It is middle to play crucial effect.Therefore, its Commercial cultivation is most important for the degradation efficiency of cellulose.Currently, the enzyme is It is widely used in the industries such as papermaking, weaving, food, bio-fuel, animal feeding.Being produced into using needs in these industries This is low, the endoglucanase with different optimal pH and temperature and better stability.In the past few decades, it largely grinds Study carefully the cost for concentrating on how reducing fungi production cellulase, the main random mutagenesis including bacterium, industry optimization, foreign protein The methods of addition.However, fully understanding due to lacking to complicated enzyme system and zymogenic bacteria, this process is relatively slow.Therefore, it seeks Look for a large amount of novel endoglucanases particularly important.

With group appearance learned, it is further that some microbial genome sequencings for producing lignocellulolyticenzymes are completed successively Research provide clearly genetic background, more and more cellulose enzyme gene nucleotide sequences are determined, and in large intestine It is expressed in bacillus and yeast, effectively supplements traditional enzyme system.And transcript profile sequencing is capable of providing gene cDNA The expression of sequence and gene can really reflect the expression of albumen in vivo, therefore, from environmental microorganism transcript profile It is relatively new that endo glucanase gene is excavated in information, while being also effective research direction.

Summary of the invention

The present invention provides a kind of novel endo glucanase gene cel5-h31, recombinase Cel5- after prokaryotic expression H31 is thermophilic medium temperature enzyme, is able to maintain stable enzymatic activity at 50 DEG C；Optimal reactive temperature is 55 DEG C, optimal pH 5.0；? PH5.0-9.0 has stronger tolerance, is able to maintain high enzyme activity.

The technical solution adopted by the present invention to solve the technical problems is:

A kind of endoglucanase, amino acid sequence is as shown in SEQ ID No.2.

A kind of endo glucanase gene cel5A-h31 encoding the endoglucanase, nucleotide sequence such as SEQ Shown in ID No.1.Endo glucanase gene cel5A-h31 of the present invention comes from sheep rumen microorganism transcript profile data.

A kind of recombinant vector comprising the endo glucanase gene cel5A-h31.

A kind of recombinant bacterium comprising the xylanase gene cel5A-h31.

A method of endoglucanase is prepared, is recombinant bacterium described in fermented and cultured, obtains endoglucanase.

Expand the specific primer that the endo glucanase gene cel5A-h31 is used, it is characterised in that the spy Specific primer are as follows: H31-F:5 'ACAGCAAATGGGTCGCGGATCCATGCAGCGTATCAAAATCTTAGCG 3 ', nucleotide Sequence is as shown in SEQ ID No.3；H31-R:5 'CTTGTCGACGGAGCTCGAATTCTTATGCCGCAGGCGCTTCC 3 ', Nucleotide sequence is as shown in SEQ ID No.4.

The acquisition methods of endo glucanase gene cel5A-h31 of the present invention are as follows

A, the building of the clone of cel5A-h31 endo glucanase gene and recombinant plasmid pET-28a/cel5A-h31；

B, expression of the recombinant plasmid pET-28a/cel5A-h31 in e. coli bl21 (DE3)；

C, the induction, purifying of recombinant protein and enzymatic property analysis；

Preferably, clone and the recombinant plasmid pET-28a/ of step a cel5A-h31 endo glucanase gene The building process of cel5A-h31 is specific as follows:

1. PCR amplification endo-glucanase enzyme coding gene cel5A-h31；

2. Inverse PCR amplification preparation linearisation pET-28a plasmid；

Experience 3. homologous recombination method constitutes recombinant plasmid pET-28a/cel5A-h31 and converts to e. coli bl21 (DE3) State cell.

Application of the endoglucanase of the present invention in terms of the cellulose degradation under alkaline environment, such as alkaline washing The industrial productions such as agent, textile industry.The strong basicity environment is that pH is greater than 7.0.Further, the strong basicity environment is pH8.0-10.0。

The present invention has following advantages and good effect:

1. the gene cloned in the present invention comes from sheep rumen microorganism transcript profile data, guarantee the novelty of gene.

2. select prokaryotic expression system in the present invention, there is genetic background to understand, is easy to operate and with short production cycle etc. excellent Point.

3. what is taken when PCR amplification target fragment in the present invention is the specific primer of designed, designed, can be effectively ensured Amplification efficiency and product specificities.

4. endoglucanase of the invention has at 50 DEG C or less compared with strong tolerance, it is able to maintain metastable enzyme activity Property.

5. endoglucanase of the invention has stronger pH tolerance in pH5.0-9.0, it is able to maintain greater activity (within the scope of pH5.0-8.0, being able to maintain 95% or more enzymatic activity, 75% or more enzymatic activity is able to maintain at pH9.0).Therefore It can be used for the cellulose industry degradation under alkaline environment, such as in detergent, weaving industry, compare convention acidic inscribe Portugal The textile of glycan enzymatic treatment can generate phenomenon of fading, and endoglucanase can be in alkaline environment in the present invention Reason avoids this phenomenon from occurring.

Detailed description of the invention

Fig. 1 is clone and the expression strategy of cel5A-h31 endo glucanase gene；

Fig. 2 is clone's cel5A-h31PCR product；

Fig. 3 is the SDS-PAGE analysis chart of recombinant protein c el5A-H31；

Fig. 4 is influence of the pH to Cel5A-H31 enzymatic activity；

Fig. 5 is the pH stability of Cel5A-H31 enzyme；

Fig. 6 is influence of the temperature to Cel5A-H31 enzymatic activity；

Fig. 7 is the thermal stability of Cel5A-H31 enzyme.

Specific embodiment

Below by specific embodiment, technical scheme of the present invention will be further explained in detail.It should be appreciated that this hair Bright implementation is not limited by the following examples, and the accommodation in any form made to the present invention and/or changed will all be fallen Enter the scope of the present invention.

In the present invention, if not refering in particular to, all parts, percentage are unit of weight, used equipment and raw material etc. It is commercially available or commonly used in the art.Method in following embodiments is unless otherwise instructed the normal of this field Rule method.

Embodiment:

One, sheep rumen content Total RNAs extraction

Take rumen content sample extraction total serum IgE (the following lysate RL, adsorption column RA, deproteinized of -80 DEG C of freezen protectives Liquid RE, rinsing liquid RW, RNase Free Water are purchased from Ai Delai Biotechnology Co., Ltd) it is ground into rapidly in liquid nitrogen Powder, every 50~100mg sample are homogenized after adding the lysate RL of 1ml, and acutely concussion is mixed with lytic cell.It is incubated at 15-30 DEG C Educating 5 minutes decomposes ribosome completely.12000rpm, 4 DEG C of centrifugation 10min remove insoluble matter.Supernatant is transferred to one to do Net centrifuge tube, every 1ml lysate RL are added 0.2ml chloroform, acutely vibrate 15s, 12000rpm, 4 DEG C of centrifugation 10min.It takes Layer colourless aqueous phase is transferred in new pipe, and the dehydrated alcohol of water phase volume half is added, and is added in adsorption column RA after mixing, at room temperature 12000rpm is centrifuged 45s, abandons supernatant.500 μ l protein liquid removal RE are added, 12000rpm is centrifuged 45s at room temperature, abandons supernatant.It is added 500 μ l rinsing liquid RW, 12000rpm is centrifuged 45s at room temperature, abandons supernatant.500 μ l rinsing liquid RW are added again, at room temperature 12000rpm is centrifuged 45s, abandons supernatant.13000rpm is centrifuged 2min and removes rinsing liquid as far as possible at room temperature.Adsorption column RA is put into In RNase free centrifuge tube, position adds 50-80 μ l RNase Free Water among adsorbed film, is placed at room temperature for 2min, 12000rpm is centrifuged 1min, obtains total serum IgE, -80 DEG C of preservations.

Two, the clone of cel5A-h31 gene

The clone of cel5A-h31 endo glucanase gene and expression strategy are shown in Fig. 1.

(1) using rumen content total serum IgE as template, the first chain cDNA (following Random is synthesized using reverse transcription Primer、RNase Free Water、5×RT Buffer、dNTP Mixture、RNase Inhibitor、ReverTra Ace is purchased from mill Biotechnology Co., Ltd, Japan)

1. preparing following mixed liquor in microcentrifugal tube:

65 DEG C of incubation 5min make RNA thermal denaturation, are immediately placed on ice.

2. preparing following reverse transcription reaction mixed liquor:

3. successively by reaction solution in 30 DEG C of incubation 10min；42 DEG C of incubation 20min；99 DEG C of incubation 5min；4 DEG C of incubation 5min, Then brief centrifugation obtains the first chain of cDNA.

(2) cel5A-h31 gene magnification

1. designing the primer containing pet28a Component Vectors homologous sequence and carrier Inverse PCR amplification primer:

H31-F:5 'ACAGCAAATGGGTCGCGGATCCATGCAGCGTATCAAAATCTTAGCG 3 ', nucleotide sequence As shown in SEQ ID No.3,

H31-R:5 'CTTGTCGACGGAGCTCGAATTCTTATGCCGCAGGCGCTTCC 3 ', nucleotide sequence such as SEQ Shown in ID No.4.

2. using the cDNA of synthesis as template PCR amplifications cel5A-h31 gene, the following (wherein 2 × Hide- of amplification system Fidelity Master Mix is purchased from Beijing Qing Kexin industry Bioisystech Co., Ltd):

Vortex oscillation mixes, and is put into PCR instrument after being slightly centrifuged.The amplification condition of cel5A-h31 gene is as follows:

PCR result is shown in Fig. 2, and amplification obtains the band of 1248bp, occurs in swimming lane without other miscellaneous bands, illustrate design primer It is specific good.

Three, the building of recombinant plasmid pET-28a/cel5A-h31

(1) linearisation pET-28a carrier preparation

PCR reversely expands pET-28a vector plasmid, preparation linearisation cloning vector.PCR amplification system is as follows:

Vortex oscillation mixes, and is put into PCR instrument after being slightly centrifuged.The amplification condition for linearizing pET-28a carrier is as follows:

(2) target gene is connect with pET-28a carrier

Using the principle of homologous recombination, by SoSoo recombinant clone kit, (holding up the new industry biotechnology of section purchased from Beijing has Limit company) quickly by target gene directed cloning into linearisation pET-28a carrier.Reaction system is as follows:

10 μ l systems, target gene and expression vector molar ratio are 5:1,50 DEG C of reaction 30min.

Four, expression of the recombinant plasmid in Escherichia coli

It is heat-shock transformed that 10 μ l connection products and E. coli competent BL21 (DE3) is taken carefully to mix, ice bath 30min；42 DEG C water-bath heat shock 50s takes out ice bath 2min immediately；The SOC solution of 37 DEG C of 500 μ l preheatings, 150rpm constant temperature incubation 1h is added； Bacterium solution after drawing conversion, is coated in the LB screening and culturing medium containing kanamycins, 37 DEG C of constant temperature incubation 12-16h；Picking bacterial plaque PCR identification is carried out, positive clone is confirmed as and is transferred to expansion culture in the LB liquid medium containing kanamycins.

Five, the induction, purifying of positive strain and enzymatic property analysis

(1) induction of positive strain

1. it draws 10 μ l positive bacterium solutions to be forwarded in LB liquid medium of the 5mL containing kanamycins (50 μ g/mL), 37 DEG C, 220rpm cultivates 12-16h；

2. 5mL bacterium solution is forwarded in 200mL LB liquid medium, 37 DEG C, 220rpm continues culture to OD=0.5- 1.0 (about 3-4 hours)；

3. being added 2ml IPTG (final concentration 1mmol/L), 20 DEG C, 150rpm low temperature induction culture 6h；

4. the bacterium solution of inducing expression is transferred in 50mL centrifuge tube, 12000rpm, 4 DEG C of centrifugation 15min discard supernatant, 30mL PBS buffer solution (pH7.4) is added, thallus is sufficiently resuspended；

5. be put into the beaker for filling ice cube, ultrasonic wave be crushed repeatedly 3 times (each ultrasound 15min, working time 3s, Intermittent time 5s, No. 6 amplitude transformers are crushed power 195W)；

6. broken bacterium solution 12000rpm, 4 DEG C of centrifugation 15min, gained supernatant is crude protein liquid (CP), is used immediately or 4 DEG C It saves.

(2) destination protein affinity chromatography

It takes and walks crude protein liquid obtained on 30mL, Ni-NTA resin extender 2mL is added, after mixing well, by mixed liquor It is transferred to chromatography pillar, upper prop collection repeatedly penetrates liquid (flow-through), is denoted as FT.

When albumen sample liquid liquid level to be mixed is close to Ni-NTA resin extender, with the Washing of 40 times of bed volumes (40mL) Buffer 1 (imidazoles containing 20mmol/L) washs pillar, removes foreigh protein removing, collects cleaning solution with 1.5mL centrifuge tube, is denoted as W1.

It is washed pillar 2 times, is used with the washing buffer 2 (imidazoles containing 50mmol/L) of 1 times of bed volume (1mL) 1.5mL centrifuge tube collects cleaning solution, is denoted as W2, W3.

Destination protein, elution 4 are eluted with the Elution buffer (imidazoles containing 250mmol/L) of 1 times of bed volume (1mL) It is secondary, eluent is collected with 1.5mL centrifuge tube, is denoted as E1, E2, E3, E4.

Purified product is subjected to SDS-PAGE analysis (Fig. 3), as the result is shown: the albumen of recombinase Cel5A-H31 is a small amount of greatly For 49kDa or so.

(3) enzymatic property is analyzed

The definition of endo-glucanase enzyme activity unit: the enzyme amount for generating 1 μm of ol reduced sugar per minute is 1 unit of activity (U), Calculation formula: enzyme activity

A: the concentration (μm ol/mL) of reduced sugar is generated

K: pure enzyme extension rate

T: enzyme digestion reaction time (min)

C: pure enzyme protein concentration (mg/mL)

Influence of the pH to enzymatic activity

Optimal pH: be respectively adopted pH 3.0-10.0 buffer (wherein pH3.0-8.0 using McIlvaine ' s buffer Liquid, pH8.0-9.0 use Tris-HCl buffer, and pH9.0-10.0 uses Glycine-NaOH buffer) 1% carboxymethyl of configuration Sodium cellulosate (CMC) reaction substrate takes 450 μ l substrates in 50 DEG C of preheating 5min, 50 μ l enzyme solutions is added, react under the conditions of 50 DEG C 10min is added 500 μ l DNS solution, measures relative activity respectively using DNS method.As the result is shown (Fig. 4: recombinase Cel5A- The optimal pH of H31 is 5.0.

PH stability: endoglucanase is incubated for 30min under the conditions of pH 3.0-10.0,37 DEG C respectively, then most Enzyme activity is detected under the conditions of suitable.It is control with enzyme activity of the untreated endoglucanase under optimum condition, calculates remaining inscribe The relative activity of dextranase.As the result is shown (Fig. 5): recombinase Cel5A-H31 has stronger pH resistance between pH5.0-9.0 By property, it is able to maintain high enzyme activity.

Influence of the temperature to enzyme activity

Optimum temperature: pH6.0 buffer 1%CMC substrate is used, endoglucanase is measured using DNS method respectively and is existed Enzyme activity at 30 DEG C -70 DEG C calculates relative activity.As the result is shown (Fig. 6): the optimal reactive temperature of recombinase Cel5A-H31 is 55℃。

Thermal stability: endoglucanase being respectively placed under the conditions of 40,50 and 60 DEG C and is incubated for 50min respectively, every 10min sampling measures enzyme activity under optimum condition.It is control with enzyme activity of the untreated endoglucanase under optimum condition, Calculate the relative activity of remaining endoglucanase.As the result is shown (Fig. 7): recombinase Cel5A-H31 is thermophilic medium temperature enzyme, at 50 DEG C It is able to maintain greater activity below, but when temperature is higher than 60 DEG C, enzymatic activity is reduced rapidly.

Conclusion: according to above-mentioned experiment conclusion, it was demonstrated that endoglucanase of the invention have preferable thermal stability and Wider pH tolerance is still able to maintain good enzymatic activity (within the scope of pH5.0-8.0, under the particular surroundings of high ph-values It is able to maintain 95% or more enzymatic activity, 75% or more enzymatic activity is able to maintain at pH9.0), there are biggish industrialized production and application Potentiality can be applied to the cellulose degradation under alkaline environment, such as alkaline detergent, textile industry industrial production.

Embodiment described above is the preferred version that the present invention excavates gene and external preparation endo-glucanase enzyme method, It is not intended to limit the present invention in any form, there are also it on the premise of not exceeding the technical scheme recorded in the claims Its variant and remodeling.

Sequence table

<110>Zhejiang University

<120>endoglucanase, its encoding gene cel5A-h31 and its application

<130> ZJDX-WJK003

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1248

<212> DNA

<213>endo glucanase gene cel5A-h31 (endoglucanase)

<400> 1

atgcagcgta tcaaaatctt agcggtggtc cttgctttat gcgttttagc cgggacggca 60

tcggcactgg ctgatgtgcc tgtcggtaca gaaggtatta ccgtgccggt gatcgatgat 120

ctgaaaaagt ttgaaatacc ggacaatgag gcaatggcac tgcttcggga catgaagtgc 180

ggatggaacc tcggaaatac atttgatgca tttaacggat ataccggaca tttttccgga 240

accggtatgg aaagtatctg ggtcgggatc aagaccaccc ggaaactgat tgccgccatt 300

aaggaggcgg gattcaatac aatccggatg cctgtaagct ggcataacca tgtcgatgag 360

aacgacatca ttgaccagga ctggatggac cgggtcaggg aagtggccgg atgggcgctg 420

gatgaaggca tgtatgtgat tgtgaacgtc catcatgaca acgacgtaca ttattactat 480

ccggattcgg cacactacga ccgttcagcc gcctatctgt cttctgtatg ggcgcagatt 540

gcggaggcgt tcaaagactg cgacgatcat ctgatcatcg aatcgatgaa tgagccccgt 600

cttgtcggaa cccagtatga atggagctgg aacgccggca tttcagactg cagactggca 660

gcaaaataca tcaatcagct caatcagctg tttgtcgata cagtacgcgc atccggagga 720

aacaacgcga cacgttacct ggccgttccg gcgtacagcg cttcgccggg aagcacggtt 780

gaccaggctt ttcagctgcc gcaagatacg caggataacc ggattattgt atcggcacac 840

gcctatactc cttataattt cgccctgaat ataaacagca acgaccggac atttgacctg 900

gaaaaggacc agaacaaaaa agaagagatt gcctcattta tgaacaaact gtataacagg 960

ttcattaagt acggcattcc ggtcatgatg gatgaattcg gcgcgcttga caaggacggg 1020

aacctccagg accgggtaaa tttcacagct tattatgtag cgtccgccag cacgagagga 1080

atcacctgcg tatggtggga caatcacgcg ttcggcggaa acggagaacg cttcggcctg 1140

attaaccggt caacagtgaa atgggtctat ccggacattg tcctggcaat ccaggaaaac 1200

tgcctgtata accgggaagg ggaaacggcg gaagcgcctg cggcatga 1248

<210> 2

<211> 415

<212> PRT

<213>endoglucanase (endoglucanase)

<400> 2

Met Gln Arg Ile Lys Ile Leu Ala Val Val Leu Ala Leu Cys Val Leu

1 5 10 15

Ala Gly Thr Ala Ser Ala Leu Ala Asp Val Pro Val Gly Thr Glu Gly

20 25 30

Ile Thr Val Pro Val Ile Asp Asp Leu Lys Lys Phe Glu Ile Pro Asp

35 40 45

Asn Glu Ala Met Ala Leu Leu Arg Asp Met Lys Cys Gly Trp Asn Leu

50 55 60

Gly Asn Thr Phe Asp Ala Phe Asn Gly Tyr Thr Gly His Phe Ser Gly

65 70 75 80

Thr Gly Met Glu Ser Ile Trp Val Gly Ile Lys Thr Thr Arg Lys Leu

85 90 95

Ile Ala Ala Ile Lys Glu Ala Gly Phe Asn Thr Ile Arg Met Pro Val

100 105 110

Ser Trp His Asn His Val Asp Glu Asn Asp Ile Ile Asp Gln Asp Trp

115 120 125

Met Asp Arg Val Arg Glu Val Ala Gly Trp Ala Leu Asp Glu Gly Met

130 135 140

Tyr Val Ile Val Asn Val His His Asp Asn Asp Val His Tyr Tyr Tyr

145 150 155 160

Pro Asp Ser Ala His Tyr Asp Arg Ser Ala Ala Tyr Leu Ser Ser Val

165 170 175

Trp Ala Gln Ile Ala Glu Ala Phe Lys Asp Cys Asp Asp His Leu Ile

180 185 190

Ile Glu Ser Met Asn Glu Pro Arg Leu Val Gly Thr Gln Tyr Glu Trp

195 200 205

Ser Trp Asn Ala Gly Ile Ser Asp Cys Arg Leu Ala Ala Lys Tyr Ile

210 215 220

Asn Gln Leu Asn Gln Leu Phe Val Asp Thr Val Arg Ala Ser Gly Gly

225 230 235 240

Asn Asn Ala Thr Arg Tyr Leu Ala Val Pro Ala Tyr Ser Ala Ser Pro

245 250 255

Gly Ser Thr Val Asp Gln Ala Phe Gln Leu Pro Gln Asp Thr Gln Asp

260 265 270

Asn Arg Ile Ile Val Ser Ala His Ala Tyr Thr Pro Tyr Asn Phe Ala

275 280 285

Leu Asn Ile Asn Ser Asn Asp Arg Thr Phe Asp Leu Glu Lys Asp Gln

290 295 300

Asn Lys Lys Glu Glu Ile Ala Ser Phe Met Asn Lys Leu Tyr Asn Arg

305 310 315 320

Phe Ile Lys Tyr Gly Ile Pro Val Met Met Asp Glu Phe Gly Ala Leu

325 330 335

Asp Lys Asp Gly Asn Leu Gln Asp Arg Val Asn Phe Thr Ala Tyr Tyr

340 345 350

Val Ala Ser Ala Ser Thr Arg Gly Ile Thr Cys Val Trp Trp Asp Asn

355 360 365

His Ala Phe Gly Gly Asn Gly Glu Arg Phe Gly Leu Ile Asn Arg Ser

370 375 380

Thr Val Lys Trp Val Tyr Pro Asp Ile Val Leu Ala Ile Gln Glu Asn

385 390 395 400

Cys Leu Tyr Asn Arg Glu Gly Glu Thr Ala Glu Ala Pro Ala Ala

405 410 415

<210> 3

<211> 46

<212> DNA

<213>artificial sequence (H31-F)

<400> 3

acagcaaatg ggtcgcggat ccatgcagcg tatcaaaatc ttagcg 46

<210> 4

<211> 46

<212> DNA

<213>artificial sequence (H31-R)

<400> 4

cttgtcgacg gagctcgaat tcttatctta tgccgcaggc gcttcc 46

Claims (9)

1. a kind of endoglucanase, it is characterised in that: its amino acid sequence is as shown in SEQ ID No.2.

2. a kind of endo glucanase gene cel5A-h31 of endoglucanase described in coding claim 1, feature exist In: its nucleotide sequence is as shown in SEQ ID No.1.

3. a kind of recombinant vector comprising endo glucanase gene cel5A-h31 described in claim 2.

4. a kind of recombinant bacterium comprising endo glucanase gene cel5A-h31 described in claim 2.

5. a kind of method for preparing endoglucanase is fermented and cultured recombinant bacterium as claimed in claim 4, it is poly- to obtain inscribe Portugal Carbohydrase.

6. expanding the specific primer that endo glucanase gene cel5A-h31 described in claim 2 is used, it is characterised in that institute The specific primer stated are as follows:

H31-F:5 'ACAGCAAATGGGTCGCGGATCCATGCAGCGTATCAAAATCTTAGCG 3 ', nucleotide sequence As shown in SEQ ID No.3,

H31-R:5 'CTTGTCGACGGAGCTCGAATTCIts nucleotide sequence of TTATGCCGCAGGCGCTTCC 3 ' such as SEQ Shown in ID No.4.

7. a kind of application of endoglucanase described in claim 1 in terms of the cellulose degradation under strong basicity environment.

8. application according to claim 7, it is characterised in that: the strong basicity environment is that pH is greater than 7.0.

9. application according to claim 7, it is characterised in that: the strong basicity environment is pH8.0-10.0.