CN112195167B - Beta-glucanase, coding gene IDSGH5-26 thereof and application thereof - Google Patents

Abstract

The invention relates to glucanase, in particular to beta-glucanase and a coding gene thereofIDSGH5‑26And the application thereof, belonging to the field of genetic engineering. Beta-glucanase gene for coding beta-glucanase from Hu sheep rumen microorganismsIDSGH5‑26The nucleotide sequence is shown in SEQ ID No. 1. The optimum temperature of the beta-glucanase is 50 ℃, and the beta-glucanase keeps good stability at 40 ℃. The enzyme has the optimum pH value of 5.0 and strong pH tolerance, can keep more than 74% of activity at the pH value of 4.0-10.0, and the products of degrading beta-glucan are monosaccharide and oligomeric cellooligosaccharide with the polymerization degree of 2-4. The recombinant beta-glucanase has good industrial application value.

Description

Beta-glucanase, coding gene IDSGH5-26 thereof and application thereof

Technical Field

The invention relates to glucanase, in particular to beta-glucanase, an encoding gene IDSGH5-26 thereof and application thereof, belonging to the field of genetic engineering.

Background

The linear polysaccharide formed by connecting hundreds or even thousands of beta-D-glucose residues through beta-1, 3 and beta-1, 4-glycosidic bonds is one of the main structural polysaccharide components of the cell wall of gramineous plants, accounts for about 5.5% of dry matter, and is widely present in the cell wall of microorganisms such as bacteria, yeast, large fungi and the like. Beta-glucan, a class of non-starch polysaccharides (NSP), is an important anti-nutritional factor in vegetable feed. It has high viscosity, is not easy to degrade and is difficult to digest, absorb and utilize by monogastric animals such as pigs, poultry and the like, which can cause the utilization rate of grains and related feeds to be reduced, and greatly improve the breeding cost.

Beta-glucanase refers to a large class of Glycoside Hydrolases (GHs) capable of degrading beta-glucan, and has important application value in feed industry and food industry as feed additives, polysaccharide modified solubilizers and the like. The high-efficiency application of the beta-glucanase in industry depends on the maintenance of high catalytic activity in environments such as high temperature, pH and the like. In recent years, certain achievements are achieved by analyzing and modifying the enzymatic properties of beta-glucanase by methods such as new enzyme screening, irrational/semi-rational/rational modification, computer simulation and the like. However, the currently obtained beta-glucanase still has defects, particularly the acid resistance of the beta-glucanase is insufficient. It is therefore of great importance to find a large number of novel beta-glucanases. Along with the application of omics technology in the aspect of sequencing microbial genomes, more and more cellulases with clear genetic backgrounds are obtained, and the traditional enzyme system is effectively enriched. And the transcriptome sequencing provides the cDNA sequence of the gene and the expression level of the gene, and more accurately reflects the expression condition of the protein in vivo. Therefore, the discovery of glucanase genes from the rumen microbial transcriptome is a novel and effective research direction.

Disclosure of Invention

The invention aims to provide beta-glucanase which has strong pH tolerance, can keep more than 74 percent of enzyme activity at the pH of 4.0-10.0 and can be used for degrading fibrous polysaccharide under wide pH conditions.

The technical scheme adopted by the invention for solving the technical problems is as follows:

the amino acid sequence of the beta-glucanase IDSGH5-26 is shown in SEQ ID No. 2. Bioinformatics shows that the beta-glucanase coded by the gene belongs to glycoside hydrolase 5 family. The prokaryotic expression recombinase IDSGH5-26 is mesophilic enzyme, the optimal temperature is 50 ℃, and good stability is kept at 40 ℃; the enzyme has an optimum pH of 5.0, strong pH tolerance, and can maintain enzyme activity of over 74% at a pH of 4.0-10.0.

A beta-glucanase gene IDSGH5-26 for coding the beta-glucanase, and the nucleotide sequence is shown as SEQ ID No. 1. The gene is from Hu sheep rumen microorganism transcriptome data.

A recombinant vector pET28a/IDSGH5-26 containing the beta-glucanase gene IDSGH5-26.

A recombinant bacterium BL21/pET28a/IDSGH5-26 containing the beta-glucanase gene IDSGH5-26.

The method for preparing the beta-glucanase is to ferment and culture the recombinant bacteria to obtain the beta-glucanase.

Specific primers adopted for amplifying the beta-glucanase gene IDSGH5-26 are as follows: IDSGH5-26-F:5'ACAGCAAATGGGTCGCGGATCCATGTTGAATATAAAAATGG 3', the nucleotide sequence of which is shown as SEQ ID No. 3;

IDSGH5-26-R:5’CTTGTCGACGGAGCTCGAATTCTTATCTGTCATTCTCTCATCTG 3' with the nucleotide sequence as shown in SEQ ID No. 4.

The application of the beta-glucanase in degrading the fibrous polysaccharide under a wide range of pH conditions. Such as: animal feed production in an acidic environment and cellulose degradation in an alkaline environment.

Preferably, the broad pH condition is from 4.0 to 10.0.

A method for obtaining a beta-glucanase gene IDSGH5-26, which comprises the following steps:

a. cloning beta-glucanase gene IDSGH5-26 and constructing recombinant plasmid pET28a/IDSGH 5-26;

b. the expression of the recombinant plasmid pET28a/IDSGH5-26 in the escherichia coli BL 21;

c. induction and purification of recombinant protein and enzyme characteristic analysis.

Preferably, the cloning of the IDSGH5-26 β -glucanase gene and the construction of the recombinant plasmid pET28a/IDSGH5-26 in step a are as follows:

(1) amplifying a beta-glucanase gene IDSGH5-26 by PCR and purifying;

(2) carrying out double enzyme digestion on the pET28a vector by BamHI and EcoRI;

(3) carrying out homologous recombination on the purified IDSGH5-26 and pET28a subjected to double enzyme digestion;

(4) the recombinant plasmid pET28a/IDSGH5-26 is transformed into the competent cells of the Escherichia coli BL 21.

Compared with the prior art, the invention has the advantages that:

1. the cloned gene is from Hu sheep rumen microorganism transcriptome data, so that the novelty of the gene is ensured;

2. the prokaryotic expression system is selected, so that the method has the advantages of clear genetic background, capability of obtaining a gene expression product in a short time, low required cost and the like;

3. the invention adopts the self-designed specific primer when the target fragment is amplified by PCR, which can effectively ensure the amplification efficiency and the product specificity;

4. the optimum temperature of the beta-glucanase IDSGH5-26 is 50 ℃, and the beta-glucanase IDSGH keeps good stability at the temperature of 40 ℃. The enzyme has strong pH tolerance, can keep more than 74% of activity at the pH of 4.0-10.0, and can catalyze and degrade products of glucan, such as monosaccharide and oligomeric cellooligosaccharide with the polymerization degree of 2-4. Therefore, the recombinant beta-glucanase has good industrial application value.

Drawings

FIG. 1 is the clone IDSGH5-26 PCR product;

FIG. 2 is an SDS-PAGE analysis of the recombinant protein IDSGH 5-26;

FIG. 3 is the effect of temperature on the enzymatic activity of the recombinant protein IDSGH 5-26;

FIG. 4 is the thermostability of the recombinant protein IDSGH 5-26;

FIG. 5 is the effect of pH on the enzymatic activity of the recombinant protein IDSGH 5-26;

FIG. 6 shows the pH stability of the recombinant protein IDSGH 5-26;

FIG. 7 is a hydrolysate analysis of the recombinant protein IDSGH5-26.

Detailed Description

The technical solution of the present invention will be further specifically described below by way of specific examples. It is to be understood that the invention is not limited to the following examples, and that any changes and/or modifications may be made to the invention as described herein.

In the present invention, all parts and percentages are by weight, unless otherwise specified, and the equipment and materials used are commercially available or commonly used in the art. The methods in the following examples are conventional in the art unless otherwise specified.

Examples

1. Extraction of total RNA from Hu sheep rumen content

(1) Rumen content samples frozen and preserved at-80 ℃ are quickly ground into powder in liquid nitrogen, 1ml of RNApure ultra-pure total RNA (RNAApure ultra-pure total RNA) quick extraction kit (Edelay Biotechnology Co., ltd., beijing, china) is added into each 50-100 mg of samples, and then liquid RL is homogenized. Sample volume cannot exceed 10% of RL volume;

(2) Violently oscillating and uniformly mixing the homogenate sample on a vortex oscillator to crack cells, and incubating for 5min at the temperature of 15-30 ℃ to completely decompose nucleoprotein;

(3) Centrifuging at 4 deg.C and 12000rpm for 10min to remove insoluble substances, carefully taking supernatant, and transferring into a new centrifuge tube without RNase;

(4) Adding 0.2ml of chloroform into each ml of lysate RL, violently shaking for 15s,12000rpm, and centrifuging for 10min at 4 ℃;

(5) Transferring the upper colorless aqueous phase to a new tube, adding absolute ethyl alcohol with half volume of the aqueous phase, uniformly mixing, adding into an adsorption column RA, centrifuging at 12000rpm for 45s at room temperature, and removing the supernatant;

(6) Adding 500 μ l deproteinized solution RE, centrifuging at 12000rpm at room temperature for 45s, and discarding the supernatant;

(7) Adding 500 mul of bleaching solution RW, centrifuging at 12000rpm for 45s at room temperature, and discarding the supernatant;

(8) Repeating the step 7;

(9) Centrifuging at 13000rpm for 2min at room temperature, and removing bleaching liquid as much as possible;

(10) Placing the adsorption column RA into a centrifugal tube without RNase, adding 50-80 μ l sterile water without RNase into the middle part of the adsorption membrane, standing at room temperature for 2min, and centrifuging at 12000rpm for 1min to obtain total RNA, and storing at-80 deg.C.

2. Cloning of IDSGH5-26 Gene

Synthesis of cDNA

And (3) carrying out reverse transcription by taking total RNA of rumen content as a template to synthesize first strand cDNA.

(1) The following mixed liquid is prepared in a micro-centrifugal tube

Random Primer(25pmol/μl)	1μl
		Total RNA	1 μ g or less
Adding RNase Free Water to	12μl

RNA was heat denatured by incubation at 65 ℃ for 5min and immediately placed on ice.

(2) The following reverse transcription reaction mixture was prepared

RNA solution after first denaturation	12μl
			5×RT Buffer	4μl
dNTP mix (10 mM each)	2μl
		RNase Inhibitor(10U/μl)	1μl
ReverTra Ace	1μl
		Total volume	20μl

(3) Incubating the reaction solution at 30 ℃ for 10min; incubating at 42 deg.C for 20min; incubating at 99 deg.C for 5min; incubate at 4 ℃ for 5min, then perform transient centrifugation to obtain cDNA.

2. The PCR amplification of the target gene takes synthesized cDNA as a template, and utilizes self-designed specific primers 'IDSGH 5-26-F and IDSGH 5-26-R' to PCR amplify the target gene, wherein an amplification system is as follows:

2×Hide-Fidelity Master Mix	25μl
		IDSGH5-26-F	2μl
IDSGH5-26-R	2μl
		cDNA template	2μl
Add ddH 2 O to	50μl

Vortex, shake and mix evenly, put into PCR instrument after being centrifugated slightly. The amplification conditions of the target gene were as follows:

number of cycles	Procedure
			1	Pre-denaturation at 98 ℃ for 2min
35	Denaturation at 98 ℃ for 10s, annealing at 66 ℃ for 15s, and extension at 72 ℃ for 30s
		1	Further extension at 72 deg.C for 5min
	Storing at 4 deg.C

The PCR amplification product was electrophoresed through 1% agarose gel to obtain a target band of 915bp (FIG. 1), and purified and recovered by DNA tapping recovery kit (Takara, shanghai, china).

3. Construction of recombinant plasmid pET28a/IDSGH5-26

(1) Preparation of linearized pET28a vector

The pET28a vector was cleaved with restriction enzymes to prepare linearized vectors (restriction enzyme reagents were purchased from Takara Baoriri physicians & Tech, ltd., beijing, china). The linearized digestion system is as follows:

pET28a	2μg
		BamHI	2μl
EcoRI	2μl
		Buffer	5μl
add ddH 2 O to	50μl

Vortex, shake, mix well, put into 37 ℃ incubator for 2-3 hours after being centrifuged slightly.

(2) The target gene is connected with a pET28a vector

By using the principle of homologous recombination, through Trelief ^TM The SoSoSoSoo Cloning Kit (Ongki Biotechnology Ltd., beijing, china) homologous recombination Kit directionally clones the target gene into the linearized pET28a vector. The reaction system is as follows:

purifying the recovered PCR product	3μl
		Linearized pET28a	1μl
2×SoSoo Mix	5μl
		Sterilization ddH 2 O	1μl
Total of	10μl

10 mul system, the mol ratio of the target gene and the expression vector is 5, and the reaction is carried out for 30min at 50 ℃.

4. Construction and protein expression of recombinant bacterium BL21/pET28a/IDSGH5-26

1. Transformation of recombinant plasmid into Escherichia coli by heat shock

(1) Carefully mixing 10. Mu.l of the ligation product with Escherichia coli competent BL21 (DE 3), and ice-cooling for 30min;

(2) Placing the centrifuge tube in 42 deg.C water bath for 60s, immediately taking out ice bath for 2-3min without shaking the centrifuge tube;

(3) Adding 890 mul of sterile SOC culture medium (without antibiotic) preheated at 37 ℃ into a centrifuge tube, uniformly mixing, and placing in a shaking table at the temperature of 37 ℃ for constant-temperature culture at 150rpm for 45min to express related resistance marker genes on plasmids and recover thalli;

(4) Mu.l of the transformed competent cells were aspirated and plated on LB solid medium containing kanamycin (the plating amount may be adjusted as the case may be, if the expected clones are less centrifuged at 4000rpm for 2min, and then a part of the culture solution is aspirated). Placing the plate at room temperature until the liquid is absorbed, and inverting the plate to culture at 37 deg.C for 12-16h;

(5) And (4) picking bacterial plaques for PCR identification, and sending the screened positive clones to a company for sequencing. The accuracy of transcriptome analysis was checked by gene alignment.

2. Induced expression and purification of positive strains

(1) Inducible expression of Positive strains

(1) Selecting a single colony of the positive recombinant engineering bacteria BL21/pET28a/IDSGH5-26, placing the single colony in 5mL of LB liquid culture medium containing 50 mu g/mL Kan, and culturing at 37 ℃ and 200rpm for 12-16h;

(2) inoculating with 1% inoculum size 500mL LB medium containing 10. Mu.g/mL Kan, culturing at 37 deg.C and 200rpm with shaking to OD ₆₀₀ 0.6 to 1.0;

(3) adding IPTG with final concentration of 1mmol/L, inducing and culturing at 16 deg.C and 100rpm for 16h;

(4) 8000rpm, centrifugation at 4 ℃ for 10min to collect cells, 100mL of 1 XPBS buffer (137 mmol/L NaCl,2.7mmol/L KCl,10mmol/L Na) ₂ HPO ₄ ，2mmol/L KH ₂ PO ₄ pH7.4) and centrifuged at 8000rpm for 10min. Discarding the supernatant, and resuspending the cells in 50mL 1 XPBS buffer;

(5) crushing in FB-2010 homogenizer (Shanghai Futu Co., ltd.) at flow rate of 6L/h, pressure of 810MPa and 6 ℃ for 5min;

(6) centrifuging at 10000rpm and 4 deg.C for 15min, and collecting supernatant as crude enzyme solution of recombinant protein.

(2) Affinity purification and electrophoretic analysis of recombinant protein

(1) Column assembling: adding 2mL of Ni-NTA agarose filler into a DE01 chromatographic column;

(2) balancing: performing column equilibration for 1h by using 20mmol/L imidazole phosphate buffer solution at the flow rate of 0.5 mL/min;

(3) loading: 75mL of protein supernatant was loaded at a flow rate of 0.5 mL/min;

(4) rebalancing: performing column equilibration for 1h by using 20mmol/L imidazole phosphate buffer solution at the flow rate of 0.5 mL/min;

(5) and (3) elution: gradient elution is carried out on 20mmol/L (liquid A) and 2mol/L (liquid B) mixed phosphate buffer solution, the final proportion of the liquid B is set to be 13%, and eluent is collected;

(6) cleaning: washing the chromatographic column with 20mmol/L imidazole phosphate buffer solution at the flow rate of 0.5mL/min for 1h;

(7) the purified protein was analyzed by SDS-PAGE (4% gel concentrate, 15% gel isolate) to give the desired size of the protein of interest (FIG. 2).

5. Enzymatic characterisation assay dextranase activity was measured using the 3,5 dinitrosalicylic acid (DNS) method with 0.5% dextran as substrate, and the amount of enzyme required to release substrate to produce 1. Mu. Mol reducing sugar per min was defined as 1 enzyme activity unit (U). Protein concentration was determined by the Bradford method.

(1) Optimum temperature

mu.L of purified enzyme solution of IDSGH5-26 (about 12. Mu.g, the same applies below) was mixed with 60. Mu.L of 0.5% dextran substrate, and reacted at 30 to 80 ℃ for 15min, respectively. Meanwhile, a blank control group is set, 15 mu L of enzyme solution which is boiled and inactivated in advance is added into a blank tube, and the reaction is carried out for 10min. Add 75. Mu.L DNS reagent to the above test and control system and incubate at 99 ℃ for 5min. After cooling to room temperature, the absorbance was measured at 540nm using a SpectraMax M3 microplate reader (Molecular Devices). The temperature at the highest activity was taken as 100%, the relative activity at each temperature was calculated, and three sets of repeated experiments were set.

The results show (fig. 3): the optimum temperature for recombinase IDSGH5-26 is 50 ℃.

(2) Thermal stability

Under the condition of pH5.0, 15 μ L of IDSGH5-26 purified enzyme solution is respectively kept at 40-70 ℃ for 60min. Sampling at 0, 2, 5, 10, 20, 40, and 60min, respectively adding 60 μ L of 0.5% dextran substrate, reacting under optimum conditions for 10min, and determining enzyme activity according to the above conditions. The residual activity under each temperature condition was calculated with the non-heat treated test group as 100%, and three sets of repeated tests were set.

The experimental results show (fig. 4): the recombinant enzyme IDSGH5-26 is incubated at 40 deg.C for 60min, the residual activity is not affected, and it is inactivated rapidly after 5min incubation at 50 deg.C.

(3) Optimum pH

15 mu L of purified enzyme solution of IDSGH5-26 is respectively reacted with glucan substrates prepared by buffer solution with pH2.2-10 (pH 2.2-8.0 of citric acid/phosphate buffer solution; pH 9-10 of glycine/sodium hydroxide buffer solution) at the optimum temperature for 10min, and the enzyme activity is determined according to the conditions. The relative activity at each pH was calculated as 100% of the pH at the highest activity, and three replicates were set.

The experimental results show (fig. 5): the optimum pH of recombinase IDSGH5-26 is 5.

(4) Stability of pH

At the optimum temperature, 7.5 mu L of IDSGH5-26 purified enzyme solution is respectively incubated in 7.5 mu L of buffer solutions (pH 2.2-10.6) with different pH values for 1h, 60 mu L of 0.5% dextran substrate is added, reaction is carried out for 10min under the optimum condition, and the enzyme activity is determined according to the conditions. The residual activity at each pH was calculated to be 100% for the groups not incubated with buffer and three replicate experiments were set up.

The experimental results show (fig. 6): the recombinase IDSGH5-26 is stable between pH4.0-10.0, and can still maintain more than 74% of activity after 1h of treatment.

(5) Substrate hydrolysis assay

Taking 1mL of IDSGH5-26 purified enzyme solution and 4mL of 0.5% glucan, incubating for 72h under the optimal reaction condition, and sampling for 2h, 10h, 24h, 48h and 72h respectively. The temperature is kept at 95 ℃ for 30min, centrifugation is carried out at 13000rpm for 15min, and the supernatant is taken and three groups of repeated experiments are set. Using Asahipak NH2P-50 4E column (Shodex corporation) and LC-1200 high performance liquid chromatograph (Agilent corporation), the mobile phase was acetonitrile: water =65:35, column temperature 35 ℃, flow rate 0.5mL/min, analysis of substrate hydrolysis samples using RID-20A time lapse refractometer.

The experimental results show (fig. 7): products of IDSGH5-26 for catalyzing and degrading glucan are monosaccharide and oligocellooligosaccharide with the polymerization degree of 2-4. After being treated by IDSGH5-26 for 48h, the yields of monosaccharide, cellobiose, cellotriose and cellotetraose which are hydrolysis products of glucan are 82.25 +/-15.44, 829.44 +/-9.87, 628.75 +/-26.89 and 52.86 +/-4.03 umol/umol protein respectively.

And (4) conclusion: according to the experimental conclusion, the endoglucanase IDSGH5-26 disclosed by the invention has wider pH tolerance, can keep more than 74% of enzyme activity within the range of pH4.0-10.0, is a monosaccharide and an oligocellucose oligosaccharide with the polymerization degree of 2-4 as a product for catalyzing and degrading glucan, has larger industrial production and application potential, and can be applied to beer brewing under an acidic condition, animal feed and biofuel and cellulose degradation under a strong alkaline environment, such as industrial production of alkaline detergents, textile industry and the like.

The above-described examples are preferred embodiments of the present invention for gene mining and the method for producing endoglucanase in vitro, and are not intended to limit the present invention in any way, and other variations and modifications may be made without departing from the scope of the claims.

Sequence listing

<110> Zhejiang Wanli college

ZHEJIANG University

<120> beta-glucanase, coding gene IDSGH5-26 thereof and application thereof

<130> ZJWL-WJK001

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 915

<212> DNA

<213> beta-glucanase gene (IDSGH 5-26)

<400> 1

atgttgaata aacttaaagt tataaatggt aaactgacag acggcgagaa gcccatcagg 60

cttttcggat tatctactca cggtatcgcc tggtatcccg aatatatctg cgaagaatcc 120

tttgcagcac tgaaaaaaga atggcgaaca aactgtgtaa ggataacttt gtataccgac 180

gaattccgtg gatactgcaa agacggcaat aagcagcatc tcaaggaact ggttgaaaaa 240

ggtgtgaata tcgctgaaaa gttggatatg tatgtaattg ttgactggca cgttctcagt 300

gatcaggatc ccatgaagta tatcgatcaa gctgaagaat tcttcggtga tatgtcaaaa 360

cgtttcgctg aaaagaacaa tgtcatatat gagatatgca acgaacccaa caacagcggc 420

acatgggaaa aggtaactga gtatgctgac aggataatcc cccttataag acagaactcc 480

cctgatgcgc tggtgatcac cggtacgcct aactggtcgc aggatatcca ctgcgcactg 540

gatagacctt tcaaatggga taatgtcatg tactcactgc acttctatgc ggcaacacat 600

aagggtactc tgcgcagccg tcttgaacgc tgtgttgaag caggacttcc tgttttcata 660

aacgaattca acctgtgtga agcaagcggc aagggcgata ttgaccatga tgagtcggaa 720

gcttggcgcg aagtaataga cagacttgat ctcagctgca tatgctggtg cttatcgaac 780

agcggtgata cctgcggagt tttcgcaaag gactgcacaa agctttcagg ctggacagat 840

gatgacctga aaaattcggg gctgatcatt aagagttggt tcagcaagtt tgcagatgag 900

gagaatgaca gatga 915

<210> 2

<211> 304

<212> PRT

<213> beta-glucanase (IDSGH 5-26)

<400> 2

Met Leu Asn Lys Leu Lys Val Ile Asn Gly Lys Leu Thr Asp Gly Glu

1 5 10 15

Lys Pro Ile Arg Leu Phe Gly Leu Ser Thr His Gly Ile Ala Trp Tyr

20 25 30

Pro Glu Tyr Ile Cys Glu Glu Ser Phe Ala Ala Leu Lys Lys Glu Trp

35 40 45

Arg Thr Asn Cys Val Arg Ile Thr Leu Tyr Thr Asp Glu Phe Arg Gly

50 55 60

Tyr Cys Lys Asp Gly Asn Lys Gln His Leu Lys Glu Leu Val Glu Lys

65 70 75 80

Gly Val Asn Ile Ala Glu Lys Leu Asp Met Tyr Val Ile Val Asp Trp

85 90 95

His Val Leu Ser Asp Gln Asp Pro Met Lys Tyr Ile Asp Gln Ala Glu

100 105 110

Glu Phe Phe Gly Asp Met Ser Lys Arg Phe Ala Glu Lys Asn Asn Val

115 120 125

Ile Tyr Glu Ile Cys Asn Glu Pro Asn Asn Ser Gly Thr Trp Glu Lys

130 135 140

Val Thr Glu Tyr Ala Asp Arg Ile Ile Pro Leu Ile Arg Gln Asn Ser

145 150 155 160

Pro Asp Ala Leu Val Ile Thr Gly Thr Pro Asn Trp Ser Gln Asp Ile

165 170 175

His Cys Ala Leu Asp Arg Pro Phe Lys Trp Asp Asn Val Met Tyr Ser

180 185 190

Leu His Phe Tyr Ala Ala Thr His Lys Gly Thr Leu Arg Ser Arg Leu

195 200 205

Glu Arg Cys Val Glu Ala Gly Leu Pro Val Phe Ile Asn Glu Phe Asn

210 215 220

Leu Cys Glu Ala Ser Gly Lys Gly Asp Ile Asp His Asp Glu Ser Glu

225 230 235 240

Ala Trp Arg Glu Val Ile Asp Arg Leu Asp Leu Ser Cys Ile Cys Trp

245 250 255

Cys Leu Ser Asn Ser Gly Asp Thr Cys Gly Val Phe Ala Lys Asp Cys

260 265 270

Thr Lys Leu Ser Gly Trp Thr Asp Asp Asp Leu Lys Asn Ser Gly Leu

275 280 285

Ile Ile Lys Ser Trp Phe Ser Lys Phe Ala Asp Glu Glu Asn Asp Arg

290 295 300

<210> 3

<211> 51

<212> DNA

<213> Artificial sequence (IDSGH 5-26-F)

<400> 3

acagcaaatg ggtcgcggat ccatgttgaa taaacttaaa gttataaatg g 51

<210> 4

<211> 45

<212> DNA

<213> Artificial sequence (IDSGH 5-26-R)

<400> 4

cttgtcgacg gagctcgaat tcttatctgt cattctcctc atctg 45

Claims (8)

1. Beta-glucanase gene of beta-glucanase from Hu sheep rumen microorganismsIDSGH5-26The method is characterized in that: the nucleotide sequence is shown as SEQ ID No. 1.

2. A beta-glucanase gene comprising the beta-glucanase gene of claim 1IDSGH5-26The recombinant vector of (1).

3. A beta-glucanase gene comprising claim 1IDSGH5-26The recombinant strain of (1).

4. A method for producing beta-glucanase, which comprises fermenting the recombinant bacterium according to claim 3 to obtain beta-glucanase.

5. Amplification of the beta-glucanase gene of claim 1IDSGH5-26The specific primer is characterized by comprising the following components in parts by weight:

IDSGH5-26-F: 5’ ACAGCAAATGGGTCGCGGATCCATGTTGAATAAACTTAAAGTTATAAATGG 3’；

IDSGH5-26-R: 5’ CTTGTCGACGGAGCTCGAATTCTTATCTGTCATTCTCCTCATCTG 3’。

6. a beta-glucanase gene according to claim 1IDSGH5-26 codedBeta-glucanThe application of carbohydrase in degrading cellulose polysaccharide under wide pH condition is characterized in that: the broad pH condition is 4.0-10.0.

7. A method for obtaining beta-glucanase is characterized by comprising the following steps:

a. beta-glucanase geneIDSGH5-26The cloning and the recombinant plasmid pET28 a-IDSGH5-26Constructing;

b. recombinant plasmid pET28 a-IDSGH5-26Expression in E.coli BL 21;

c. induction and purification of recombinant protein and enzymatic characteristic analysis; beta-glucanase geneIDSGH5-26The nucleotide sequence of (A) is shown in SEQ ID No. 1.

8. The method of claim 7, wherein: step a beta-glucanase GeneIDSGH5-26The cloning and the recombinant plasmid pET28 a-IDSGH5-26The construction process is as follows:

(1) PCR amplification of beta-glucanase geneIDSGH5-26And purifying;

(2) at the same time useBamHI andEcoRI performs double enzyme digestion on the pET28a vector;

(3) after purificationIDSGH5-26Carrying out homologous recombination with pET28a subjected to double enzyme digestion;

(4) recombinant plasmid pET28 a-IDSGH5-26Transformed into Escherichia coli BL21 competent cells.

Images