CN109762798A - The preparation method and application of a kind of balun Pueraria lobota hereby series bacillus chitosan enzyme - Google Patents

Abstract

The invention discloses the preparation methods and application of a kind of balun Pueraria lobota hereby series bacillus chitosan enzyme.The present invention provides protein, for it is following 1), 2) or 3) described in protein: 1) amino acid sequence is protein shown in sequence 1 in sequence table；2) fused protein that the N-terminal of protein shown in sequence 1 or/and C-terminal connection label obtain in sequence table；1) or 2) 3) protein obtaining protein shown in by the substitution and/or deletion and/or addition of one or several amino acid residues and with the same function.The chitosan enzyme of the invention successful expression in bacillus subtilis, recombinant bacterium are 1103.4U/mL, protein content 4.7mg/mL through high density fermentation ectoenzyme vigor.Chitosan enzyme producing enzyme of the present invention is horizontal high, and safety is good, and the chitosan enzyme zymologic property prepared is excellent, hydrolysis efficiency is high, thus has important application value in industries such as food, medicine, feeds.

Description

The preparation method and application of a kind of balun Pueraria lobota hereby series bacillus chitosan enzyme

Technical field

The present invention relates to field of biotechnology, the preparation method of specifically a kind of balun Pueraria lobota hereby series bacillus chitosan enzyme With application.

Background technique

Chitosan is the deacetylated product in chitin part, by the D- Glucosamine (GlcN) and N- second of random distribution Acyl-D- Glucosamine (GlcNAc) is with straight chain natural polymers made of β -1,4- glucosides key connection.Chitosan oligosaccharide is chitosan The product of degradation, the degree of polymerization (degree of polymerization, DP) is generally between 2-10.Chitosan oligosaccharide is in addition to molecular weight Outside low and good water solubility, also there are many physiological activity, such as biocidal property, anti-oxidant, antitumor, norcholesterol, blood pressure lowering, anti-sense Dye and control arthritis etc., thus it is widely used in the industries such as food, medicine, agricultural, feed (Liaqat et al.Carbohydrate Polymers,2018:184-243).Chitosan enzyme (EC3.2.1.132) is single-minded hydrolyzing chitosan Enzyme, cut β-Isosorbide-5-Nitrae-glycosidic bond at random from chitosan chain, product is the chitosan oligosaccharide and Glucosamine of different polymerization degree. According to the difference of amino acid sequence homology, chitosan enzyme belongs to 6 glycoside hydrolase Families [Glycoside Hydrolases (GH) family]: GH5, GH7, GH8, GH46, GH75 and GH80 (Thadathil et al.Food Chemistry,2014,150:392-399)。

Microorganism is the main source of chitosan enzyme, and many bacteriums, fungi all produce chitosan enzyme, but the horizontal lower bound of producing enzyme Its large-scale industrial production and application are made.It is to improve its producing enzyme level using genetic engineering means heterogenous expression chitosan enzyme Effective ways.There are many microbe-derived chitosan enzyme successful expressions in Escherichia coli and Pichia pastoris at present, wherein Chitosan enzyme opposite research in bacillus genus source is less, and only 4 realize expression in escherichia expression system, point It Lai Zi not Paenibacillusfukuinensis D2 (Kimoto et al.The Journal of Biological Chemistry,2002,277:14695-14702)、PaenibacilluscookiiSS-24(Shinoda et al.Biotechnology Letters,2012,34:281-286)、Paenibacillus sp.1794(Zitouni et al.Appllied Microbiology Biotechnology,2013,97:5801-5813)、 Paenibacillusdendritiformis(Sun et al.Jounal of Agricutural Food Chemistry, 2018:4645-4651)。

Bacillus subtilis as GRAS grades of bacterial strains, compared to Escherichia coli have non-pathogenic, codon usage bias it is few, Hypersecretion is easy to cultivate the advantages that forming high density and easily amplification, is gradually widely used as recombinant protein heterogenous expression host (Vavrova′et al.Research in Microbiology,2010,161:791-797).Compared to Escherichia coli and finish red Yeast expression system, the research report that chitosan enzyme is expressed in bacillus subtilis is seldom, only several document reports, no phase Close patent report.168 chitosan enzyme of bacillus subtilis is expressed in bacillus subtilis, and producing enzyme level is after high density fermentation 208.23U/mL(Su et al.Journal of the Taiwan Institute of Chemical Engineers, 2017:1-6).These report producing enzyme levels are relatively low, it is difficult to meet the requirement of industrial mass production and application.

Chitosan limits its application industrially since not soluble in water and viscosity is big.It is low point by degradation of chitosan The oligosaccharides of son amount can not only improve its water solubility, while the product obtained has better biological activity.Currently, common shell Polyose degradation method has acid-hydrolysis method, physical degradation methods and enzyme hydrolysis method, and wherein enzyme hydrolysis method has environmental-friendly, reaction condition Mildly, the advantages that product composition is ideal is current widely used degradation of chitosan method (Cabrera et al.Biochemical Engineering Journal,2005,25:165-172).Chitosan enzyme is enzymic degradation chitosan Key enzyme.Currently, most of chitosan enzymes still have several drawbacks, such as producing enzyme level is low, enzymatic property is undesirable.Cause This, exploitation enzymatic property is excellent, the horizontal high novel chitosan enzyme of producing enzyme is the pass for realizing chitosan enzyme industrial production and application Key.

Summary of the invention

The object of the present invention is to provide a kind of preparation method and application of balun Pueraria lobota hereby series bacillus chitosan enzyme.

Chitosan enzyme provided by the present invention, encoding gene are to use conventional method from high yield chitin degrading enzyme system bacterium Strain balun Pueraria lobota hereby clones gained in series bacillus (Paenibacillusbarengoltzii) CAU904, for it is following 1), 2) or 3) protein described in:

1) amino acid sequence is protein shown in sequence 1 in sequence table；

2) fused protein that the N-terminal of protein shown in sequence 1 or/and C-terminal connection label obtain in sequence table；

Or 2) 3) 1) protein shown in by the substitution of one or several amino acid residues and/or missing and/or is added Protein adding and with the same function.

It 1) or 2) or 3), can be in the amino terminal or carboxyl terminal of the protein in order to make the protein in convenient for purifying Connect label as described in Table 1.

The sequence of 1 label of table

Label	Residue number	Sequence
			Ploy-Arg	5-6 (usually 5)	RRRRR
Ploy-His	2-10 (usually 6)	HHHHHH
			PLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

Above-mentioned protein can be artificial synthesized, can also first synthesize its encoding gene, then carries out biological expression and obtain.Above-mentioned egg The encoding gene of white matter can be by lacking the close of one or several amino acid residues for DNA sequence dna shown in sequence 2 in sequence table Numeral, and/or the missense mutation of one or several base-pairs is carried out, and/or hold shown in connection tables 1 at its 5 ' end and/or 3 ' The coded sequence of label obtains.

The present invention protects the nucleic acid molecules for encoding above-mentioned chitosan enzyme.

The nucleic acid molecules can be following (a1), (a2) or (a3) described DNA molecular:

(a1) code area includes the DNA molecular of sequence 2 in sequence table；

(a2) nucleotide sequence limited with (a1) has 75% or 75% or more identity, and encodes above-mentioned protein DNA molecular；

(a3) nucleotide sequence hybridization limited under strict conditions with (a1), and encode the DNA molecular of above-mentioned protein.

Above-mentioned stringent condition refers in 6 × SSC, the solution of 0.5%SDS, hybridizes at 65 DEG C, then with 2 × SSC, It is primary that 0.1%SDS and 1 × SSC, 0.1%SDS respectively wash film.

Above-mentioned term " homology " refers to the sequence similarity with native sequence nucleic acid." homology " includes and institute of the invention The nucleotide sequence for stating nucleic acid molecules has 75% or higher or 80% or higher or 85% or higher or 90% or higher, Or 95% or higher identity nucleotide sequence.Identity can be evaluated with computer software.Using computer software, Homology between two or more sequences can be indicated with percentage (%), can be used to evaluate same between correlated series One property.

Above-mentioned nucleic acid molecules such as cDNA, genomic DNA or recombinant DNA can be also possible to RNA for DNA, such as mRNA or HnRNA etc..

Those skilled in the art can use conventional method, such as directed evolution and point mutation, of the present invention to encoding The nucleotide sequence of protein is mutated.Those are by manually modified, with the core with coding protein of the present invention The nucleic acid molecules of acid sequence 75% or more high homology, if code for said proteins and have chitosan enzyme activity, be Derived from nucleic acid sequence of the invention and it is equal to sequence of the invention.

Present invention protection contains recombinant vector, expression cassette, transgenic cell line or the recombinant microorganism of above-mentioned nucleic acid molecules.

Above-mentioned protein is being also the scope of protection of the invention as the application in chitosan enzyme.

Above-mentioned chitosan enzyme is chitosan enzyme or endo-type chitosan enzyme with β -1,3-1,4 dextranase activity.

Above-mentioned nucleic acid molecules, or, containing expression cassette, recombinant vector, recombinant microorganism or the transgenosis of above-mentioned nucleic acid molecules Cell line is also the scope of protection of the invention preparing the application in chitosan enzyme.

Another object of the present invention is to provide a kind of method for preparing chitosan enzyme.

Method provided by the invention includes the following steps: the above-mentioned recombinant microorganism that ferments, obtains chitosan enzyme.

In the fermentation, start to add supplemented medium when the carbon source in the fermentation system is depleted；

When the depleted finger dissolved oxygen of above-mentioned carbon source rises close to 100% or residual glucose concentration < 2g/L.

Using the above-mentioned recombinant microorganism of high density fermentation.

The condition of the fermentation is as follows: 37 DEG C of temperature, ventilatory capacity 1.5vvm, pH 7.0, speed of agitator 500-700r/ Min, fermentation time 72-84h；And start to add supplemented medium when the dissolved oxygen amount in the fermentation system is higher than limit value Dissolved oxygen amount into fermentation system is lower than limit value；

Above-specified high density fermentation strategies specifically: use fed batch fermentation, accelerated by DO-stat policy control stream Rate, i.e., when dissolved oxygen is higher than limit value (35-45%) Shi Qidong constant speed flow feeding.

The dissolved oxygen limit value range 35-45%, concretely 35% or 40% or 45%.

The formula of the supplemented medium is glucose and peptone, mass ratio 20:3.

The present invention protects above-mentioned chitosan enzyme hydrolyzing glycan or preparing the application in chitosan oligosaccharide.

The present invention protects the chitosan enzyme to be individually used for hydrolyzing chitosan and prepares chitosan oligosaccharide；Or the chitosan enzyme with Other chitosan enzymes and/or chitinase are used in mixed way, and synergetic hydrolysis chitosan and/or chitin prepare chitosan oligosaccharide.

The present invention protects above-mentioned chitosan enzyme, nucleic acid molecules and recombinant vector, expression cassette, transgenic cell line or recombinant bacterium Preparing the application in chitosan oligosaccharide.

The present invention also provides a kind of method for hydrolyzing glycan, include the following steps: to hydrolyze glycan with above-mentioned protein；

Or a kind of method for preparing chitosan oligosaccharide, include the following steps: the group with above-mentioned protein or containing above-mentioned protein Hydrate hydrolysis chitosan, obtains chitosan oligosaccharide.

The above-mentioned composition containing above-mentioned protein is that chitosan enzyme is mixed with other chitosan enzymes and/or chitinase It arrives.

Above-mentioned glycan is chitosan, barley beta-glucan, lichenin, sodium carboxymethylcellulose or glycol-chitosan.

In above-mentioned application, the pH value of the hydrolysis can be 4.5-7.5；Concretely 4.5,5,5.5,6,6.5,7,7.5, or PH value in the range of between point value described in above-mentioned any two；And/or the temperature of the hydrolysis is 30-70 DEG C；Concretely 30 DEG C, 35 DEG C, 40 DEG C, 45 DEG C, 50 DEG C, 55 DEG C, 60 DEG C, 65 DEG C, between point value described in 70 DEG C or above-mentioned any two in the range of Temperature value.

The chitosan enzyme of the invention successful expression in bacillus subtilis, recombinant bacterium is through high density fermentation ectoenzyme vigor For 1103.4U/mL, protein content 4.7mg/mL.The enzyme has good thermostabilization and wide in range pH stability range, most suitable Temperature is 65-70 DEG C, and 55 DEG C of half-life period are 278min, keeps stablizing in pH5.0-11.0.The chitosan enzyme is used to digest Chitosan, chitosan is substantially completely hydrolyzed after 4h, and chitosan oligosaccharide (DP2-6) yield is 79.3%.Chitosan enzyme of the present invention Producing enzyme is horizontal high, and safety is good, and the chitosan enzyme zymologic property prepared is excellent, hydrolysis efficiency is high, thus food, medicine, The industries such as feed have important application value.

Detailed description of the invention

Fig. 1 is recombinant expression carrier pWB980-PbCsn8 building process (a) and plasmid map (b).

Fig. 2 is the course figure of recombined bacillus subtilis high density fermentation secretion recombination chitosan enzyme (PbCsn8).

Fig. 3 is the purifying electrophoretogram for recombinating chitosan enzyme (PbCsn8).

Fig. 4 is recombination chitosan enzyme (PbCsn8) optimal pH (a) and pH stability (b) test curve figure.

Fig. 5 is that recombination chitosan enzyme (PbCsn8) optimum temperature (a) and temperature stability (b) and half-life period (c) test are bent Line chart.

Fig. 6 is recombination chitosan enzyme (PbCsn8) hydrolysis properties analysis chart.

Fig. 7 is recombination chitosan enzyme (PbCsn8) hydrolyzing chitosan time history diagram.

Specific embodiment

Experimental method used in following embodiments is conventional method unless otherwise specified.

The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.

Following embodiment is only limited to illustrate technical solution of the present invention.

Balun Pueraria lobota hereby series bacillus (Paenibacillus barengoltzii) CAU904 bacterial strain in August 20 in 2014 Day is preserved in Chinese microorganism strain collection (abbreviation CGMCC, address: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3), Deposit number is CGMCC No.9530, and classification naming is balun Pueraria lobota hereby series bacillus (Paenibacillus barengoltzii)。

The standard method of chitosan enzyme enzyme activity determination is as follows in following case study on implementation: using 3,5- dinitrosalicylic acid (3, 5-dinitrosalicylic acid, DNS) method, using Glucosamine as standard.400 μ L 0.5% (w/v, g/L) chitosans (DDA=75-85%, pH5.5) solution (solvent is 50mM acetic acid-sodium acetate buffer solution) and the suitably diluted enzyme solution of 100 μ L are mixed It is even, 10min is kept the temperature at 70 DEG C, and 500 μ LDNS are added and terminate reaction, boiling water bath 10min colour developing.12000rpm is centrifuged 10min, Supernatant is taken to survey light absorption value under 540nm.

Enzyme activity calculation formula are as follows: H=Cx × n/ (T × V), wherein H is represented enzyme activity (U/mL), and Cx represents reaction life At the amount of the substance of reduced sugar (with the amount (Cx, μm ol) of aminoglucose sugar substance for ordinate, with light absorption value (X) for abscissa Standard curve is done, calibration curve formula Cx=aX+b is obtained, a is the slope of curve, and b is constant.) (μm ol), n represents the dilute of enzyme solution Multiple is released, T is represented reaction time (min), and V represents the volume (mL) that enzyme solution is added.

Enzyme activity definition: under the above-described reaction conditions, enzyme amount needed for reacting 1 μm of oL reduced sugar of release per minute is defined as One enzyme activity unit (U).

Using bovine serum albumin as standard protein, using Lowry method (Lowry et al., The Journal of Biological Chemistry, 1951,193 (1): 265-275) measurement protein content (mg/mL).

Specific enzyme activity power is defined as: enzyme activity unit possessed by every milligram of albumen (U/mg)

The clone of embodiment 1, balun Pueraria lobota hereby series bacillus gene PbCsn8

1, the clone of gene PbCsn8

According to balun Pueraria lobota hereby series bacillus chitosan enzyme gene order design upstream primer PbCsn8-F (5 ' ATGAAGCCGTTCCCGCAGCAG3 ') and downstream primer PbCsn8-R (5 ' CTACTGACCTGTCACTTCAAACTCGTAAAG3 '), using balun Pueraria lobota, hereby series bacillus CAU904 genome is template, PCR Amplification.PCR program are as follows: 94 DEG C, 2min；94 DEG C, 20s, 60 DEG C annealing 20s, recycle 35 times by 72 DEG C, 45s；Prolong after last 72 DEG C Stretch 5min.

PCR product connects cloning vector pMD19-T, transformed clone host e. coli after agarose gel recovery purifying DH5α.It will be positive transformant through bacterium colony PCR verifying screening, send to raw work (Beijing) bioengineering Co., Ltd sequencing.

Amplification, which obtains PCR product, has nucleotide shown in sequence 2 in sequence table, and unnamed gene shown in the nucleotide is The albumen of gene PbCsn8, full length gene 1566bp, gene coding are named as albumen PbCsn8, the amino acid sequence of the albumen For sequence 1 in sequence table.

2, the building of recombinant vector pWB980-PbCsn8

Recombinant expression carrier pWB980-PbCsn8 is that gene PbCsn8 shown in sequence 2 in sequence table is inserted into pWB980 Carrier (it records in the following literature: Wu and Wong, Journal of Biotechnology, 1999,72,185-195.) Sma The carrier obtained after I site, the carrier express recombinant protein PbCsn8, and the amino acid sequence of recombinant protein PbCsn8 is sequence 1 Shown in albumen PbCsn8 C-terminal add 6 histidine HHHHHH.

Recombined bacillus subtilis is that recombinant expression carrier pWB980-PbCsn8 is transferred to bacillus subtilis WB600 (note Carry in the following literature: Wu et al., Journal of Biotechnology, 1991,173,4952-4958.) obtain Recombinant bacterium.

The method bibliography method (You of above-mentioned building bacillus subtilis recombinant expression carrier pWB980-PbCsn8 Et al.Applied and Environmental Microbiology, 2011,1539-1595) it is modified slightly, specifically such as Under:

(1) amplification of target gene fragment and expression vector: two pairs of primers of design (PbCsn8-IF, PbCsn8-IR and PWB-VF, pWB-VR) use NEBPhusion DNA polymerase PCR amplification target gene and expression vector.Expand mesh Upstream region of gene primer PbCsn8-IF (5 'GCAACTCAAGCTTTTGCCTCGAGCATGAAGCCGTTCCCGCAGCAGATCA G3 '), length 50bp, 5 ' end 25bp are Chong Die with 3 ' end sequence of carrier pWB980 (underlined sequences), 3 ' end 25bp sequences It is Chong Die with target gene 5 ' terminal sequence；Amplifying target genes downstream primer PbCsn8-IR Length 60bp, 5 ' end 20bp are Chong Die with the 3 ' end sequences of pWB980 (underlined sequences), 3 ' end 20bp sequences and purpose The overlapping of gene 5 ' terminal sequence；The sequence that black matrix and italic indicate is His-Tag sequence.Primer pWB-VF and pWB-VR difference It is the reverse complementary sequence of PbCsn-IR and PbCsn-IF.

Using balun Pueraria lobota, hereby series bacillus genome is obtained as template with PbCsn8-IF and PbCsn8-IR primer amplification The Insert Fragment of 1625bp；

Using pWB980 carrier as template, the carrier of 3854bp is obtained with pWB-VF and pWB-VR primer amplification；

(2) POE-PCR expands polymer plasmid:

Above-mentioned Insert Fragment is reacted with carrier with following PCR system:

PCR system forms: the molar ratio of dNTPs (every kind of 0.2mM), Insert Fragment 2ng/ μ L, carrier and Insert Fragment is 1:1；0.04U/μLNEBPhusion DNA polymerase.PCR reaction condition: 98 DEG C, 30s；98 DEG C, 10s, 60 DEG C, annealing 20s；72 DEG C, extend certain time (speed 2Kb/min)；72 DEG C, 10min.

Fig. 1 is recombinant expression carrier pWB980-PbCsn8 building process electrophoretogram and plasmid map, wherein (a) is The pcr amplification product electrophoretogram of PbCsn8 gene and polymer plasmid, (b) load for being recombinant expression carrier pWB980-PbCsn8 Body map.Wherein, swimming lane M is DNA marker to a；Swimming lane 1 is the pcr amplification product of PbCsn8 gene；Swimming lane 2 is plasmid The pcr amplification product of pWB980；Swimming lane 3 is the product that POE-PCR expands polymer plasmid.Illustrate recombinant expression carrier PWB980-PbCsn8 is constructed successfully and recombined bacillus subtilis expression strain construction is successful.

Construct bacillus subtilis recombinant strains method bibliography method (Zhang et al.Methods in Molecular Biology,2014,1151(8),95)。

Control recombined bacillus subtilis is that carrier pWB980 is transferred in bacillus subtilis WB600, obtains recombinant bacterium.

Embodiment 2 prepares chitosan enzyme

One, recombined bacillus subtilis fermentation prepares chitosan enzyme

Fermentation medium (g/L): glucose 10, tryptone 20, yeast extract 10, Na₂HPO₄6, KH₂PO₄3, MgSO₄0.3, remaining is water.

Flow feeding culture medium (g/L): glucose 500, tryptone 75, remaining is water.

High density fermentation is divided into three stage of seed liquor culture, batch fermentation and feed supplement fed-batch cultivation.

The recombined bacillus subtilis obtained using the 2 of high density fermentation culture embodiment 1, specific as follows:

1, seed liquor culture:

The 2 of embodiment 1 obtained recombined bacillus subtilis are inoculated with 100mL LB culture medium culture 10-11h, at this time for In the logarithmic growth later period, obtain seed liquor.

2, batch fermentation:

LB culture volume 2L in 5L fermentor accesses above-mentioned seed liquor in LB culture medium according to inoculum concentration 5%, temperature 37 DEG C, ventilatory capacity 1.5vvm, using 28% ammonium hydroxide and 20% phosphorus acid for adjusting pH 7.0, control speed of agitator 600r/min.

3, feed supplement fed-batch cultivation

Depleted (dissolved oxygen rises close to 100% or residual glucose concentration < 2g/L) carbon source in 6h fermentor after inoculation When, start flow feeding.

Flow feeding strategy: using DO-stat strategy, start the training of constant speed flow feeding when dissolved oxygen is higher than limit value (40%) Base is supported, stops feed supplement when dissolved oxygen is lower than limit value.

It is spaced 6h since inoculation and collects tunning, 12000rpm centrifugation 10min obtains fermented supernatant fluid and precipitating.

Detect cell density (OD in tunning₆₀₀)；

Detect extracellular chitosan enzyme enzyme activity in fermented supernatant fluid；

Detect protein content in fermented supernatant fluid.

As a result as shown in Figure 2, wherein triangle point is cell density (OD₆₀₀), square dot be fermented supernatant fluid chitosan Enzyme enzyme activity (U/mL), circular dot are the protein concentration (mg/mL) of fermented supernatant fluid；As can be seen that by the fermentation of 84h, weight Contain chitosan enzyme in group fermentation of bacillus subtilis supernatant, and chitosan enzyme enzyme activity reaches up to 1103.4U/mL, Protein content is 4.7mg/mL.

Control recombined bacillus subtilis is obtained as control with the 2 of embodiment 1, is detected using same method, control weight Without chitosan enzyme enzyme activity in the fermented supernatant fluid of group bacillus subtilis.

It proves, albumen PbCsn8 is chitosan enzyme, and recombinant protein PbCsn8 is recombination chitosan enzyme.

Two, the purifying of chitosan enzyme is recombinated

It uses agarose Ni-NTA to chromatograph column packing, carries out purifying above-mentioned 3 obtained hairs using the chromatographic column of 1 × 10cm Ferment supernatant, specific as follows:

By the 3 of above-mentioned one tunning of 84h since inoculation, 12000rpm centrifugation 10min obtains fermented supernatant fluid With buffer solution A (20mM disodium hydrogen phosphate-sodium dihydrogen phosphate pH 8.0,500mM NaCl, 20mM imidazoles, solvent is water) dialysis two It is secondary.Dialyzate is splined on chromatographic column (balancing 10 column volumes with buffer solution A in advance) and is purified, flow velocity 0.5mL/min.With slow Fliud flushing A is eluted to OD₂₈₀Less than 0.05, buffer solution B (20mM disodium hydrogen phosphate-sodium dihydrogen phosphate pH 8.0,500mM is then used NaCl, 50mM imidazoles, solvent are water) it is eluted to OD₂₈₀Less than 0.1, collects buffer solution B and cross the solution after column, the weight as purified Group chitosan enzyme solution, using the purity of SDS-PAGE testing goal albumen.

As a result as shown in figure 3, recombination chitosan enzyme purification process SDS-PAGE analysis；Swimming lane M is Protein Marker, Swimming lane 1 is fermented supernatant fluid, and swimming lane 2 is the recombination chitosan enzyme solution of purifying, it can be seen that recombinating chitosan enzyme size is The end C- of 60KD, size and the amino acid sequence shown in sequence 1 is added in the same size after 6 histidine HHHHHH.

The purification 2.1 of chitosan enzyme purification process is recombinated, the enzyme activity rate of recovery is 61.2%, and pure enzyme specific enzyme activity power is 360.4U/mg, the content 4.7mg/mL (table 2) of zymoprotein.

Table 2. recombinates the purifying table of chitosan enzyme (PbCsn8)

Purification step	Total enzyme activity/U	Total protein/mg	Specific enzyme activity/U mg-1	Purificationa	The enzyme activity rate of recoveryb/ %
						Crude enzyme liquid	10658.1	60.9	175.1	1.0	100.0
Ni-NTA	6522.3	18.1	360.4	2.1	61.2

A: purification refers to the ratio of the specific enzyme activity of pure enzyme and the specific enzyme activity of thick enzyme.

B: the rate of recovery refers to that the total enzyme activity power of pure enzyme accounts for the percentage composition of crude enzyme liquid total enzyme activity power.

Three, the zymologic property measurement of chitosan enzyme is recombinated

1, the measurement of optimal pH and pH stability

Using the recombination chitosan enzyme solution (enzyme activity 3708.5U/mL) that above-mentioned two purifying obtains as enzyme solution to be measured, Optimal pH is measured within the scope of pH4-7.5.Measure enzyme activity.With enzyme activity peak for 100%, calculate separately under condition of different pH Enzyme activity.

PH Stability Determination: enzyme solution to be measured is diluted using the different buffers within the scope of pH3.0-12.0, is protected at 55 DEG C Then warm 30min, immediately ice-water bath 30min measure residual enzyme activity under optimum condition according to standard method shown in preceding.With Without above-mentioned processing (above-mentioned processing refer to using pH range 3.0-12.0 different buffers dilute chitosan enzyme solution, 55 DEG C heat preservation 30min, then be immediately placed in ice water cooling 30min) enzyme solution be control, calculate residual enzyme activity and account for blank control enzyme The percentage composition of vigor.

Buffer to be measured and its corresponding data point identification are as follows: citric acid-trisodium citrate pH 3.0-6.0 (△)； Bistris-HClpH 5.5-7.5(◆)；Acetic acid-sodium acetate pH 3.5-6.0 (■)；MES pH 5.0-6.0(◇)；Di(2-ethylhexyl)phosphate Hydrogen sodium-disodium hydrogen phosphate pH 6.0-8.0 (▲)；Tris-HCl pH 7.0-9.0(○)；CHES pH 8.0-10.0(●)； CAPS pH 10.0-11.0(□)；Disodium hydrogen phosphate-sodium hydroxide pH 11.0-12.0 (▼).

Buffer formulation to be measured is as follows:

Citric acid-trisodium citrate pH 3.0-6.0: it is molten that appropriate 50mM sodium citrate is added into 50mM citric acid solution Liquid adjusts pH respectively to 3.0,3.5,4.0,4.5,5.0,5.5 and 6.0；

Bistris-HClpH 5.5-7.5: be added into 50mM Bistris solution appropriate 6M HCl adjust pH to 5.5, 6.0,6.5,7.0 and 7.5；

Acetic acid-sodium acetate pH 3.5-6.0: appropriate 50mM sodium acetate solution is added into 50mM acetic acid solution and adjusts pH points Not to 3.5,4.0,4.5,5.0,5.5 and 6.0；

MES pH 5.0-6.0: a small amount of 2M NaOH solution is added into 50mM MES solution and adjusts pH respectively to 5.0,5.5 And 6.0；

Sodium dihydrogen phosphate-disodium hydrogen phosphate pH 6.0-8.0: appropriate 50mM phosphorus is added into 50mM sodium dihydrogen phosphate Sour disodium hydrogen solution adjusts pH respectively to 6.0,6.5,7.0,7.5 and 8.0；

Tris-HCl pH 7.0-9.0: be added into 50mM Tris solution appropriate 6M HCl adjust pH respectively to 7.0, 7.5,8.0,8.5 and 9.0；

CHES pH 8.0-10.0: be added into 50mM CHES solution appropriate 2M NaOH solution adjust pH respectively to 8.0, 8.5,9.0,9.5 and 10.0；

CAPS pH 10.0-11.0: be added into 50mM CAPS solution appropriate 2M NaOH solution adjust pH respectively to 10.0,10.5 and 11.0；

Disodium hydrogen phosphate-sodium hydroxide pH 11.0-12.0: appropriate 2M NaOH is added into 50mM disodium phosphate soln Solution adjusts pH respectively to 11.0,11.5 and 12.0.

As a result as shown in figure 4, be PbCsn8 optimal reaction pH (a) with pH (b) stability (a is acetic acid-sodium acetate pH3.5- 6.0 buffers, Bistris-HClpH 5.5-7.5 buffer, MES pH 5.0-6.0 buffer；B is citric acid-citric acid three Sodium pH 3.0-6.0 buffer, acetic acid-sodium acetate pH 3.5-6.0 buffer, MES pH 5.0-6.0 buffer, biphosphate Sodium-disodium hydrogen phosphate pH 6.0-8.0 buffer, Tris-HCl pH 7.0-9.0 buffer, CHES pH 8.0-10.0 buffering Liquid, CAPS pH 10.0-11.0 buffer.), it can be seen that chitosan enzyme optimal reaction pH is 5.5, in pH5.0-11.0 model Interior holding is enclosed to stablize.

2, the measurement of optimum temperature and temperature stability and half-life period

Substrate is configured with the buffer of optimal pH, enzyme reaction optimum temperature is measured within the scope of 25-90 DEG C, according to standard side Method measures enzyme activity, with enzyme activity peak for 100%, calculates separately the enzyme activity under condition of different temperatures.

The measurement of temperature stability: enzyme solution is placed under different temperatures (20-60 DEG C) and keeps the temperature 30min, immediately ice-water bath Then 30min measures residual enzyme activity under optimum condition according to standard method.With without above-mentioned processing, (above-mentioned processing refers to Be to be placed in enzyme solution at 20-60 DEG C to keep the temperature 30min, ice-water bath 30min immediately) enzyme solution as control, calculate residual enzyme activity Account for the percentage composition of blank control enzyme activity.

The measurement of half-life period: enzyme solution is respectively placed at 50 DEG C, 55 DEG C, 60 DEG C and handles different time, immediately ice-water bath 30min measures residual enzyme activity under optimum condition according to standard method.With without above-mentioned processing, (above-mentioned processing is referred to Handle different time at 50 DEG C, 55 DEG C, 60 DEG C, immediately ice-water bath 30min) enzyme solution as control, calculate residual enzyme activity account for The percentage composition of blank control enzyme activity, calculate enzyme at different temperatures enzyme activity decay to 50% time.

As a result as shown in figure 5, being optimal reactive temperature (a), temperature stability (b) and the half-life period (c) of PbCsn8, wherein The temperature of Fig. 5 (c) identifies are as follows: 50 DEG C (●), 55 DEG C (▲), 60 DEG C (■) can be seen from chitosan enzyme optimal reactive temperature is 65-70 DEG C, stablize at 55 DEG C or less, 55 DEG C of half-life period is 278min.

3, substrate specificity and hydrolysis properties

Substrate specificity measurement: with 50mM acetic acid -5.5 buffer of sodium acetate pH configure 0.5% (w/v, g/L) chitosan, Barley beta-glucan, lichenin, sodium carboxymethylcellulose (CMC-Na), microcrystalline cellulose, laminarin, can obtain right polysaccharide, Tobacco brown spot pathogen, glycol-chitosan, ethylene glycol chitin and xylan solution；Enzyme activity is measured according to standard method, with shell The enzyme activity measured when glycan is substrate is 100%, calculates enzyme to the enzyme activity and specific enzyme activity power of different substrates.

Hydrolysis properties measurement: the chitosan (DDA=of 1% (w/v) is configured with 50mM acetic acid -5.5 buffer of sodium acetate pH 85%) solution, enzyme concentration are 1U/mL (adding according to chitosan enzyme enzyme activity), and 55 DEG C are reacted, interval different time (15, 30min, 1,2,4,8 and 12h) sampling, boiling water bath 5min enzyme deactivation, 12000rpm, centrifugation 10min take supernatant using thin layer Analysis method (TLC) analyzes hydrolysate.

Barley beta-glucan hydrolysising condition: the barley of 1% (w/v) is configured with 50mM acetic acid -5.5 buffer of sodium acetate pH Beta glucan, enzyme concentration are 5U/mL (adding according to dextranase enzyme activity), and 55 DEG C are reacted, interval different time (15, 30min, 1,2,4,8 and 12h) sampling, boiling water bath 5min enzyme deactivation, 12000rpm, centrifugation 10min take supernatant using thin layer Analysis method (TLC) analyzes hydrolysate.

Chitosan oligosaccharide hydrolysising condition: chitobiose-shell six of 1% (w/v) is configured with 50mM acetic acid -5.5 buffer of sodium acetate pH Sugar, enzyme concentration 2U/mL (are added) according to chitosan enzyme enzyme activity, 55 DEG C of reactions, separated in time (15, the and of 30min, 1,2 It 4h) samples, boiling water bath 5min enzyme deactivation, hydrolysate is analyzed using TLC.

Chitosan oligosaccharide TLC condition: developing agent is normal propyl alcohol: 25% ammonium hydroxide: water (3:1:1).Color developing agent is methanol: the concentrated sulfuric acid (95:5).Using chitosan oligosaccharide and Glucosamine as standard.Sample is splined on 254 silica gel plate of Merck Slica Gel, opens up layer 2 It is secondary.Then color developing agent is uniformly sprayed, develop the color at 150 DEG C 5min after drying.

Portugal's oligosaccharides TLC condition: developing agent is normal propyl alcohol: acetic acid: water (2:1:1), color developing agent is methanol: the concentrated sulfuric acid (95: 5).Use cell-oligosaccharide and glucose as standard.

The results are shown in Table 3 for the substrate specificity of chitosan enzyme (PbCsn8), PbCsn8 to the hydrolysis abilities of a variety of glycan, The enzyme is most strong to the hydrolysis ability of chitosan, is secondly barley beta-glucan (20.0%), and to lichenin (3.75%), carboxylic Sodium carboxymethylcellulose pyce (0.54%) and glycol-chitosan (0.3%) hydrolysis ability are very weak, to tobacco brown spot pathogen, ethylene glycol chitin Matter, laminarin can obtain right polysaccharide, xylan and microcrystalline cellulose then without hydrolysis ability (table 3).Illustrate that the enzyme is that one kind has The chitosan enzyme of β -1,3-1,4 dextranase activity.

The substrate specificity of 3. chitosan enzyme of table (PbCsn8)

Substrate	Specific enzyme activity power/U/mga	Relative activity/%
			Chitosan (DDA75-85%)	360.4	100.0
Barley beta-glucan	72.08	20.0
			Lichenin	13.41	3.72
Sodium carboxymethylcellulose	1.71	0.54
			Glycol-chitosan	0.95	0.30
Microcrystalline cellulose	Noneb	0
			Right polysaccharide can be obtained	Noneb	0
Laminarin	Noneb	0
			Xylan	Noneb	0
Ethylene glycol chitin	Noneb	0
			Tobacco brown spot pathogen	Noneb	0

A: enzyme activity determination condition: 5.5,70 DEG C of 50mM acetic acid-sodium acetate pH, 10min is reacted.

B: activity is not detected.

Fig. 6 is the specificity analysis figure of PbCsn8 hydrolyzing chitosan and barley beta-glucan.(a) PbCsn8 hydrolyzing chitosan Product TLC analysis chart, wherein duct M: Glucosamine and chitosan oligosaccharide standard items mixture (chitobiose, chitotriose, shell tetrose, Six sugar of shell pentasaccharides and shell)；(b) PbCsn8 hydrolyzes the product TLC analysis chart of barley beta-glucan, wherein duct M: glucose and fibre It ties up oligosaccharide standards mixture (cellobiose, cellotriose and cellotetrose).PbCsn8 hydrolyzing chitosan primary product is two Sugar, trisaccharide and a small amount of tetrose and pentasaccharides hydrolyze 15min, that is, have the generation of trisaccharide, tetrose, pentasaccharides, six sugar and a small amount of seven sugar, As time went on, oligosaccharides amount gradually increases, but oligomerization degree gradually becomes smaller, and product no longer changes substantially after hydrolyzing 4h, these As a result illustrate that the enzyme is endo-type chitosan enzyme.The enzyme hydrolysis barley beta-glucan primary product is tetrose and some high polymerization degrees Cell-oligosaccharide, as the cell-oligosaccharide of the extension high polymerization degree of time is not degraded to the oligosaccharides of low polymerization degree.

Embodiment 3, recombination chitosan enzyme hydrolyzing chitosan prepare chitosan oligosaccharide

Hydrolysis is as follows: 5% (w/v, g/L) chitosan (being dissolved in 0.2M acetic acid) solution 100mL, shell adding glycan enzyme amount 5.5,55 DEG C of held for some time of 5U/mL, pH vibrate (200r/min) hydrolysis in constant-temperature table, are spaced different time (institute Stating interval time point is respectively 0.5,1,2,4,8 and 12h) sampling, 12000rpm, centrifugation 10min take supernatant to carry out chitosan oligosaccharide Product qualitative and quantitative analysis.Using the composition of chitosan oligosaccharide in TLC qualitative analysis hydrolyzate；Using in HPLC quantitative analysis hydrolyzate The concentration of chitosan oligosaccharide.

Above-mentioned chitosan is the chitosan enzyme solution (3708.5U/mL that above-mentioned two purifying obtains.).

Chitosan oligosaccharide yield (Y) calculation formula are as follows: Y=Cn × V/M × 100%.Y is the oligosaccharides or amino of DP2-6 in formula The yield of glucose, Cn are the oligosaccharides of DP2-6 or the concentration (mg/mL) of Glucosamine, and V is enzyme digestion reaction total volume (mL), M is the quality (mg) of total chitosan

TLC analysis condition: developing agent is normal propyl alcohol: 25% ammonium hydroxide: water (3:1:1), color developing agent is methanol: the concentrated sulfuric acid (95: 5).Using chitosan oligosaccharide (chitobiose, chitotriose, shell tetrose, shell pentasaccharides and the sugar of shell six) and Glucosamine as standard.

HPLC analysis condition: NH2P-50 4E chromatographic column (4.6 × 250mm)；Column temperature: 30 DEG C；RID detector；Sample volume: 10μL；Mobile phase: 70% acetonitrile；Flow velocity: 0.8mL/min；With aminoglucose sugar and chitosan oligosaccharide (chitobiose, chitotriose, shell four Sugar, shell pentasaccharides and the sugar of shell six) standard items do standard curve.

As a result such as Fig. 7, the time history of chitosan oligosaccharide is prepared for PbCsn8 hydrolyzing chitosan；(a) shell is hydrolyzed for PbCsn8 to gather The TLC analysis of sugared product composition, wherein M is aminoglucose sugar and chitosan oligosaccharide (chitobiose, chitotriose, shell tetrose, shell pentasaccharides and shell Six sugar) standard items mixture；It (b) is the HPLC quantitative analysis of PbCsn8 hydrolyzing chitosan product, wherein circular dot represents shell widow The yield of sugar (chitobiose, chitotriose, six sugar of shell tetrose, shell pentasaccharides and shell), square dot represent the yield of Glucosamine；As a result It has been shown that, hydrolysis chitosan oligosaccharide early period yield increase sharply, and after hydrolyzing 4h, the yield of chitosan oligosaccharide no longer changes substantially, at this time DP2-6 Chitosan oligosaccharide yield be 79.3%, Glucosamine yield be 3.5%, hydrolysis primary product be chitobiose and chitotriose, respectively The 33.2% and 51.4% of the total soluble oligosaccharide content of Zhan.

Sequence table

<110>China Agricultural University

<120>preparation method and application of a kind of balun Pueraria lobota hereby series bacillus chitosan enzyme

<170>PatentIn version 3.5

<160>2

<210>1

<211>521

<212> PRT

<213>balun Pueraria lobota hereby series bacillus (Paenibacillusbarengoltzii) CAU904

<400>1

Met Lys Pro Phe Pro Gln Gln Ile Ser Tyr Pro Gly Ile Ile Lys Pro

1 5 10 15

Ser His Val Thr Gln Ala Ala Met Asn Gln Ala Val Ala Ser Tyr Tyr

20 25 30

Asp Tyr Trp Lys Ala Thr Tyr Leu Arg Asn Asn Leu Ser Ser Leu Pro

35 40 45

Gly Gly Tyr Tyr Val Lys Gly Asn Ile Thr Gly Asp Pro Asp Gly Phe

50 55 60

Thr Ala Leu Gly Ser Ser Glu Gly Gln Gly Tyr Gly Met Ile Ile Thr

65 70 75 80

Val Leu Met Ala Gly Tyr Asp Pro Asn Ala Lys Thr Ile Tyr Asp Gly

85 90 95

Leu Phe Lys Thr Ala Arg Thr Tyr Lys Ser Ser Gly Asn Pro Asn Leu

100 105 110

Met Gly Trp Val Val Ala Asp Ser Lys Ala Ala Gln Gly His Phe Gly

115 120 125

Ser Ala Thr Asp Gly Asp Leu Asp Ile Ala Tyr Ser Leu Ile Leu Ala

130 135 140

His Asn Gln Trp Gly Ser Gly Gly Ala Ile Asn Tyr Leu Gln Glu Ala

145 150 155 160

Lys Lys Met Ile Thr Asp Gly Ile Lys Ala Ser Tyr Val Thr Ser Gly

165 170 175

Asn Arg Leu Asn Leu Gly Asp Trp Asp Gly Lys Asp Ala Leu Asn Thr

180 185 190

Arg Pro Ser Asp Trp Met Leu Ser His Leu Arg Ala Phe Tyr Glu Val

195 200 205

Thr Gly Asp Glu Thr Trp Ile His Val Ile Asp His Leu Tyr Asp Val

210 215 220

Tyr Gln Gln Phe Ser Ala Thr Tyr Ser Pro Asn Thr Gly Leu Ile Ser

225 230 235 240

Asp Phe Val Val Gly Asn Pro Pro Arg Pro Ala Pro Glu Trp Tyr Leu

245 250 255

Asp Glu Phe Lys Glu Thr Asn Gln Tyr Tyr Tyr Asn Ala Ser Arg Val

260 265 270

Pro Leu Arg Ile Val Met Asp Tyr Ala Leu Tyr Gly Asp Thr Arg Ala

275 280 285

Lys Ala Leu Ala Asp Lys Met Val Ser Trp Ile Lys Thr Lys Thr Gly

290 295 300

Gly Ala Pro Ala Asn Ile Lys Asn Gly Tyr Lys Leu Asp Gly Thr Ala

305 310 315 320

Ile Gly Asn Tyr Ala Thr Ala Val Phe Val Ala Pro Phe Ile Ser Ala

325 330 335

Gly Thr Val Asn Ser Asn His Gln Ala Trp Val Asn Ala Gly Trp Asp

340 345 350

Trp Met Lys Asn Lys Lys Glu Asp Tyr Phe Ser Asp Thr Tyr Asn Leu

355 360 365

Leu Asn Leu Leu Phe Leu Ser Gly Asn Trp Trp Lys Pro Ser Gly Ala

370 375 380

Thr Val Pro Glu Ala Pro Asn Leu Ala Leu Asn Lys Thr Ala Val Ser

385 390 395 400

Ser Thr Met Glu Gly Val Gly Phe Glu Pro Asp Lys Ala Ile Asp Gly

405 410 415

Asn Gln Met Thr Arg Trp Ala Ser Arg Glu Gly Thr Asp Pro Glu Trp

420 425 430

Ile Tyr Val Asp Leu Gly Ala Val His Gln Ile Thr Gly Val Lys Leu

435 440 445

Arg Trp Glu Val Ala Tyr Ala Lys Arg Tyr Lys Ile Glu Ile Ser Thr

450 455 460

Asp Ser Gly Ala Pro Glu His Trp Gln Glu Val Tyr Ser Thr Ser Ser

465 470 475 480

Gly Asp Gly Gly Leu Asp Glu Ile Pro Leu Ser Pro Gln Pro Ala Arg

485 490 495

Tyr Val Arg Met Tyr Gly Ile Glu Arg Gly Thr Pro Tyr Gly Tyr Ser

500 505 510

Leu Tyr Glu Phe Glu Val Thr Gly Gln

515 520

<210>2

<211>1566

<212> DNA

<213>balun Pueraria lobota hereby series bacillus (Paenibacillusbarengoltzii) CAU904

<400>2

atgaagccgt tcccgcagca gatcagctat ccgggaatca tcaagccaag ccacgtcacc 60

caagccgcga tgaatcaggc tgtggcgtca tattacgatt attggaaagc gacttatctt 120

cgcaacaatt tgtcttcttt gccgggcggt tactatgtga agggcaatat tacgggagat 180

cccgacgggt ttaccgcgct tggttcctct gaaggtcagg gctacggcat gatcatcacc 240

gtgctgatgg caggttatga tccgaacgcc aagacgattt atgacggatt gtttaagacg 300

gcacgtacat ataagagcag cggaaatccg aacttgatgg gttgggtagt agcggacagc 360

aaagccgctc aaggccattt tgggtcagct accgacggtg atttggacat cgcttattcg 420

ttgattttag ctcacaacca gtggggctcg ggcggggcga tcaactattt gcaagaagcg 480

aaaaaaatga ttaccgacgg cattaaagca agctatgtta catctggtaa tcggcttaat 540

cttggagatt gggacggtaa ggatgcgctg aatacgcggc cgtcggactg gatgctcagt 600

catttgcgcg ctttttatga ggtcacaggg gatgagactt ggattcatgt gatagatcat 660

ttgtacgacg tgtatcaaca gtttagcgca acatattctc caaataccgg actgatctct 720

gactttgtgg tgggcaaccc gccaagacct gcgccagagt ggtatctgga tgagttcaaa 780

gaaacgaatc aatattacta taatgcaagc cgtgtaccgc tgcgcatcgt tatggattat 840

gcgttatacg gcgataccag agcgaaagcg ctcgccgaca aaatggtgag ctggatcaaa 900

acgaaaaccg gcggtgcacc tgcaaatatc aaaaatggct acaagctgga cggcacagcc 960

ataggaaatt atgccacagc ggtatttgtc gctccgttca tctcggcggg aacggtgaat 1020

tccaatcatc aagcttgggt gaatgcgggc tgggactgga tgaagaataa gaaagaggat 1080

tacttcagcg atacctacaa tttgctgaac ttgctgttcc tatcggggaa ttggtggaag 1140

cccagcgggg caactgtacc ggaagctccg aatctggccc tgaataaaac agcggtatcc 1200

agcacaatgg aaggcgtggg gtttgaaccg gacaaggcga tagacggcaa ccagatgacg 1260

cgctgggcca gtcgcgaggg gaccgatccg gaatggattt acgttgatct gggtgccgta 1320

catcaaatca ccggcgtcaa gctgcggtgg gaggtggcat acgccaagcg gtacaagatt 1380

gaaatctcca cggacagcgg agcgccagag cattggcagg aagtatattc gacttcaagc 1440

ggagatggag gacttgatga aatcccgctt tcgccgcagc cggcaagata tgtccgcatg 1500

tatggcatcg agcgggggac accttacggg tattcccttt acgagtttga agtgacaggt 1560

cagtag 1566

Claims (10)

1. protein, for it is following 1) or 2) or 3):

1) amino acid sequence is protein shown in sequence 1 in sequence table；

2) fused protein that the N-terminal of protein shown in sequence 1 or/and C-terminal connection label obtain in sequence table；

Or 2) 3) 1) protein shown in by the substitution of one or several amino acid residues and/or is deleted and/or added Protein arriving and with the same function.

2. encoding the nucleic acid molecules of protein described in claim 1.

3. nucleic acid molecules as claimed in claim 2, it is characterised in that: the nucleic acid molecules are following (a1) or (a2) or (a3) Shown in DNA molecular:

(a1) code area includes the DNA molecular of sequence 2 in sequence table；

(a2) nucleotide sequence limited with (a1) has 75% or 75% or more identity, and encodes egg described in claim 1 The DNA molecular of white matter；

(a3) nucleotide sequence hybridization limited under strict conditions with (a1), and encode the DNA of protein described in claim 1 Molecule.

4. expression cassette, recombinant vector, recombinant microorganism or transgenic cell line containing nucleic acid molecules described in Claims 2 or 3.

5. protein described in claim 1 is as the application in chitosan enzyme；

Or nucleic acid molecules described in Claims 2 or 3, or, the expression cassette containing nucleic acid molecules described in Claims 2 or 3, recombination carry Body, recombinant microorganism or transgenic cell line are preparing the application in chitosan enzyme.

6. a kind of method for preparing chitosan enzyme includes the following steps: the recombinant microorganism described in claim 5 that ferments, obtains Chitosan enzyme.

7. according to the method described in claim 6, it is characterized by:

In the fermentation, start to add supplemented medium when the carbon source in the fermentation system is depleted；

The supplemented medium includes glucose and tryptone.

8. application of the protein described in claim 1 in hydrolysis glycan；

Or protein described in claim 1 is preparing the application in chitosan oligosaccharide.

9. a kind of method for hydrolyzing glycan includes the following steps: the hydrolysis glycan of the protein described in claim 1；

Or a kind of method for preparing chitosan oligosaccharide, include the following steps: the protein described in claim 1 or contains the protein Composition hydrolyzing chitosan, obtain chitosan oligosaccharide.

10. application according to claim 8 or method as claimed in claim 9, it is characterised in that:

The reaction pH range of the hydrolysis is 4.5-7.5 and/or the temperature range of the hydrolysis is 30-70 DEG C.