CN107964540B - Endoglucanase, its encoding gene cel5A-h28 and its application - Google Patents

Abstract

The invention belongs to genetic engineering fields, and in particular to a kind of endoglucanase, its encoding gene cel5A-h28 and its application.A kind of gene cel5A-h28 encoding the endoglucanase, nucleotide sequence is as shown in SEQ ID No.1.Bioinformatic analysis shows that the endoglucanase of gene coding belongs to the 5th family of glycoside hydrolase.Inventor is successfully cloned by design primer, and the successful expression in prokaryotic expression system, the most suitable action pH for purifying resulting recombined endo dextranase through induced ultrasonic is 6.0, optimum temperature is 55 °C, more stable enzymatic activity is able to maintain under 40 °C, with stronger pH tolerance, 85% or more enzymatic activity is able to maintain at pH4.0-9.0.The recombined endo dextranase has biggish research and commercial application potentiality.

Description

Endoglucanase, its encoding gene cel5A-h28 and its application

Technical field

The invention belongs to genetic engineering fields, and in particular to a kind of endoglucanase, its encoding gene cel5A-h28 and It is applied.

Background technique

Main constituents of the cellulose as plant cell wall are the most abundant renewable resources in current nature, However its obstinate structure limits its utilization.Cellulose degradation needs endoglucanase at the process of glucose (Endoglucanase, EC3.2.1.4), exoglucanase (exoglucanase, E.C.3.2.1.91) and beta-glucosidase The system same-action of enzyme (β-glucosidase, E.C.3.2.1.21) three kinds of cellulases.Wherein, endoglucanase is fine The most important ingredient of plain enzyme system is tieed up, it mainly acts on the noncrystalline domain of cellulose, the β in random hydrolysis cellulose chain-Isosorbide-5-Nitrae sugar Glycosidic bond, cut staple element long-chain are converted into the short chain of a large amount of different polymerization degrees, the degree of polymerization of cellulose are reduced, in degradation process It is middle to play crucial effect.Therefore, its Commercial cultivation is most important for the degradation efficiency of cellulose.Currently, the enzyme is It is widely used in the industries such as papermaking, weaving, food, bio-fuel, animal feeding.Being produced into using needs in these industries This is low, the endoglucanase with different optimal pH and temperature and better stability.In the past few decades, it largely grinds Study carefully the cost for concentrating on how reducing fungi production cellulase, the main random mutagenesis including bacterium, industry optimization, foreign protein The methods of addition.However, fully understanding due to lacking to complicated enzyme system and zymogenic bacteria, this process is relatively slow.Therefore, it seeks Look for a large amount of novel endoglucanases particularly important.

With group appearance learned, it is further that some microbial genome sequencings for producing lignocellulolyticenzymes are completed successively Research provide clearly genetic background, more and more cellulose enzyme gene nucleotide sequences are determined, and in large intestine It is expressed in bacillus and yeast, effectively supplements traditional enzyme system.And transcript profile sequencing is capable of providing gene cDNA The expression of sequence and gene can really reflect the expression of albumen in vivo, therefore, from environmental microorganism transcript profile It is relatively new that endo glucanase gene is excavated in information, while being also effective research direction.

Summary of the invention

The present invention provides a kind of endo glucanase gene cel5-h28, and recombinase Cel5-H28 is thermophilic after prokaryotic expression Medium temperature enzyme is able to maintain stable enzymatic activity at 40 DEG C；Optimal reaction pH is 6.0, and optimal reactive temperature is 55 DEG C,；With relatively strong PH tolerance, be able to maintain between pH4.0-9.0 high enzyme activity.

The technical solution adopted by the present invention to solve the technical problems is:

A kind of endoglucanase, amino acid sequence is as shown in SEQ ID No.2.

A kind of endo glucanase gene cel5A-h28 encoding the endoglucanase, nucleotide sequence such as SEQ Shown in ID No.1.Endo glucanase gene cel5A-h28 of the present invention comes from sheep rumen microorganism transcript profile data.

A kind of recombinant vector comprising the endo glucanase gene cel5A-h28.

A kind of recombinant bacterium comprising the xylanase gene cel5A-h28.

A method of endoglucanase is prepared, is recombinant bacterium described in fermented and cultured, obtains endoglucanase.

Expand the specific primer that the endo glucanase gene cel5A-h28 is used, it is characterised in that the spy Specific primer are as follows: H28-F:5 'ACAGCAAATGGGTCGCGGATCCATGAAAAAAACATTTACTTCACTTAG 3 ', nucleosides Acid sequence is as shown in SEQ ID No.3；H28-R:5 'CTTGTCGACGGAGCTCGAATTCTTATTTCAAAATTAACTTTATT ATGTTTATTCC 3 ', nucleotide sequence is as shown in SEQ ID No.4.

The acquisition methods of endo glucanase gene cel5A-h28 of the present invention are as follows

A, the building of the clone of cel5A-h28 endo glucanase gene and recombinant plasmid pET-28a/cel5A-h28；

B, expression of the recombinant plasmid pET-28a/cel5A-h28 in e. coli bl21 (DE3)；

C, the induction, purifying of recombinant protein and enzymatic property analysis；

Preferably, clone and the recombinant plasmid pET-28a/ of step a cel5A-h28 endo glucanase gene The building process of cel5A-h28 is specific as follows:

1. PCR amplification endo-glucanase enzyme coding gene cel5A-h28；

2. Inverse PCR amplification preparation linearisation pET-28a plasmid；

Experience 3. homologous recombination method constitutes recombinant plasmid pET-28a/cel5A-h28 and converts to e. coli bl21 (DE3) State cell.

Application of the endoglucanase of the present invention in terms of the cellulose degradation under strong basicity environment, as alkalinity is washed Wash the industrial productions such as agent, textile industry.The strong basicity environment is that pH is greater than 7.0.Further, the strong basicity environment is pH8.0-10.0。

The present invention has following advantages and good effect:

1. the gene cloned in the present invention comes from sheep rumen microorganism transcript profile data, guarantee the novelty of gene.

2. select prokaryotic expression system in the present invention, there is genetic background to understand, is easy to operate and with short production cycle etc. excellent Point.

3. what is taken when PCR amplification target fragment in the present invention is the specific primer of designed, designed, can be effectively ensured Amplification efficiency and product specificities.

4. there is endoglucanase of the invention wider pH adaptation range to be able to maintain within the scope of pH4.0-9.0 High enzyme activity.(within the scope of pH4.0-7.0, it is able to maintain 90% or more enzymatic activity, is able to maintain 85% at pH8.0-9.0 The above enzymatic activity).Therefore it can be used for the cellulose industry degradation under alkaline environment, such as in detergent, weaving industry, compare The textile of convention acidic endo-glucanase enzymatic treatment can generate phenomenon of fading, and endoglucanase can be in middle alkali in the present invention Property environment in handled, avoid this phenomenon occur.

Detailed description of the invention

Fig. 1 is clone and the expression strategy of cel5A-h28 endo glucanase gene；

Fig. 2 is clone's cel5A-h28 PCR product；

Fig. 3 is the SDS-PAGE analysis chart of recombinant protein c el5A-H28；

Fig. 4 is influence of the pH to Cel5A-H28 enzymatic activity；

Fig. 5 is the pH stability of Cel5A-H28 enzyme；

Fig. 6 is influence of the temperature to Cel5A-H28 enzymatic activity；

Fig. 7 is the thermal stability of Cel5A-H28 enzyme.

Specific embodiment

Below by specific embodiment, technical scheme of the present invention will be further explained in detail.It should be appreciated that this hair Bright implementation is not limited by the following examples, and the accommodation in any form made to the present invention and/or changed will all be fallen Enter the scope of the present invention.

In the present invention, if not refering in particular to, all parts, percentage are unit of weight, used equipment and raw material etc. It is commercially available or commonly used in the art.Method in following embodiments is unless otherwise instructed the normal of this field Rule method.

Embodiment:

One, sheep rumen content Total RNAs extraction

Take rumen content sample extraction total serum IgE (the following lysate RL, adsorption column RA, deproteinized of -80 DEG C of freezen protectives Liquid RE, rinsing liquid RW, RNase Free Water are purchased from Ai Delai Biotechnology Co., Ltd) it is ground into rapidly in liquid nitrogen Powder, every 50~100mg sample are homogenized after adding the lysate RL of 1ml, and acutely concussion is mixed with lytic cell.It is incubated at 15-30 DEG C Educating 5 minutes decomposes ribosome completely.12000rpm, 4 DEG C of centrifugation 10min remove insoluble matter.Supernatant is transferred to one to do Net centrifuge tube, every 1ml lysate RL are added 0.2ml chloroform, acutely vibrate 15s, 12000rpm, 4 DEG C of centrifugation 10min.It takes Layer colourless aqueous phase is transferred in new pipe, and the dehydrated alcohol of water phase volume half is added, and is added in adsorption column RA after mixing, at room temperature 12000rpm is centrifuged 45s, abandons supernatant.500 μ l protein liquid removal RE are added, 12000rpm is centrifuged 45s at room temperature, abandons supernatant.It is added 500 μ l rinsing liquid RW, 12000rpm is centrifuged 45s at room temperature, abandons supernatant.500 μ l rinsing liquid RW are added again, at room temperature 12000rpm is centrifuged 45s, abandons supernatant.13000rpm is centrifuged 2min and removes rinsing liquid as far as possible at room temperature.Adsorption column RA is put into In RNase free centrifuge tube, position adds 50-80 μ l RNase Free Water among adsorbed film, is placed at room temperature for 2min, 12000rpm is centrifuged 1min, obtains total serum IgE, -80 DEG C of preservations.

Two, the clone of cel5A-h28 gene

The clone of cel5A-h28 endo glucanase gene and expression strategy are shown in Fig. 1.

(1) using rumen content total serum IgE as template, the first chain cDNA (following Random is synthesized using reverse transcription Primer、RNase Free Water、5×RT Buffer、dNTP Mixture、RNase Inhibitor、ReverTra Ace is purchased from mill Biotechnology Co., Ltd, Japan)

1. preparing following mixed liquor in microcentrifugal tube:

65 DEG C of incubation 5min make RNA thermal denaturation, are immediately placed on ice.

2. preparing following reverse transcription reaction mixed liquor:

3. successively by reaction solution in 30 DEG C of incubation 10min；42 DEG C of incubation 20min；99 DEG C of incubation 5min；4 DEG C of incubation 5min, Then brief centrifugation obtains the first chain of cDNA.

(2) cel5A-h28 gene magnification

1. designing the primer containing pet28a Component Vectors homologous sequence and carrier Inverse PCR amplification primer:

H28-F:5 'ACAGCAAATGGGTCGCGGATCCATGAAAAAAACATTTACTTCACTTAG 3 ', nucleotides sequence It arranges as shown in SEQ ID No.3,

H28-R:5 'CTTGTCGACGGAGCTCGAATTCTTATTTCAAAATTAACTTTATTATGTTTATTCC 3 ', core Nucleotide sequence is as shown in SEQ ID No.4.

2. using the cDNA of synthesis as template PCR amplifications cel5A-h28 gene, the following (wherein 2 × Hide- of amplification system Fidelity Master Mix is purchased from Beijing Qing Kexin industry Bioisystech Co., Ltd):

Vortex oscillation mixes, and is put into PCR instrument after being slightly centrifuged.The amplification condition of cel5A-h28 gene is as follows:

PCR result is shown in Fig. 2, and amplification obtains the band of 1443bp, occurs in swimming lane without other miscellaneous bands, illustrate design primer It is specific good.

Three, the building of recombinant plasmid pET-28a/cel5A-h28

(1) linearisation pET-28a carrier preparation

PCR reversely expands pET-28a vector plasmid, preparation linearisation cloning vector.PCR amplification system is as follows:

Vortex oscillation mixes, and is put into PCR instrument after being slightly centrifuged.The amplification condition for linearizing pET-28a carrier is as follows:

(2) target gene is connect with pET-28a carrier

Using the principle of homologous recombination, by SoSoo recombinant clone kit, (holding up the new industry biotechnology of section purchased from Beijing has Limit company) quickly by target gene directed cloning into linearisation pET-28a carrier.Reaction system is as follows:

10 μ l systems, target gene and expression vector molar ratio are 5:1,50 DEG C of reaction 30min.

Four, expression of the recombinant plasmid in Escherichia coli

It is heat-shock transformed that 10 μ l connection products and E. coli competent BL21 (DE3) is taken carefully to mix, ice bath 30min；42 DEG C water-bath heat shock 50s takes out ice bath 2min immediately；The SOC solution of 37 DEG C of 500 μ l preheatings, 150rpm constant temperature incubation 1h is added； Bacterium solution after drawing conversion, is coated in the LB screening and culturing medium containing kanamycins, 37 DEG C of constant temperature incubation 12-16h；Picking bacterial plaque PCR identification is carried out, positive clone is confirmed as and is transferred to expansion culture in the LB liquid medium containing kanamycins.

Five, the induction, purifying of positive strain and enzymatic property analysis

(1) induction of positive strain

1. it draws 10 μ l positive bacterium solutions to be forwarded in LB liquid medium of the 5mL containing kanamycins (50 μ g/mL), 37 DEG C, 220rpm cultivates 12-16h；

2. 5mL bacterium solution is forwarded in 200mL LB liquid medium, 37 DEG C, 220rpm continues culture to OD=0.5- 1.0 (about 3-4 hours)；

3. being added 2ml IPTG (final concentration 1mmol/L), 20 DEG C, 150rpm low temperature induction culture 6h；

4. the bacterium solution of inducing expression is transferred in 50mL centrifuge tube, 12000rpm, 4 DEG C of centrifugation 15min discard supernatant, 30mL PBS buffer solution (pH7.4) is added, thallus is sufficiently resuspended；

5. be put into the beaker for filling ice cube, ultrasonic wave be crushed repeatedly 3 times (each ultrasound 15min, working time 3s, Intermittent time 5s, No. 6 amplitude transformers are crushed power 195W)；

6. broken bacterium solution 12000rpm, 4 DEG C of centrifugation 15min, gained supernatant is crude protein liquid (CP), is used immediately or 4 DEG C It saves.

(2) destination protein affinity chromatography

It takes and walks crude protein liquid obtained on 30mL, Ni-NTA resin extender 2mL is added, after mixing well, by mixed liquor It is transferred to chromatography pillar, upper prop collection repeatedly penetrates liquid (flow-through), is denoted as FT.

When albumen sample liquid liquid level to be mixed is close to Ni-NTA resin extender, with the Washing of 40 times of bed volumes (40mL) Buffer 1 (imidazoles containing 20mmol/L) washs pillar, removes foreigh protein removing, collects cleaning solution with 1.5mL centrifuge tube, is denoted as W1.

It is washed pillar 2 times, is used with the washing buffer 2 (imidazoles containing 50mmol/L) of 1 times of bed volume (1mL) 1.5mL centrifuge tube collects cleaning solution, is denoted as W2, W3.

Destination protein, elution 4 are eluted with the Elution buffer (imidazoles containing 250mmol/L) of 1 times of bed volume (1mL) It is secondary, eluent is collected with 1.5mL centrifuge tube, is denoted as E1, E2, E3, E4.

Purified product is subjected to SDS-PAGE analysis (Fig. 3), as the result is shown: the albumen of recombinase Cel5A-H28 is a small amount of greatly For 56kDa or so.

(3) enzymatic property is analyzed

The definition of endo-glucanase enzyme activity unit: the enzyme amount for generating 1 μm of ol reduced sugar per minute is 1 unit of activity (U), Calculation formula:

A: the concentration (μm ol/mL) of reduced sugar is generated

K: pure enzyme extension rate

T: enzyme digestion reaction time (min)

C: pure enzyme protein concentration (mg/mL)

Influence of the pH to enzymatic activity

Optimal pH: be respectively adopted pH 3.0-10.0 buffer (wherein pH3.0-8.0 using McIlvaine ' s buffer Liquid, pH8.0-9.0 use Tris-HCl buffer, and pH9.0-10.0 uses Glycine-NaOH buffer) 1% carboxymethyl of configuration Sodium cellulosate (CMC) reaction substrate takes 450 μ l substrates in 50 DEG C of preheating 5min, 50 μ l enzyme solutions is added, react under the conditions of 50 DEG C 10min is added 500 μ l DNS solution, measures relative activity respectively using DNS method.As the result is shown (Fig. 4: recombinase Cel5A- The optimal pH of H28 is 6.0.

PH stability: endoglucanase is incubated for 30min under the conditions of pH 3.0-10.0,37 DEG C respectively, then most Enzyme activity is detected under the conditions of suitable.It is control with enzyme activity of the untreated endoglucanase under optimum condition, calculates remaining inscribe The relative activity of dextranase.As the result is shown (Fig. 5): recombinase Cel5A-H28 has wider pH tolerance, in pH4.0- Greater activity is able to maintain between 9.0.

Influence of the temperature to enzyme activity

Optimum temperature: pH6.0 buffer 1%CMC substrate is used, endoglucanase is measured using DNS method respectively and is existed Enzyme activity at 30 DEG C -70 DEG C calculates relative activity.As the result is shown (Fig. 6): the optimal reactive temperature of recombinase Cel5A-H28 is 55℃。

Thermal stability: endoglucanase being respectively placed under the conditions of 40,50 and 60 DEG C and is incubated for 50min respectively, every 10min sampling measures enzyme activity under optimum condition.It is control with enzyme activity of the untreated endoglucanase under optimum condition, Calculate the relative activity of remaining endoglucanase.As the result is shown (Fig. 7): recombinase Cel5A-H28 is thermophilic cold-adapted enzyme, at 40 DEG C When be able to maintain greater activity, but when temperature is higher than 50 DEG C, enzymatic activity is reduced rapidly.

Conclusion: according to above-mentioned experiment conclusion, it was demonstrated that endoglucanase of the invention has wider pH tolerance, in height It is still able to maintain good enzymatic activity under the particular surroundings of pH value and (within the scope of pH4.0-7.0, is able to maintain 90% or more enzyme activity Property, 85% or more enzymatic activity is able to maintain at pH8.0-9.0), there are biggish industrialized production and application potential, can be applied to strong Cellulose degradation under alkaline environment, such as alkaline detergent, textile industry industrial production.

Embodiment described above is the preferred version that the present invention excavates gene and external preparation endo-glucanase enzyme method, It is not intended to limit the present invention in any form, there are also it on the premise of not exceeding the technical scheme recorded in the claims Its variant and remodeling.

Sequence table

<110>Zhejiang University

<120>endoglucanase, its encoding gene cel5A-h28 and its application

<130> ZJDX-WJK002

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1443

<212> DNA

<213>endo glucanase gene cel5A-h28 (Endoglucanase)

<400> 1

atgaaaaaaa catttacttc acttagaaaa acaacatctg cgattgccgc tttagttatt 60

tcaggtatga cattcaacgc atccgcagaa aaactttcag ggaacacagc tactgagatc 120

gctggaatga tgaccacagg ttggaacctt ggaaacacat ttgatgcaac tggcggaaaa 180

ggcgaagggt atggtcttga cgcagagacg tcttggggac aacctaaaac cacacaagag 240

atgataaccg ccgtacgaaa agcaggattc aatacaattc gtattcctgt atcatgggga 300

aatcatacaa atttctggga agacactgaa aacttcacaa tcagcgaaga atggatggca 360

cgcgtcaaag aagtggttga ttactgttac aatgaaaatt tgtttgtaat cctcaatatc 420

catcacgaca acaactctgg caacatctat tatatgcctg aagaagatga ggataatgaa 480

ctcttcatca aaggtgtttg gcgtcagatt gcggaagctt ttaaagatta cgaccagcat 540

ttgattttcg aaatcatgaa cgagcctcgt ctggtaggaa aagcaaacga atggtggttt 600

gatataaaca acccttctat gcctatcgtc actgcactcg aaatgataaa caagttcaac 660

caaataggag ttgatgaaat tcgtggaaat ggttctgcag agaacaagga ccgcgtaatt 720

atgtgtcctg gatatgcagc ttgttacgag ggatgtatga ctcctgattt cgagttgcca 780

acagacgtga caccaaatcg tcttgcagta tctctacatg cataccgtcc atacgatctt 840

tgtttgggta gcgtatctac atggaaagat agctacaaga aagaaatcga agattacttc 900

aagcctgttt atgaaaagtt catcgtaggc atgggggttc ctgtaatcat tggagaggaa 960

tcatgctctg ccagattcag cagaaacgaa agaacaaatc aagacgacag attggaatgg 1020

gtagaggtat actacaatgt aaccaagaaa tatggtatgc cttctgtttt gtgggacaac 1080

aacgtataca gaagcaacaa aggtgaagcc cacggtcatt tgaatcgtaa agaattaaaa 1140

tggtacgatc aagcattcat ccagaaaatc atggatgtac ttggaatcga aagtgttgac 1200

aatatctcta ttgactattc attgtctatt ggtccaaacc cagcaacgaa catcatcaat 1260

gtttcggcag acaatgagct acaaaatatc acaatttact ctgctagcgg aacaagagtt 1320

atgttccaag agatttcagg aaacaatgcg gaaatcggaa tctctatgct aaacagagga 1380

atttacaacg ctgtcgttaa gacagaatta ggaataaaca taataaagtt aattttgaaa 1440

tag 1443

<210> 2

<211> 480

<212> PRT

<213>endoglucanase (Endoglucanase)

<400> 2

Met Lys Lys Thr Phe Thr Ser Leu Arg Lys Thr Thr Ser Ala Ile Ala

1 5 10 15

Ala Leu Val Ile Ser Gly Met Thr Phe Asn Ala Ser Ala Glu Lys Leu

20 25 30

Ser Gly Asn Thr Ala Thr Glu Ile Ala Gly Met Met Thr Thr Gly Trp

35 40 45

Asn Leu Gly Asn Thr Phe Asp Ala Thr Gly Gly Lys Gly Glu Gly Tyr

50 55 60

Gly Leu Asp Ala Glu Thr Ser Trp Gly Gln Pro Lys Thr Thr Gln Glu

65 70 75 80

Met Ile Thr Ala Val Arg Lys Ala Gly Phe Asn Thr Ile Arg Ile Pro

85 90 95

Val Ser Trp Gly Asn His Thr Asn Phe Trp Glu Asp Thr Glu Asn Phe

100 105 110

Thr Ile Ser Glu Glu Trp Met Ala Arg Val Lys Glu Val Val Asp Tyr

115 120 125

Cys Tyr Asn Glu Asn Leu Phe Val Ile Leu Asn Ile His His Asp Asn

130 135 140

Asn Ser Gly Asn Ile Tyr Tyr Met Pro Glu Glu Asp Glu Asp Asn Glu

145 150 155 160

Leu Phe Ile Lys Gly Val Trp Arg Gln Ile Ala Glu Ala Phe Lys Asp

165 170 175

Tyr Asp Gln His Leu Ile Phe Glu Ile Met Asn Glu Pro Arg Leu Val

180 185 190

Gly Lys Ala Asn Glu Trp Trp Phe Asp Ile Asn Asn Pro Ser Met Pro

195 200 205

Ile Val Thr Ala Leu Glu Met Ile Asn Lys Phe Asn Gln Ile Gly Val

210 215 220

Asp Glu Ile Arg Gly Asn Gly Ser Ala Glu Asn Lys Asp Arg Val Ile

225 230 235 240

Met Cys Pro Gly Tyr Ala Ala Cys Tyr Glu Gly Cys Met Thr Pro Asp

245 250 255

Phe Glu Leu Pro Thr Asp Val Thr Pro Asn Arg Leu Ala Val Ser Leu

260 265 270

His Ala Tyr Arg Pro Tyr Asp Leu Cys Leu Gly Ser Val Ser Thr Trp

275 280 285

Lys Asp Ser Tyr Lys Lys Glu Ile Glu Asp Tyr Phe Lys Pro Val Tyr

290 295 300

Glu Lys Phe Ile Val Gly Met Gly Val Pro Val Ile Ile Gly Glu Glu

305 310 315 320

Ser Cys Ser Ala Arg Phe Ser Arg Asn Glu Arg Thr Asn Gln Asp Asp

325 330 335

Arg Leu Glu Trp Val Glu Val Tyr Tyr Asn Val Thr Lys Lys Tyr Gly

340 345 350

Met Pro Ser Val Leu Trp Asp Asn Asn Val Tyr Arg Ser Asn Lys Gly

355 360 365

Glu Ala His Gly His Leu Asn Arg Lys Glu Leu Lys Trp Tyr Asp Gln

370 375 380

Ala Phe Ile Gln Lys Ile Met Asp Val Leu Gly Ile Glu Ser Val Asp

385 390 395 400

Asn Ile Ser Ile Asp Tyr Ser Leu Ser Ile Gly Pro Asn Pro Ala Thr

405 410 415

Asn Ile Ile Asn Val Ser Ala Asp Asn Glu Leu Gln Asn Ile Thr Ile

420 425 430

Tyr Ser Ala Ser Gly Thr Arg Val Met Phe Gln Glu Ile Ser Gly Asn

435 440 445

Asn Ala Glu Ile Gly Ile Ser Met Leu Asn Arg Gly Ile Tyr Asn Ala

450 455 460

Val Val Lys Thr Glu Leu Gly Ile Asn Ile Ile Lys Leu Ile Leu Lys

465 470 475 480

<210> 3

<211> 48

<212> DNA

<213>artificial sequence (H28-F)

<400> 3

acagcaaatg ggtcgcggat ccatgaaaaa aacatttact tcacttag 48

<210> 4

<211> 55

<212> DNA

<213>artificial sequence (H28-R)

<400> 4

cttgtcgacg gagctcgaat tcttatttca aaattaactt tattatgttt attcc 55

Claims (7)

1. a kind of endoglucanase, it is characterised in that: its amino acid sequence is as shown in SEQ ID No.2.

2. a kind of endo glucanase gene cel5A-h28 of endoglucanase described in coding claim 1, feature exist In: its nucleotide sequence is as shown in SEQ ID No.1.

3. a kind of recombinant vector comprising endo glucanase gene cel5A-h28 described in claim 2.

4. a kind of recombinant bacterium comprising endo glucanase gene cel5A-h28 described in claim 2.

5. a kind of method for preparing endoglucanase is fermented and cultured recombinant bacterium as claimed in claim 4, it is poly- to obtain inscribe Portugal Carbohydrase.

6. expanding the specific primer that endo glucanase gene cel5A-h28 described in claim 2 is used, it is characterised in that institute The specific primer stated are as follows:

H28-F:5 'ACAGCAAATGGGTCGCGGATCCATGAAAAAAACATTTACTTCACTTAG 3 ', nucleotide sequence As shown in SEQ ID No.3,

H28-R:5 'CTTGTCGACGGAGCTCGAATTCTTATTTCAAAATTAACTTTATTATGTTTATTCC 3 ', core Nucleotide sequence is as shown in SEQ ID No.4.

7. a kind of endoglucanase described in claim 1 is in terms of the cellulose degradation under the alkaline environment of pH8.0-9.0 Application.