KR101252801B1 - Identification of Mannanase from Clostridium cellulovorans and application of cellulosome complex for hydrolysis of galactomannan - Google Patents

Abstract

The present invention relates to a mannanase in Clostridium cellulovorans . Mannanase of the present invention has an excellent mannanase activity, and has an excellent effect on the decomposition of mannan, a major component of wood based together with cellulose as a cellulosome complex, making it suitable for a process for producing biofuel from wood based biomass. It is possible.

Description

Identification of Mannanase from Clostridium cellulovorans and application of cellulosome complex for hydrolysis of galactomannan}

The present invention relates to a nucleic acid molecule encoding a mannanase isolated from Clostridium cellulose boronase, an anaerobic cellulosome-forming bacterium, a vector comprising the nucleic acid molecule, and a method for utilizing cellulosome complexes for woody biomass degradation. It is about.

Wood fiber is a constituent of the cell walls of plants and consists of a complex of cellulose and hemicellulose. Cellulose is a -1,4-glucose complex and is the most abundant renewable material in nature (Reiter et al . Biosynthesis and properties of the plant cell wall. Curr Opin Plant Biol 5 (2002) 536-42). Although the chemical composition is simple, the action of several different enzymes is required to effectively break down cellulose (Ximenes e t). al . Hemicellulases and biotechnology. Recent Res Develop Microbiol 2 (1998) 165-176). Hemicelluloses include xylan, β-1.4-xylose, and glucomannan, β-1,4-glucose and mannose. Anaerobic microorganisms that can degrade most cellulose form enzyme complexes called cellulose (Roy H. Doi, The Clostridium cellulovorans cellulosome: An enzyme complex with plant cell wall degrading activity. The Chemical Record 1 (2001) 24-32). Cellulosomes act against various substrates such as crystalline cellulose, xylan, met, pectin and consist of cellulosome-forming enzymes and support proteins. The formation of cellulosomes consists of binding the dockerin domain of one cellulosome forming enzyme and one of several cohisine domains of the support protein. All cellulosome forming enzymes have β dockerine domains and enzymes without dockerine domains are non-cellulosome forming enzymes (Bayer et. al . The cellulosome: multienzyme machines for degradation of plant cell wall polysaccharides. Annual Review of Microbiol 58 (2004) 521-554).

Mannanase is an enzyme used to break down mannan. Mannan is a substrate rich in woody biomass. It contains 2-5% of galactomannan in conifers and 15-25% of glucogalactomannan in hardwood. Pham e t al . J Biotechnol 1 48 (2010) 163-170).

On the other hand, the support protein CbpA in the cellulosome complex has a carbohydrate binding module (Carbohydrate binding module), which helps the enzymes to access insoluble biomass. Endoglucanase E from Clostridium cellulose boron is expected to have metase activity in addition to endoglucanase activity as GH5 (Vlasenko e t). al . Substrate specificity of family 5, 6, 7, 9, 12, and 45 endoglucanases. Bioresour Technol 101 (2009) 2405-2411).

Recently, attention is being drawn to renewable energy due to fuel depletion due to excessive use of fossil fuels and concerns about global warming and environmental pollution represented by extreme weather. Bioenergy, one of the alternative energy sources, aims to make biofuels such as bioethanol, butanol and diesel using non-edible plant resources that have not been used previously. Plant resources biomass is composed of cellulose, hemicellulose, lignin, etc., so that they can be degraded only if they have specific enzymes.

The present invention has been made in view of the above necessity, and an object of the present invention is to provide an enzyme that effectively decomposes woody biomass degradation.

It is another object of the present invention to provide nucleic acid molecules that effectively degrade woody biomass degradation.

It is another object of the present invention to provide a recombinant vector that effectively degrades woody biomass degradation.

It is still another object of the present invention to provide a transformant that effectively degrades woody biomass degradation.

It is another object of the present invention to provide a method for inducing a synergistic effect on galactomannan degradation.

The present invention in order to attain the object of the cloth has the amino acid sequence shown in SEQ ID NO: 1 tree Stadium cellulose Robo lance (Clostridium cellulovorans ) provides mannanase isolated.

The present invention also provides a gene encoding the enzyme of the present invention.

In one embodiment of the present invention, the gene preferably has a nucleotide sequence set forth in SEQ ID NO: 2, but in consideration of the degeneracy of the genetic code of the base sequence set forth in SEQ ID NO: 2, 80% homology, preferably Preferably, genes having 85% homology, more preferably 90% homology, and most preferably 95% homology, are included in the metase gene of the present invention.

The present invention also provides a recombinant vector containing the gene of the present invention derived from Clostridium cellulose boranth.

In one embodiment of the present invention, the vector preferably has a cleavage map as described in FIG. 4, but is not limited thereto.

The present invention also provides a transformant transformed with the vector of the present invention.

In another aspect, the present invention provides a wood-based biomass decomposition method comprising the step of treating the wood-based biomass enzyme of claim 1 of the present invention.

In another aspect, the present invention provides a wood-based biomass sugar conversion method comprising the step of treating the enzyme of the present invention to wood-based biomass.

In another aspect, the present invention provides a wood-based biomass decomposition method comprising the step of treating the wood-based biomass of a complex of mini sibi P and endoglucanase E, the enzyme of the present invention and the cellulosome complex forming protein. .

In another aspect, the present invention provides a wood-based biomass sugar conversion method comprising the step of treating the wood-based biomass of a complex of mini sibiP and endoglucanase E, the enzyme of the present invention and a cellulosome complex forming protein. do.

In another aspect, the present invention provides a composition for biomass degradation of wood-based biomass comprising a complex of mini sibi P and endoglucanase E, the enzyme of the present invention and a cellulosome complex forming protein as an active ingredient.

In another aspect, the present invention provides a composition for the conversion of wood-based biomass sugar comprising a complex of mini sibiP and endoglucanase E, the enzyme of the present invention and a cellulosome complex forming protein, as an active ingredient.

Hereinafter, the present invention will be described.

According to one aspect of the present invention, the present invention provides a met kinase isolated from Clostridium cellulose borance comprising a nucleic acid or amino acid sequence.

The present inventors earnestly researched to develop a mannase required for a sugar conversion process for producing biofuel from heterogeneous biomass. As a result, by cloning a novel gene having homology with a known mannase amino acid sequence from mesophilic anaerobic, cellulosome-forming bacteria, the cloned gene was expressed in E. coli to experimentally confirm the mannase activity. Completed.

The cellulase of the present invention is a novel enzyme isolated based on the sequence homology of the mannanase isolated from Clostridium cellulose boranth.

As used herein, the term mannanase refers to an enzyme that catalyzes the production of mannose, a monosaccharide, by hydrolyzing 1,4--D-mannopyranosyl linkages in mannan. . It is meant to include the enzyme endo-beta-1,4-mannanase (endo-1,4--mannanase; EC 3.2.1.78).

Clostridium cellulose boranose in the present invention ( Clostridium cellulovorans ) is a cellulosome-forming bacterium that is hydrolysable, such as crystalline cellulose, xylan, and pectin, and is known to produce metinase when mixed with xylan, Avicel, xylan, and pectin (Cho et. al . Cellulosomic profiling produced by Clostridium cellulovorans during growth on different carbon sources explored by the cohesin marker. J Biotechnol 45 (2010) 233-239).

The novel mannase of the present invention is amplified by PCR (polymerase chain reaction) method using oligo-nucleotides prepared based on known nucleic acid sequences as primers and DNA extracted from Clostridium cellulose as a template. It was. The metnase of the present invention comprises the 657 amino acid sequence shown in FIG. 3 and is similar in sequence similarity to the metnase of Clostridium cellulolyticum belonging to the family 26 family of glycosyl hydrolase. ), And met kinase activity.

According to another aspect of the present invention, the present invention provides a nucleic acid molecule encoding a mannanase isolated from Clostridium cellulose boranth.

It is apparent to those skilled in the art that the nucleotide sequence encoding the mannanase isolated from the Clostridial cellulose boranth of the present invention is not limited to the nucleotide sequence shown in FIG.

According to another aspect of the invention, there is provided a vector comprising a nucleic acid molecule encoding a mannase isolated from Clostridium cellulose boranth.

Vectors of the invention can typically be constructed as vectors for expression or as vectors for cloning. Preferably, the vector of the present invention is a vector for expressing a recombinant peptide or protein. In addition, the vector of the present invention is an expression vector, and can be constructed using prokaryotic or eukaryotic cells as host cells.

On the other hand, the vector of the present invention as an optional marker, and includes an antibiotic endogenous gene commonly used in the art, for example, ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin And resistance genes for tetracycline.

According to another aspect of the present invention, the present invention provides a transformant transformed with a vector comprising a nucleic acid molecule encoding the aforementioned mannanase.

Development of a transformant transformed into E. coli with a vector containing a nucleic acid molecule encoding the above-described met kinase of the present invention and the January 2011 to the Korea Microorganism Conservation Center (KCCM), Yurim Building, Hongje 1-dong, Seodaemun-gu, Seoul, Korea Deposited with E. coli BL 21 (DE3) pET22b-ManB Accession No. KCCM11161P for 7 days.

Homework cells capable of stable and continuous cloning and expression of the vectors of the present invention may use any host cell known in the art, for example, E. coli JM109, E. coli BL21 (DE3), E. coli DH5. , Bacillus genus strains such as E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus subtilis, Bacillus thuringiensis, and Salmonella typhimurium, Ceratia Enterobacteria and strains such as Marsesons and various Pseudomonas species.

In addition, when transforming a vector of the present invention into eukaryotic cells, yeast (Saccharomyce cerevisiae) and the like can be used as host cells.

According to another embodiment of the present invention, the galvantomannan is digested by using the mannanase isolated from Clostridium cellulose boron and mini sibipie protein and endoglucanase E, which are part of the sibipie protein, a cellulosome forming protein. To provide synergy.

It is used for biomass degradation including mannan using mannanase and mini-SBiPay isolated from Clostridium cellulose boranth of the present invention.

The present invention includes the use of mannanase and mini-cibiP and other cellulosome forming enzymes isolated from the Clostridium cellulose boranthose of the present invention for biomass degradation.

The present invention will provide an efficient method for biofuel production using wood-based fiber as an energy source.

Hereinafter, the present invention will be described in more detail.

The present invention was isolated and screened through the novel invention coherence markers (see Fig. 1), this is Escherichia coli ) and cloned. In addition, the metase activity was analyzed, and the optimum temperature and pH were confirmed. Mini-CbpA protein and endoglucanase E, which are part of CBiA in cellulosomes, were used to effectively degrade galactomannan. Mannanase was associated with mini-cibiP protein to increase galactomannan activity, while mini-SB and its manganase and endoglucanase E were synergistic in degrading galactomannan. effect) (see Figure 8).

Thus, the present inventors have confirmed that it can effectively decompose the mannan using a novel mannase, completed the present invention.

The present invention relates to a novel anti-anase isolated from Clostridium cellulose borax which is a kind of mesophilic anaerobic, cellulosome forming bacteria. Mannanase of the present invention has excellent mannanase activity and can be used in the sugar conversion process for biofuel production from wood-based biomass including mannan. In addition, a portion of the cellulosome-forming protein sibiP, mini- sibiP and endoglucanase E, has been used to synergistically degrade woody biomass including galactomannan.

1 is a figure for identifying and identifying a mannase, a cellulosome forming enzyme of Clostridium cellulose, through a cohysine marker;
2 is the nucleotide sequence of a nucleic acid encoding a metase of Clostridium cellulose boranth;
3 is an amino acid sequence encoding a metase of Clostridium cellulose boranth;
4 is a schematic diagram of pET 22b-mannanase incorporating Clostridial cellulose boranthene metase into the pET 22b vector;
5 is a figure confirming the purification of the metnase of Clostridium cellulose Boranase in E. coli and the activity of the met through the zymogram;
6 is a table showing the enzymatic activity of the met kinase of Clostridium cellulose boranth;
FIG. 7A is a drawing of the metase and mini-SBiPie of Clostridium cellulose boranth assembled;
FIG. 7B is an assembled view of Endoglucanase E and Mini-Sivipedia of Clostridium cellulose;
FIG. 8A is a diagram showing a synergistic effect on the decomposition of galactomannan LBG by mixing the assembled mannanase and mini-SiviP complex and endoglucanase E and mini-SIVP complex in a ratio;
FIG. 8B is a diagram showing a synergistic effect on galactosmanin-induced gear gum degradation by mixing the assembled mannanase and mini-SiviP complex and endoglucanase E and mini-SIVP complex in a proportion.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. .

Example  One: Clostridium Cellulose borance Cellulosome  Formation Enzyme Search

Traditional cohisine markers (Cho et al . Cellulosomic profiling produced by Clostridium cellulovorans During the growth on different carbon sources explored by the cohesin marker. J Biotechnol 45 (2010) 233-239), different nucleic acids were detected in the Clostridium cellulose boron genome sequence and are shown in FIG. 1.

Example  2: gene amplification and Cloning

Amplification of the DNA encoding a dehydratase (Mannanase) met the estimation by the Figure 4 shown with reference to the forward primer (Forward primer) 5 'GGATCC GATGAAAAAAATTTTCGGCAGAGCGATG -3' 5 has the restriction enzyme BamHI, a reverse primer (SEQ ID NO: 3) ( Reverse primer) 5 'of GAATTC GAGCTAAGTAATATCTTCT-3' (SEQ ID NO: 4) was synthesized by designing a primer to insert the restriction enzyme EcoR1 recognition sequence. Then, PCR was performed using the synthesized primers.

Example  3: Mannanase  gene Cloning , Expression and purification

Amplified products were electrophoresed on 0.8% agarose gel and DNA fragments on agarose gel were recovered using a gel extraction kit (GeneAll, Korea). After digestion with restriction enzymes BamHI , EcoRI and ligation to E. coli protein expression vector pET-22b (Novagen, USA), it was transformed into Escherichia coli ( E. coli ) BL21 DE3 and completed. The vector is shown in FIG. The transformed Escherichia coli was then inoculated into a Luria-Butani culture solution containing empicillin (50 μg / mL) and cultured at 37 ° C. until A ₆₀₀ = 0.6, followed by isopropyl-D-thiogalactopyrano. Side (IPTG) was added to a total concentration of 0.5 mM and incubated at 30 ° C. for 12 hours. Then, E. coli was separated by centrifugation (4,000 X g, 20 minutes), and then dissolved in 10 mL Lysis buffer (50 mM NaH ₂ PO ₄ , 300 mM NaCl, 10 mM Imidazole, pH 8.0), and then ground by ultrasonication. Subsequently, insoluble proteins were removed by centrifugation (10,000 X g, 30 minutes), water soluble proteins were separated, and the metase protein was purified using affinity chromatography using a histidine label contained in the recombinant protein, followed by SDS-PAGE. Check the size of 70kDa. Zymogram confirmed the activity of the metase. PAGE gel containing 0.2% galactomannan LBG (locust bean gum) was lowered, incubated in 0.1 M succinic acid buffer (pH 6.3) containing 1 mM dithiothreitol and 10 mM CaCl ₂ at room temperature for 2 hours, and then 0.1% congo. Stained with red and washed with 1M NaCl. SDS-PAGE and Zymogram are shown in FIG.

Example  4: Mannanase  Enzyme Activity Assay

Enzyme activity analysis was determined by adding 1% substrate in acetic acid buffer (pH 7.0) and incubating for 2 hours at 40 ° C. Enzyme activity was complete | finished by heating for 5 minutes. The amount of reducing sugar was measured using the DNS method. Protein concentration was measured using a protein assay kit (Bio-Rad, USA) based on the Bradford's method. Substrate specificity of the metase is shown in FIG. 6.

Example 5: Mini-azepin met for it to fertilizing blood and Assembly of Endoglucanase E

Enzyme complexes are made using the coheron domains attached to the mini-SB and the dockerin modules present in cellulose-forming enzymes. Mini-Sivipiee and endoglucanase E required for cellulosome assembly are based on the vector used by Murashima, and expression and purification in E. coli BL21 follows the method used by Murashima. The assembly of mannanase and endoglucanase E into mini-Sivipiea follows Murashima method (Murashima et al. al . J Bacteriol 184 (2002) 5088-5095). Mini-Sivi Pa. (5.0 mnol) and mannase, and mini-Sivi Pa. (5.0 mnol) and endoglucanase E (10.0 nmol) were added to 100ul binding buffer (25 mM sodium acetate buffer [pH 6.0], 15 mM). Mix with CaCl ₂ and incubate for 1 hour at 4 ° C. and confirm the assembled complex (mannanase and mini-cibiA, endoglucanase E and mini-SiviP A) through native PAGE. 7 is shown.

Example  6: To galactomannan  Measure synergy

Determination of the activity of each of the assembled enzymes was carried out using a mixture of 100 ul of the metnase and mini-cibiP complex and endoglucanase E and mini-cibiP complex (0.5% substrate, 50 mM sodium acetate buffer [pH 7.0]). It was confirmed at. After the incubation of the mannase and mini-cibiP complex and the endoglucanase E and mini-cibiP complex for 4 hours at 37 ° C., the reducing sugar was measured by DNS method. The concentration of each enzyme was measured at 2 nmol / ml. As a result, synergistic effects were observed in galactomannan LBG and guar gum. In LBG, the maximum synergistic effect was found to be 2.4-fold when the ratio of metase, mini-cibiP complex and endoglucanase E, and mini-cibiP complex was 2: 1, and guar gum was used as a substrate. The maximum synergistic effect was found to be 2.8 times at 3: 1 ratio. The synergistic effect on galactomannan is shown in FIG. 8.

Korea Microorganism Conservation Center (overseas) KCCM11161P 20110107

<110> KOREAN UNIVERSITY RESEARCH AND BUSINESS FOUNDATION <120> Identification of Mannanase from Clostridium cellulovorans and          application of cellulosome complex for hydrolysis of          galactomannan <160> 4 <170> Kopatentin 1.71 <210> 1 <211> 657 <212> PRT <213> Clostridium cellulovorans <400> 1 Met Lys Lys Ile Phe Gly Arg Ala Met Ser Leu Leu Ala Thr Phe Ala   1 5 10 15 Leu Val Cys Ser Phe Phe Val Ala Met Pro Thr Thr Pro Val Lys Ala              20 25 30 Glu Thr Ser Leu Pro Val Lys Val Glu Ala Glu Ala Cys Thr Leu Ser          35 40 45 Asn Gly Ala Ala Val Thr Thr Asn Val Tyr Gly Thr Asn Tyr Pro Gly      50 55 60 Tyr Ser Gly Asn Gly Phe Val Trp Ala Ser Asn Ser Gly Thr Ile Thr  65 70 75 80 Phe Asn Val Thr Val Pro Lys Asn Gly Met Tyr Glu Ile Ser Ser Arg                  85 90 95 Cys Trp Met Tyr Leu Gly Asn Val Gly Asp Thr Arg Leu Gln Val Leu             100 105 110 Ser Ile Asn Gly Ala Ala Gln Gly Asn Phe Tyr Val Pro Asn Lys Gly         115 120 125 Gly Trp Ala Asp Tyr Ser Phe Gly Tyr Phe Tyr Leu Glu Ala Gly Thr     130 135 140 Ala Lys Ile Glu Ile Gly Ser Ser Gly Ser Trp Gly Phe Ile Leu Tyr 145 150 155 160 Asp Thr Val Thr Phe Asp Asn Ala Lys Met Pro Ala Leu Lys Ala Asp                 165 170 175 Pro Thr Pro Cys Asp Val Asn Ala Thr Ser Glu Thr Lys Asn Leu Lys             180 185 190 Gln Tyr Leu Thr Ser Val Tyr Gly Asn His Val Ile Ser Gly Gln Gln         195 200 205 Glu Ile Tyr Gly Gly Gly Asn Asp Gly Asn Ala Glu Leu Glu Phe Asp     210 215 220 Tyr Ile Tyr Asn Lys Thr Gly Lys Tyr Pro Ala Ile Arg Gly Phe Asp 225 230 235 240 Phe Met Asn Tyr Asn Pro Leu Tyr Gly Trp Glu Asp Gly Thr Thr Asn                 245 250 255 Arg Met Ile Lys Trp Val Lys Glu Arg Gly Gly Ile Ala Thr Ala Ser             260 265 270 Trp His Ile Asn Val Pro Ser Asp Phe Thr Asn Tyr Lys Leu Gly Asp         275 280 285 Lys Leu Asp Trp Lys Ser Cys Thr Tyr Lys Pro Thr Ala Ser Phe Lys     290 295 300 Thr Ala Asn Cys Leu Asp Lys Thr Ser Lys Glu Tyr Ala Tyr Leu Met 305 310 315 320 Leu Ala Val Asp Asp Leu Ala Lys Gln Leu Leu Ile Leu Gln Asp Ala                 325 330 335 Lys Val Pro Val Leu Leu Arg Pro Phe His Glu Ala Glu Gly Asn Asn             340 345 350 Asn Thr Asn Gly Ser Gly Ala Trp Phe Trp Trp Gly Ser Gly Gly Ala         355 360 365 Asp Val Tyr Lys Gln Leu Trp Lys Leu Leu Tyr Ser Thr Leu Thr Glu     370 375 380 Lys Tyr Gly Ile His Asn Val Ile Trp Glu Val Asn Leu Tyr Ser Tyr 385 390 395 400 Ala Asn Ser Ala Gln Trp Tyr Pro Gly Asp Asp Cys Val Asp Ile Val                 405 410 415 Gly Tyr Asp Lys Tyr Glu Gly Ser Pro Tyr Thr Trp Lys Thr Ser Ala             420 425 430 Ala Thr Ser Val Phe Leu Thr Leu Val Asn His Thr Asn Asp Thr Lys         435 440 445 Met Val Ala Leu Thr Glu Asn Asp Val Ile Pro Asp Ile Gln Asn Ile     450 455 460 Val Asn Gln Gly Ala Trp Trp Leu Tyr Phe Cys Pro Trp Tyr Gly Asp 465 470 475 480 Phe Ile Thr Ser Ser Thr Tyr Asn Asp Pro Val Leu Leu Lys Thr Thr                 485 490 495 Tyr Asn Ser Pro Tyr Val Val Thr Leu Asp Glu Leu Pro Lys Asp Leu             500 505 510 Tyr Ala Ser Ser Ser Ly Lys Val Gln Ala Pro Thr Leu Ser Val Lys Glu         515 520 525 Gly Thr Tyr Ser Val Thr Gln Thr Val Ala Leu Ser Ser Ala Thr Glu     530 535 540 Gly Ala Thr Ile Tyr Tyr Thr Leu Asp Gly Thr Glu Pro Thr Val Ala 545 550 555 560 Ser Thr Val Tyr Asp Lys Pro Ile Glu Val Ala Lys Thr Thr Thr Ile                 565 570 575 Lys Ala Ile Ala Ile Lys Ala Gly Leu Thr Asn Ser Asp Val Val Thr             580 585 590 Ala Thr Tyr Thr Ile Ser Val Ser Met Leu Gly Asp Val Asn Asn Asp         595 600 605 Gly Lys Val Asn Ala Ile Asp Tyr Ala Met Val Lys Ser Tyr Leu Leu     610 615 620 Gly Asn Pro Val Thr Ile Asn Leu Lys Asn Ala Asp Leu Asn Ser Asp 625 630 635 640 Gly Lys Ile Asn Ala Ile Asp Leu Ala Ser Ile Lys Lys Ile Leu Leu                 645 650 655 Ser     <210> 2 <211> 1971 <212> DNA <213> Clostridium cellulovorans <400> 2 atgaaaaaaa ttttcggcag agcgatgtct ctgttggcaa cgtttgcatt ggtatgttcg 60 tttttcgtgg caatgccaac aacgccagtt aaagctgaaa cttctttgcc tgtaaaggtc 120 gaagcggaag cttgtactct tagtaacggt gctgctgtta ctacaaatgt ctacggaact 180 aactatccag gttattctgg caatggattt gtgtgggcat ctaattcagg gacaataaca 240 tttaatgtta cagttcctaa aaatggtatg tatgagattt catcaagatg ctggatgtat 300 cttggaaatg tcggggacac aagacttcaa gtgcttagca tcaatggtgc agcacaaggc 360 aatttctacg ttccaaacaa aggtggctgg gctgattaca gctttggata cttctatctt 420 gaagcaggta cagctaaaat tgagattgga tcatctggaa gctggggctt catactgtat 480 gatacagtaa catttgacaa tgctaaaatg ccagctctta aggctgaccc aactccatgt 540 gatgtaaatg caacttcaga aacaaagaac ttaaaacaat atcttactag cgtttatggc 600 aatcatgtta tttctggcca acaagaaatt tatggtggcg gaaatgacgg taatgcagaa 660 cttgaatttg attacattta taataagaca ggcaaatacc ctgcaattag aggctttgat 720 tttatgaact acaatcctct atacggatgg gaagacggta caacaaaccg tatgattaag 780 tgggttaaag aacgtggtgg tattgcaact gcatcttggc atatcaacgt accatctgat 840 tttacaaact ataagttagg tgataaatta gattggaaaa gttgtacata caagcctact 900 gctagtttta aaacagctaa ctgtcttgat aaaacatcaa aagaatacgc ttatttaatg 960 cttgcagttg atgaccttgc aaagcaatta ctaattcttc aagatgcaaa agttcctgta 1020 cttttacgtc ctttccatga agcagaaggt aataacaata caaatggttc aggagcatgg 1080 ttctggtggg gttctggcgg tgctgatgtg tacaagcaac tttggaaact tctttattca 1140 accctaacag aaaagtacgg tatccataat gtaatatggg aagtaaatct ttattcttat 1200 gcaaattcag ctcaatggta tccaggagat gattgtgtag atatcgttgg atatgataag 1260 tatgaaggct caccttacac ttggaaaaca agtgctgcaa catcagtatt tttgacactt 1320 gtaaatcata caaatgatac aaagatggtt gcattaactg aaaatgatgt tatacctgac 1380 attcagaata tagttaatca aggagcttgg tggttgtatt tctgtccatg gtatggtgat 1440 ttcattacta gttcaactta taatgatcct gtacttctta aaactaccta caatagccca 1500 tatgtagtta ctttagatga attaccaaaa gatctttatg catcttcttc taaagttcaa 1560 gcaccaactt taagtgttaa agaaggtaca tatagtgtta ctcaaacagt agctcttagc 1620 agtgcaacag aaggagcaac tatttattat actcttgatg gaactgagcc tactgttgca 1680 tctactgtat atgataagcc aatagaagta gctaaaacta caactatcaa agctattgca 1740 attaaagctg ggctgacaaa ttcagacgta gttactgcta cttatacaat ttcagtttct 1800 atgcttggtg atgttaacaa cgatggcaaa gttaatgcaa tagattatgc aatggtaaaa 1860 agttatttac ttggaaatcc agtgactata aatctaaaaa atgcagactt aaatagtgat 1920 ggtaagataa atgctattga cctagcatct ataaagaaga tattacttag c 1971 <210> 3 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 ggatccgatg aaaaaaattt tcggcagagc gatg 34 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gaattcgagc taagtaatat cttct 25

Claims (12)

delete delete delete delete delete delete delete delete (a) a mannanase isolated from Clostridium cellulovorans having the amino acid sequence of SEQ ID NO: 1 and a mini sibipie complex, a cellulosome complex forming protein, and (b) endoglucana Wood-based biomass comprising the step of treating a mixture of Aze E and a cellulosome complex-forming protein mini sibi P complex in a ratio of 1: 1-3: 1 to wood-based biomass including galactomannan Decomposition method. (a) a mannanase isolated from Clostridium cellulovorans having the amino acid sequence of SEQ ID NO: 1 and a mini sibipie complex, a cellulosome complex forming protein, and (b) endoglucana Wood-based biomass comprising the step of treating a mixture of Aze E and a cellulosome complex-forming protein mini sibi P complex in a ratio of 1: 1-3: 1 to wood-based biomass including galactomannan Party conversion method. (a) a mannanase isolated from Clostridium cellulovorans having the amino acid sequence of SEQ ID NO: 1 and a mini sibipie complex, a cellulosome complex forming protein, and (b) endoglucana A composition for the biomass degradation of wood-based biomass comprising galactomannan comprising a mixture of Aze E and a mini sibiP complex which is a cellulosome complex forming protein in a ratio of 1: 1 to 3: 1. (a) a mannanase isolated from Clostridium cellulovorans having the amino acid sequence of SEQ ID NO: 1 and a mini sibipie complex, a cellulosome complex forming protein, and (b) endoglucana Composition for converting wood-based biomass sugar comprising galactomannan comprising a mixture of Aze E and a mini-SB C complex which is a cellulosome complex forming protein in a ratio of 1: 1 to 3: 1.

Images