CN107881202B - Biological preparation method of key chiral intermediate of levonorgestrel - Google Patents

Abstract

The invention discloses a biological preparation method of a key chiral intermediate of levonorgestrel, which comprises the steps of taking wet thalli obtained by fermenting and culturing geotrichum candidum ZJPH1704 as an enzyme source, taking an ethyl condensation compound as a substrate, taking a phosphate buffer solution with the pH value of 5.8-8.0 as a reaction medium to form a reaction system, carrying out reaction at the temperature of 30-40 ℃ and the speed of 150-250 rpm, and after the reaction is finished, separating and purifying the reaction solution to obtain the key chiral intermediate of levonorgestrel; the intermediate is prepared by adopting the geotrichum candidum ZJPH1704 strain for catalytic reduction, and the method has the advantages of high substrate concentration for catalytic reduction, good stereoselectivity and the like. When the substrate concentration was 7.0g/L (22.4mM), the yield was 73%, and the ee value was 100%.

Description

A kind of biological preparation method of levonorgestrel key chiral intermediate

(1) Technical field

The invention relates to a method for preparing a key chiral intermediate of levonorgestrel by bioreduction of Geotrichum candidum ZJPH1704 strain.

(2) Background technology

Ethyl condensate (chemical name: 2-[2-(3,4-dihydro-6-methoxy-1(2H)-naphthylidene)ethyl]-2-ethylcyclopentane-1, Structural formula of 3-diketone, CAS number: 850-92-0):

Ethyl Hydroxide (chemical name: 2-ethyl-3-hydroxy-2-[2-(6-methoxy-3,4-dihydro-1(2H)-naphthalene)ethyl]cyclopentane Ketone, CAS number: 51773-49-0) structural formula:

Ethyl Hydroxylate is used in the synthesis of progestin drugs levonorgestrel (chemical name: D(-)-17α-ethynyl-17β-hydroxy-18-methylestr-4-en-3-one) The key chiral intermediate, the drug mainly acts on the hypothalamus and pituitary gland, has good progesterone activity, and has a strong ability to bind to androgen receptors. Combined with estrogen, it can be used as short-acting and long-acting oral contraceptives, and is currently the most widely used second-generation oral contraceptives. It can also be used to treat irregular menstruation, functional uterine bleeding and endometriosis.

Levonorgestrel is the biologically active L-form of the racemic norgestrel. The existing chemical synthesis method uses sodium borohydride as a reducing agent to reduce the ethyl condensate to an ethyl hydroxide, and four isomers are produced during the reaction, the stereoselectivity is not ideal, and the catalyst pollutes the environment; Martina et al. used oxazaborolidine as a catalyst and added 6.5 mM of ethyl condensate substrate, the yields were 25%-30%, and the e.e. value was 75%.

The intermediate is prepared by the bioreduction method catalyzed by microbial whole cells, which has the characteristics of mild reaction conditions, high stereoselectivity, and environmental friendliness. In addition, the biocatalyst is a microbial cell, which can be produced by self-fermentation, with stable quality and low cost.

Federica et al. (Catalysis Communications, 2017(93): 29-32) used a continuous packed-bed flow reactor to treat ketoreductase (KDE1-Pglu) from Pichia pastoris and glucose dehydrogenase (BmGDH) from Bacillus megaterium with Aldehyde-activated agarose was immobilized to achieve co-expression, and 6.5 mM ethyl condensate was added as a substrate, and the conversion rate was 62-63%. Martina et al. (Eur.J.Org.Chem.2016, 1260-1263) used recombinant KRED1-Pglu, added 6.5mM ethyl condensate substrate, added ethanol and glucose as auxiliary substrates, and had high stereoselectivity (> 98% e.e.), the yield was 65% after 6 h of reaction. When Saccharomyces cerevisiae was used as a catalyst, 10 mM of ethyl condensate substrate was added, and the yield was 87% after 24 hours of reaction.

(3) Contents of the invention

The purpose of the present invention is to provide a method for preparing the key chiral intermediate of levonorgestrel by utilizing the bio-asymmetric reduction of Geotrichum candidum ZJPH1704 strain. The method has high stereoselectivity, low cost, mild reaction conditions, environmental friendliness and easy industrialization.

The technical scheme adopted in the present invention is:

The invention provides a biological preparation method for a key chiral intermediate of levonorgestrel. The method uses the wet thalli obtained by fermentation and culture of Geotrichum candidum ZJPH1704 as an enzyme source, and the method is represented by formula (III) The ethyl condensate is used as the substrate, and the reaction system is formed with pH 5.8-8.0 (preferably 7.0) and 0.05-0.2M (preferably 0.1M) phosphate buffer as the reaction medium, and the reaction system is heated at 30-40° C., 150-250 rpm (preferably 30° C. , 200rpm) for 12-72h (preferably 72h), after the reaction, the reaction solution was separated and purified to obtain the key chiral intermediate of levonorgestrel shown in formula (IV); the Geotrichum candidum (Geotrichum candidum) ) ZJPH1704 strain, preserved in China Center for Type Culture Collection, preservation number: CCTCC NO: M 2017380, preservation date: June 26, 2017, preservation address is Wuhan University, China, zip code 430072;

Further, the amount of the substrate is 4-7.5 g/L (preferably 7 g/L) in terms of buffer volume, and the amount of wet cells is 200-500 g/L (preferably 300 g/L) in terms of buffer volume.

Further, the reaction system also contains an auxiliary substrate, and the auxiliary substrate is one of the following: glucose, maltose, sucrose, lactose, methanol, isopropanol, glycerol, L-alanine, or L-cysteine amino acid, preferably glycerol.

Further, when the auxiliary substrate is glucose, maltose, sucrose, lactose, glycerol, L-alanine, and L-cysteine, the amount of the auxiliary substrate is 10-300 g/L in terms of buffer volume. In the case of methanol or isopropanol, the volume usage is 10-50% based on the volume of the buffer. Preferably, when the auxiliary substrate is glucose, sucrose, maltose and lactose, the addition amount is 100 g/L buffer; when the auxiliary substrate is glycerol, the addition amount is 60 g/L buffer; when the auxiliary substrate is methanol or isopropanol, The added volume concentration is 10-30%. When the auxiliary substrate is L-cysteine and L-alanine, the added amount is 10 g/L buffer. Preferably, the auxiliary substrate is glycerol, and the dosage is 60 g/L buffer.

Further, a co-solvent is also added to the reaction medium, and the co-solvent is one of the following: (1) 37° C. preheated ethanol (the ethanol is an ethanol reagent with a volume content of 95%); (2) dimethyl methylene sulfone.

Further, the volume addition amount of the cosolvent is 0.5-20% (preferably 7%) based on the volume of the buffer. Further, the enzyme source is prepared as follows: (1) slant culture: inoculate Geotrichum candidum ZJPH1704 into slant medium, and culture at 25-30°C (preferably 30°C) for 1-2 days to obtain slant strain; slant medium The final concentration composition is: glucose 15g/L, peptone 7.5g/L, yeast extract 6g/L, (NH ₄ ) ₂ SO ₄ 3g/L, KH ₂ PO ₄ 1.5g/L, NaCl 0.75g/L, MgSO ₄ 7H ₂ O 0.75g/L, agar powder 15～20g/L (preferably 20g/L), the solvent is distilled water, pH 6.5;

(2) Seed culture: inoculate the slanted strain into the seed medium, the filling volume is 100ml of seed medium per 250ml shake flask, and culture at 25-30°C and 150-250rpm for 10-24h (preferably at 30°C and 200rpm for 12h). ) to obtain seed liquid; the final concentration of seed medium is composed of: glucose 15g/L, peptone 20g/L, yeast extract 10g/L, (NH ₄ ) ₂ SO ₄ 2g/L, KH ₂ PO ₄ 2g/L, NaCl 1g/L, MgSO ₄ ·7H ₂ O 0.5g/L, the solvent is distilled water, pH 6.5;

(3) Fermentation culture: inoculate the seed liquid with an inoculation amount of 4-10% (preferably 10%) by volume concentration into the fermentation medium, the filling amount is 70mL/250mL shake flask, 25-30 ℃, 150- Culture at 250rpm for 24-28h (preferably at 30°C, culture at 200rpm for 24h), after fermentation, centrifuge the fermentation broth, wash the resulting precipitate with 0.1M, pH 6.5 buffer, and collect wet cells, which are the enzyme source; the fermentation culture The final concentration of the base is composed of: glucose 24.45 g/L, peptone 15.75 g/L, (NH ₄ ) ₂ SO ₄ 21.39 g/L, CaCl ₂ 1 mmol/L, and the solvent is distilled water, pH 6.5.

After the transformation reaction, the transformation solution was extracted twice with an equal volume of ethyl acetate, the extracts were combined, and the solvent was evaporated with a rotary evaporator. The obtained concentrated solution was dissolved in anhydrous methanol, and the content of product and residual substrate was detected by thin plate chromatography (TLC) or high performance liquid chromatography (HPLC).

Thin-plate chromatography detection: use a capillary to draw a certain amount of the sample to be detected, the ethyl condensate substrate standard, and the ethyl hydroxide product standard, respectively, and spot them on a pre-activated silica gel plate, and the developing solvent is ethyl acetate /Petroleum ether (3/7(v/v)), develop color at 254nm, and observe whether there is a conversion product in the sample.

Compared with the prior art, the beneficial effects of the present invention are mainly reflected in: the present invention provides a method for preparing levonorgestrel by catalytic asymmetric reduction of microorganisms, and the intermediate is prepared by catalytic reduction of Geotrichum candidum ZJPH1704 strain, which has catalytic effect. The reduced substrate concentration is high and the stereoselectivity is good. When the substrate concentration was 7.0 g/L (22.4 mM), the yield was 73% and the e.e. value was 100%.

(4) Description of drawings

Figure 1 shows the plate colony morphology of Geotrichum candidum ZJPH1704 in Example 1.

Fig. 2 is a scanning electron microscope photograph of cells of Geotrichum albicans ZJPH1704 in Example 1, 500 times.

Fig. 3 is a scanning electron microscope photograph of cells of Geotrichum albicans ZJPH1704 in Example 1, 10,000 times.

Figure 4 is the GC chromatographic detection pattern (including internal standard n-dodecane) of the product (S)-1-(2,6-dichloro-3-fluorophenyl)ethanol (I-a) of Example 1.

Figure 5 is the GC chromatographic detection pattern of the substrate 2,6-dichloro-3-fluoroacetophenone (II) in Example 1 (including internal standard n-dodecane).

Figure 6 shows the racemates of the products of Example 1, namely (S)-1-(2,6-dichloro-3-fluorophenyl)ethanol (I-a) and (R)-1-(2,6-dichloromethane) GC chromatographic detection pattern of the mixture (1:1) of chloro-3-fluorophenyl)ethanol (I-b) (with internal standard n-dodecane).

Figure 7 is the GC chromatographic detection pattern (including internal standard n-dodecane) of the transformed sample (ie the extract) of the bioreduction of 2,6-dichloro-3-fluoroacetophenone by Geotrichum candidum ZJPH1704 strain in Example 1.

Figure 8 is the HPLC chromatographic detection pattern of the standard substance of the substrate ethyl condensate (III) of Example 3.

Figure 9 is the HPLC chromatographic detection pattern of the ethyl hydroxide (IV) standard product of Example 3.

Fig. 10 is the HPLC chromatographic detection pattern of the bioreduced ethyl condensate transformed sample of Geotrichum albicans ZJPH1704 strain in Example 3.

(5) Specific implementation manner

The present invention is further described below in conjunction with specific embodiment, but the protection scope of the present invention is not limited to this:

The ethanol used in the embodiments of the present invention is an ethanol reagent with a volume content of 95% (purchased from Sinopharm Chemical Reagent Co., Ltd.).

Example 1: Screening of microbial strains for catalytic reduction of 2,6-dichloro-3-fluorophenylethanol

1. Strain screening

Enrichment culture: add 1g of fresh soil samples (soil samples collected on the campus of Zhejiang University of Technology (Hangzhou, Zhejiang)) into a 250mL shake flask containing 50mL of enrichment medium, cultivate at 30°C, 200rpm for 5 days, and take 1mL of culture The liquid was transferred to fresh enrichment medium, and the culture was continued for 5 d, and the enrichment was repeated twice. The enrichment medium consists of: (NH ₄ ) ₂ SO ₄ 2g/L, KH ₂ PO ₄ 2g/L, NaCl 1g/L, MgSO ₄ ·7H ₂ O 0.5g/L, the compound of formula (II) (2g/L) L) is the only carbon source, and the solvent is distilled water, pH 6.5.

Plate primary screening: The enriched culture medium was diluted 10 ⁴ -10 ⁶ times with physiological saline, then spread on the plate screening medium, and cultured at 30°C for 2 days. A single colony was picked and streaked again, and cultured at 30°C for 2 days. The purified strain ZJPH1704 was obtained after 2 streak isolation and culture, and was stored in solid slant medium. The final concentration of the plate selection medium is composed of: (NH ₄ ) ₂ SO ₄ 2g/L, KH ₂ PO ₄ 2g/L, NaCl 1g/L, MgSO ₄ 7H ₂ O 0.5g/L, 20g/L agar powder, The solvent was distilled water, pH 6.5. The final concentration of the slant medium is composed of: glucose 15g/L, peptone 7.5g/L, yeast extract 6g/L, (NH ₄ ) ₂ SO ₄ 3g/L, KH ₂ PO ₄ 1.5g/L, NaCl 0.75g/L , MgSO ₄ ·7H ₂ O 0.75g/L, agar powder 20g/L, the solvent is distilled water, pH 6.5.

Microbial culture and collection: pick purified seeds and inoculate them into seed medium, cultivate at 30°C, 200rpm for 10-24h, transfer to the initial fermentation medium at 10% (v/v) inoculum, 30°C, 200rpm Culture 24 ~ 48h. The fermentation broth was centrifuged at 4°C and 9000 rpm for 10 min, the supernatant was discarded, the cells were washed twice with pH 6.5 phosphate buffer, and centrifuged again to obtain resting cells. The final concentrations of the seed medium and the initial fermentation medium are: glucose 15g/L, peptone 20g/L, yeast extract 10g/L, (NH ₄ ) ₂ SO ₄ 3g/L, KH ₂ PO ₄ 1.5g/L, NaCl 0.75g/L, MgSO ₄ ·7H ₂ O 0.5g/L, the solvent is distilled water, pH 6.5.

Rescreening of strains: using resting microbial cells as enzyme source to catalyze the stereoselective reduction of substrate 2,6-dichloro-3-fluoroacetophenone (Ⅱ) to prepare (S)-type product (Ⅰ-a), reaction The system is as follows: 2g of resting cells (wet weight) are resuspended in 10mL of phosphate buffer (0.1M, pH 6.5), 1g/L of substrate is added, 100g/L of glycerol is used as an auxiliary substrate, and the reaction is performed at 40°C and 200rpm. 24h. After the reaction, the reaction solution was extracted with ethyl acetate, and the conversion product was detected by gas chromatography (GC) analysis. Compared with the racemic reduction product (I-a), it was observed whether formula (I-a) appeared in the biocatalytic sample. The reduction product peaked. Strain ZJPH1704 can reduce substrates to compounds of formula (I-a). The enantiomeric excess value (e.e. value) of the reduction product of the strain was detected by chiral GC method, and the e.e. value was >99.9%.

Qualitative and quantitative analysis by gas chromatography: Detect the content of products and residual substrates after the conversion reaction, and calculate the concentration of related substances, yield (Yield) and e.e. value.

In formula (1), C _i and C ₀ are the molar concentration of the product at the end of the reaction and the molar concentration of the substrate at the beginning of the reaction, respectively.

The optical purity of the product is characterized by the enantiomeric excess (e.e.).

In formula (2): C _S and C _R are (S)-1-(2,6-dichloro-3-fluorophenyl)ethanol and (R)-1-(2,6-dichloro-3 respectively) - Molar concentration of fluorophenyl)ethanol.

Gas chromatography conditions: The concentrations of products and residual substrates in the reaction extract were analyzed by gas chromatography and quantified by internal standard method. The internal standard is dodecane. Take 1 mL of the extract and add 1 μL of dodecane for analysis. Gas chromatography conditions: Japan Shimadzu GC-2014 gas chromatograph, Zhejiang University N2000 chromatography workstation; American Varian CP-Chirasil-Dex chiral capillary gas chromatography column (25m×0.25mm×0.25μm). The carrier gas is high-purity nitrogen, the flow rate is 2mL/min; the injection volume is 1μL, and the split ratio is 15:1; the temperature of the detector and the injection port are both 250℃; the column temperature is 120～170℃; the heating rate: 5℃ /min; detector is FID. Formula (I-a) product (S)-1-(2,6-dichloro-3-fluorophenyl)ethanol, formula (II) substrate 2,6-dichloro-3-fluoroacetophenone, formula (I-a)(S)-1-(2,6-dichloro-3-fluorophenyl) and formula (I-b)(R)-1-(2,6-dichloro-3-fluorobenzene The gas chromatogram of the transformed sample (ie the extract) of the bioreduction of 2,6-dichloro-3-fluoroacetophenone by strain ZJPH1704 is shown in Figures 4-7.

2. Identification of strains

Morphological characteristics, physiological and biochemical characteristics and ITS sequence of strain ZJPH1704:

① Morphological observation On the nutrient agar plate, the appearance, texture, color, growth rate and other characteristics of the colony of strain ZJPH1704 were observed, and the cell morphology was observed by scanning electron microscope. 30 ℃, cultured for 36h, the colonies on the nutrient agar plate spread flat, grow fast, flat, milky white, fluffy or almost powdery, with concentric circles that can be radiated, and some are central protrusions. In liquid culture, it is raw, fluffy or powdery. The coarse and larger colonies are shown in Figure 1; the cells of strain ZJPH1704 can be observed in the form of scattered and straight rods under the scanning electron microscope, as shown in Figures 2 and 3.

② The available carbon sources for physiological and biochemical properties are: glucose, D-xylose, galactose, but not sucrose, maltose, raffinose, lactose, arabinose, cellobiose, and melibiose. Can tolerate 0.01% and 0.1% cycloheximide, cannot assimilate nitrate and urea.

③Characteristic ITS sequence PCR amplification of fungal ribosomal ITS (Internal Transcribed Spacer) gene segment can identify fungi quickly, accurately and simply. The universal primers ITS1 and ITS4 were used to amplify the ITS region of the rDNA of ZJPH1704 strain to generate a DNA fragment with a size of 349 bp. The above PCR amplification products were sequenced. After determination, the fungal ribosomal ITS (Internal Transcribed Spacer) gene sequence (SEQ ID NO. 1) of the ZJPH1704 strain is as follows:

CCTGCGGAAGGATCATTAAGAATTATAAATATTTGTGAAATTTACACAGCAAACAATAATTTTATAGTCAAAACAAAAATAATCAAAACTTTTAACAATGGATCTCTTGGTTCTCGTATCGATGAAGAACGCAGCGAAACGCGATATTTCTTGTGAATTGCAGAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCATTGCTTTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAAGCATATCAA

The sequence has been submitted to GenBank (GenBank accession number is No. MG214158), and the ITS sequence of strain ZJPH1704 was subjected to homology alignment (BLAST) on the NCBI website (http://www.ncbi.nlm.nih.gov), The results showed that strain ZJPH1704 had high sequence homology with some strains of Geotrichum sp., and had 100% sequence homology with strain Geotrichum candidum CBS:11628 (GenBank accession No. KY103456.1). . Therefore, the strain ZJPH1704 is named as Geotrichum candidum ZJPH1704, which is deposited in the China Center for Type Culture Collection, preservation number: CCTCC NO: M 2017380, preservation date: June 26, 2017, preservation address is Wuhan, China, Wuhan University, 430072.

Example 2: Catalyst preparation for biological reduction of ethyl condensate

1) Slant culture: Inoculate Geotrichum candidum ZJPH1704 into slant medium, culture at 30°C for 1-2 days, and store in a refrigerator at 4°C. Slant medium formula: glucose 15g/L, peptone 7.5g/L, yeast extract 6g/L, (NH ₄ ) ₂ SO ₄ 3g/L, KH ₂ PO ₄ 1.5g/L, NaCl 0.75g/L, MgSO ₄ ·7H ₂ O 0.75g/L, agar 20g/L, the solvent is distilled water, pH 6.5.

2) Seed culture: pick a ring of thalli from the cultured mature slant and insert it into a 250ml shake flask containing 100ml of seed medium, and cultivate at 30°C and 200rpm for 12h to obtain a seed solution. Seed medium formula: glucose 15g/L, peptone 20g/L, yeast extract 10g/L, (NH ₄ ) ₂ SO ₄ 2g/L, KH ₂ PO ₄ 2g/L, NaCl 1g/L, MgSO ₄ 7H ₂ O0.5g/L, the solvent is distilled water, pH 6.5.

3) Fermentation culture: transfer the seed liquid to a 250ml shake flask containing 70ml of fermentation medium with an inoculation amount of 7% by volume, cultivate at 30° C., 200rpm shaker for 24h, after the fermentation is completed, centrifuge the fermentation broth to obtain The pellet was washed with 0.1 M, pH 6.5 phosphate buffer, and the wet cells were collected. The final concentration of the fermentation medium is composed of: glucose 24.45 g/L, peptone 15.75 g/L, (NH ₄ ) ₂ SO ₄ 21.39 g/L, CaCl ₂ 1 mmol/L, and the solvent is distilled water, pH 6.5.

Example 3 Preparation of Ethyl Hydroxide by Bioreduction of Geotrichum candidum ZJPH1704

3 g of Geotrichum candidum ZJPH1704 wet cells obtained by the method of Example 2 were suspended in 10ml, 0.1M, pH 6.5 phosphate buffer, the wet cell was 300g/L by wet weight, and the final concentration of 7.5g was added. /L of the ethyl condensate represented by formula (III) as the substrate, 30 ° C, 200 rpm shaking culture for 72 hours, TLC tracking detection, after the reaction, centrifuge the reaction solution, take the supernatant, add an equal volume of ethyl acetate The ester was extracted twice, the extracts were combined, and the solvent was evaporated on a rotary evaporator. The obtained concentrated solution was dissolved in anhydrous methanol and detected by HPLC, as shown in Figure 10. The liquid chromatograms of the substrate ethyl condensate III (Fig. 8) and the product ethyl hydroxylate IV standard (Fig. 9) were simultaneously detected, and the calculated yield was 11%.

Thin-layer chromatography detection: use a capillary spotting tube to draw a certain amount of bioreductive transformation sample, ethyl condensate substrate III standard, ethyl hydroxyl product IV standard, and spot them on pre-activated silica gel thin layer plates. On the above, ethyl acetate/petroleum ether (3/7 (v/v)) was used as the developing solvent, and the color was developed at 254 nm. Observe the sample for the presence of conversion products.

High performance liquid chromatography analysis: All samples were filtered with 0.45 μm microporous membrane before injection and detection, and then the concentration of product and residual substrate in the reaction solution was detected. Liquid chromatography conditions: Agilent 1260 liquid chromatograph, Agilent liquid chromatography workstation, chromatographic column Luna 5u C ₁₈ (2) 100A (250×4.6mm), flow rate: 1.0ml/min, injection volume: 20μL, column Temperature: room temperature, detection wavelength: 266 nm, mobile phase: acetonitrile-water (v/v), gradient elution, elution conditions are shown in Table 1.

The calculation formula of product yield is: yield=C _i /C ₀ ×100%

In the formula, C ₀ and C _i are the molar concentration of the reaction starting substrate and the molar concentration of the product at the end of the reaction, respectively.

Table 1 HPLC gradient elution conditions

Example 4 The effect of auxiliary substrate species on the bioreduction of Geotrichum candidum ZJPH1704 to prepare ethyl hydroxide

3 g of Geotrichum candidum ZJPH1704 wet cells obtained by the method of Example 2 were suspended in 10ml, 0.1M, pH 6.5 phosphate buffer, the wet cell was 300g/L by wet weight, and the final concentration of 7.5g was added. /L ethyl condensate as the substrate (dissolve with 37°C hot ethanol first, where the final concentration of ethanol added is 7% by volume, that is, the addition amount is 0.7ml), respectively, add glucose with a final concentration of 100g/L, 100g/L sucrose , 100g/L maltose, 100g/L lactose, 60g/L glycerol, 10% methanol by volume, 30% isopropanol by volume, 10g/L L-cysteine and 10g/L L-alanine Acid as an auxiliary substrate, 30 ° C, 200 rpm shaking culture for 72 h, thin layer chromatography tracking detection, after the reaction, centrifuge the reaction solution, take the supernatant, add equal volume of ethyl acetate to extract twice, combine the extracts, use The solvent was evaporated on a rotary evaporator. The obtained concentrated solution is detected after dissolving with anhydrous methanol, the detection method is shown in Example 3, and the results are shown in Table 2.

Table 2 Influence of auxiliary substrates on the yield of ethyl hydroxide products

serial number Auxiliary substrates and concentrations Product yield (%) 1 100g/L glucose 14.9 2 100g/L sucrose 12.1 3 100g/L maltose 13.2 4 100g/L lactose 13.8 5 60g/L glycerin 48.0 6 10% methanol 14.5 7 30% isopropyl alcohol 5.8 8 10g/L L-cysteine 13.5 9 10g/L L-alanine 12.9 10 Control (no auxiliary substrate added) 20.5

Conclusion: It can be seen from Table 2 that the preferred auxiliary substrate is glycerol, and the yield of the product is 48%.

Example 5 The effect of glucose and glycerol double auxiliary substrates on the bioreduction of Geotrichum candidum ZJPH1704 to prepare ethyl hydroxide

3g of Geotrichum candidum ZJPH1704 wet cells obtained by the method of Example 2 were suspended in 10ml, 0.1M, pH 6.5 phosphate buffer solution, and the final concentration of wet cells was 300g/L by wet weight. The concentration of 7.5g/L ethyl condensate is used as the substrate (dissolve with 37 ℃ hot ethanol first, and the volume of ethanol is 7%, that is, the addition amount is 0.7ml), add the final concentration of 60g/L glycerol and the final concentration of 100g/ L glucose was used as an auxiliary substrate and incubated at 30°C and 200rpm for 72h. After the reaction, the reaction solution was centrifuged, the supernatant was taken, and an equal volume of ethyl acetate was added for extraction twice. The extracts were combined and evaporated with a rotary evaporator. solvent. The obtained concentrated solution was dissolved in anhydrous methanol and detected. The detection method was shown in Example 3, and the yield was 15%. Thus, the dual co-substrates glycerol and glucose are not suitable for this substrate conversion.

Example 6 The effect of auxiliary substrate addition on the preparation of ethyl hydroxide by bioreduction of Geotrichum candidum ZJPH1704

Suspend 3g of the ground mold ZJPH1704 wet thalli obtained by the method of Example 2 in 10ml, 0.1M, pH 6.5 phosphate buffer, the wet thalline is 300g/L by wet weight, and the final concentration of 7.5g/L is added. L ethyl condensate is the substrate (dissolve with hot ethanol at 37°C first, where the volume of ethanol is 7%, that is, the addition amount is 0.7ml), and the final concentrations of 30g/L, 40g/L, 50g/L, 60g/L, 70g/L, and 80g/L glycerol were used as auxiliary substrates, and were incubated at 30°C and 200rpm for 72h. After the reaction, the reaction solution was centrifuged, the supernatant was taken, and an equal volume of ethyl acetate was added to extract twice. The extracts were combined and the solvent was evaporated on a rotary evaporator. The obtained concentrated solution is detected after dissolving with anhydrous methanol, the detection method is shown in Example 3, and the results are shown in Table 3.

Table 3 Influence of the amount of auxiliary substrate glycerol on the yield of ethyl hydroxylate products

serial number Amount of Glycerol (g/L) Product yield (%) 1 30 10.0 2 40 25.0 3 50 33.0 4 60 48.0 5 70 43.0 6 80 39.0

Conclusion: It can be seen from Table 3 that the preferred glycerol auxiliary substrate dosage is 60 g/L, and the product yield is 48%.

Example 7 Influence of transformation temperature on bioreduction of Geotrichum candidum ZJPH1704 to prepare ethyl hydroxide

Suspend 3g of the ground mold ZJPH1704 wet cells obtained by the method of Example 2 in the phosphate buffer of 10ml, 0.1M, pH 6.5, and the wet cells have a final concentration of 300g/L by wet weight, and add a final concentration of 7.5g/L. L ethyl condensate was used as the substrate (dissolved in hot ethanol at 37°C, where the volume of ethanol was 7%, i.e., the added amount was 0.7ml), and glycerol with a final concentration of 60g/L was added as an auxiliary substrate, respectively at 30°C. , 34 ℃, 37 ℃, 40 ℃, 200rpm shaking culture for 72h, after the reaction, centrifuge the reaction solution, take the supernatant, add an equal volume of ethyl acetate to extract twice, combine the extracts, and use a rotary evaporator to evaporate the solvent . The obtained concentrated solution is detected after dissolving with anhydrous methanol, the detection method is shown in Example 3, and the results are shown in Table 4.

Table 4 Influence of temperature on the yield of ethyl hydroxide product

serial number Transformation temperature (℃) Product yield (%) 1 30 48.0 2 34 33.0 3 37 29.0 4 40 18.0

Conclusion: It can be seen from Table 4 that the optimal conversion temperature is 30°C, and under this condition, the product yield is 48%.

Example 8 Influence of buffer pH value on preparation of ethyl hydroxide by bioreduction of Geotrichum candidum ZJPH1704

3g of the wet cells of Geotrichum candidum ZJPH1704 obtained by the method of Example 2 were suspended in purified water and 0.1M and 10ml of phosphate buffer solution with pH of 5.8, 6.0, 6.5, 7.0, 7.5 and 8.0 respectively. The final concentration is 300g/L, and the ethyl condensate with a final concentration of 7.5/L is added as the substrate (dissolve with 37°C hot ethanol first, where the volume of ethanol is 7%, that is, the addition amount is 0.7ml), and the final concentration is added. 60 g/L glycerol was used as the auxiliary substrate, and the culture was shaken at 30 °C and 200 rpm for 72 h. After the reaction, the reaction solution was centrifuged, the supernatant was taken, and an equal volume of ethyl acetate was added to extract twice. Combine the extracts and use a rotary evaporator. The solvent was evaporated. The obtained concentrated solution is detected after dissolving with anhydrous methanol, the detection method is shown in Example 3, and the results are shown in Table 5.

Table 5 Influence of buffer pH value on the yield of ethyl hydroxide product

serial number buffer pH Product yield (%) 1 5.8 10.0 2 6.0 15.0 3 6.5 50.0 4 7.0 60.0 5 7.5 45.0 6 8.0 40.0 7 water 5.0

Conclusion: It can be seen from Table 5 that the pH value of the optimal buffer solution is 7.0, and the product yield is 60%.

Example 9 Influence of buffer ionic strength on preparation of ethyl hydroxide by bioreduction of Geotrichum candidum ZJPH1704

3g of the wet cells of Geotrichum candidum ZJPH1704 obtained by the method of Example 2 were respectively suspended in 10 ml of phosphate buffer with ionic strength of 0.05M, 0.1M, 0.15M, 0.2M, and pH 7.0. The wet cells were calculated by wet weight. The final concentration is 300g/L, and the final concentration of 7.5g/L ethyl condensate is added as the substrate (dissolve with 37°C hot ethanol first, where the volume of ethanol is 7%, that is, the addition amount is 0.7ml), and the final concentration is added. 60 g/L glycerol was used as an auxiliary substrate, and incubated at 30 °C and 200 rpm for 72 h. After the reaction, the reaction solution was centrifuged, the supernatant was taken, and an equal volume of ethyl acetate was added to extract twice. Combine the extracts and use a rotary evaporator. The solvent was evaporated. The obtained concentrated solution is detected after dissolving with anhydrous methanol, the detection method is shown in Example 3, and the results are shown in Table 6.

Table 6 Influence of buffer ionic strength on the yield of ethyl hydroxide product

serial number Buffer ionic strength (M) Product yield (%) 1 0.05 50.0 2 0.1 61.0 3 0.15 57.0 4 0.2 52.0

Conclusion: It can be seen from Table 6 that the optimal buffer ionic strength is 0.1M, and under this condition, the product yield is 61%.

Example 10 The effect of bacterial concentration on the preparation of ethyl hydroxide by bioreduction of Geotrichum candidum ZJPH1704

3g of the ground mold ZJPH1704 wet cells obtained by the method of Example 2 were suspended in 10ml, 0.1M, the phosphate buffer of pH 7.0, and the wet cells were respectively 200g/L, 300g/L, 400g/L by wet weight. L, 500g/L, add the final concentration of 7.5g/L ethyl condensate as the substrate (first dissolve in 37 ℃ hot ethanol, the volume of ethanol added is 7%, that is, the addition amount is 0.7ml), add the final concentration of 60g /L glycerol was used as an auxiliary substrate, and incubated at 30°C and 200rpm for 72h. After the reaction, the reaction solution was centrifuged, the supernatant was taken, and an equal volume of ethyl acetate was added for extraction twice. The extracts were combined and evaporated with a rotary evaporator. Remove solvent. The obtained concentrated solution is detected after dissolving with anhydrous methanol, the detection method is shown in Example 3, and the results are shown in Table 7.

Table 7 Influence of bacterial concentration on the yield of preparation of ethyl hydroxylate products

serial number Bacterial concentration (g/L) Product yield (%) 1 200 45.0 2 300 62.0 3 400 53.0 4 500 39.0

Conclusion: It can be seen from Table 7 that the optimal bacterial concentration is 300g/L, and under this condition, the product yield is 69%.

Example 11 Influence of substrate concentration on preparation of ethyl hydroxide by bioreduction of Geotrichum candidum ZJPH1704

Suspend 3 g of Geotrichum candidum ZJPH1704 wet cells obtained by the method of Example 2 in 10 ml, 0.1M, phosphate buffer of pH 7.0, and the wet cells are calculated with a final concentration of 300 g/L by wet weight, and the final concentration of 4 g/L is added respectively. , 4.5g/L, 5.0g/L, 5.5g/L, 6.0g/L, 6.5g/L, 7.0g/L, 7.5g/L ethyl condensate as the substrate (first dissolve with 37 ℃ hot ethanol , wherein the volume of ethanol is 7%, that is, the amount of ethanol added is 0.7 ml), and glycerol with a final concentration of 60 g/L is added as an auxiliary substrate, and the culture is shaken at 30 ° C and 200 rpm for 72 h. After the reaction, the reaction solution is centrifuged and the supernatant is taken. The solution was extracted twice by adding an equal volume of ethyl acetate, the extracts were combined, and the solvent was evaporated with a rotary evaporator. The obtained concentrated solution is detected after dissolving with anhydrous methanol, the detection method is shown in Example 3, and the results are shown in Table 8.

Table 8 Effect of substrate concentration on the yield of ethyl hydroxide product

serial number Substrate concentration (g/L) Product yield (%) 1 4.0 98.0 2 4.5 95.0 3 5.0 90.0 4 5.5 80.0 5 6.0 75.0 6 6.5 74.0 7 7.0 73.0 8 7.5 60.0

Conclusion: It can be seen from Table 8 that the optimal substrate concentration is 7.0 g/L, and under this condition, the product yield is 73%.

Example 12 The effect of transformation time on the preparation of ethyl hydroxide by bioreduction of Geotrichum candidum ZJPH1704

Suspend 3 g of Geotrichum candidum ZJPH1704 wet cells obtained by the method of Example 2 in 10 ml, 0.1M, pH 7.0 phosphate buffer, the wet cells are based on wet weight with a final concentration of 300 g/L, and add a final concentration of 7.0 g/L. The ethyl condensate was used as the substrate (dissolved in hot ethanol at 37°C, and the volume of ethanol added was 7%, i.e., the added amount was 0.7ml), and glycerol with a final concentration of 60g/L was added as an auxiliary substrate, at 30°C, 200rpm , shake and culture for 12h, 22h, 32h, 42h, 52h, 62h, 72h, respectively, after the reaction, centrifuge the reaction solution, take the supernatant, add an equal volume of ethyl acetate to extract twice, combine the extracts, and use a rotary evaporator to evaporate Remove solvent. The obtained concentrated solution is detected after dissolving with anhydrous methanol, the detection method is shown in Example 3, and the results are shown in Table 9.

The influence of table 9 conversion time on the yield of ethyl hydroxide product

serial number Conversion time (h) Product yield (%) 1 12 20.0 2 twenty two 40.0 3 32 50.0 4 42 60.0 5 52 65.0 6 62 68.0 7 72 73.0

Conclusion: It can be seen from Table 9 that the optimal conversion time is 72h, and under this condition, the product yield is 73%.

Example 13 The effect of cosolvent species on the preparation of ethyl hydroxide by bioreduction of Geotrichum candidum ZJPH1704

Suspend 3 g of Geotrichum candidum ZJPH1704 wet cells obtained by the method of Example 2 in 10 ml, 0.1M, pH 7.0 phosphate buffer, the wet cells are based on wet weight with a final concentration of 300 g/L, and add a final concentration of 7.0 g/L. The ethyl condensate is the substrate, and the substrate is first added with 37 ℃ hot ethanol and DMSO as a cosolvent to dissolve, wherein the volume of ethanol is 7% (that is, the volume of DMSO is 0.7ml), and the volume of DMSO is 20% (ie The addition amount is 2ml), and then add the final concentration of 60g/L glycerol as an auxiliary substrate, at 30 ° C, 200 rpm, shaking culture for 72 h, after the reaction is completed, the reaction solution is centrifuged, the supernatant is taken, and an equal volume of ethyl acetate is added for extraction. Twice, the extracts were combined and the solvent was evaporated on a rotary evaporator. The obtained concentrated solution is detected after dissolving with anhydrous methanol, the detection method is shown in Example 3, and the results are shown in Table 10.

Table 10 Influence of co-solvent types on the yield of ethyl hydroxylate products

serial number Types and dosages of cosolvents Product yield (%) 1 7% hot ethanol 73.0 2 20% DMSO 40.0 3 Control (without cosolvent) 25.0

Conclusion: It can be seen from Table 10 that the preferred co-solvent is ethanol, and under this condition, the product yield is 73%.

Example 14 The effect of co-solvent ethanol addition on the preparation of ethyl hydroxide by bioreduction of Geotrichum candidum ZJPH1704

Suspend 3g of the wet cells of Geotrichum candidum ZJPH1704 obtained by the method of Example 2 in 10ml, 0.1M, pH 7.0 phosphate buffer solution, the wet cells have a final concentration of 300g/L by wet weight, and add a final concentration of 7.0g/L ethyl acetate. The base condensate is the substrate, the substrate is first dissolved in hot ethanol at 37°C, and the volume of ethanol added is 0%, 3% (that is, 0.3 ml is added), 5% (that is, 0.5 ml is added), and 7% (that is, added 0.7ml), 8% (ie adding 0.8ml), 9% (ie adding 0.9ml), 10% (ie adding 1ml), 11% (ie adding 1.1ml). Then add the final concentration of 60g/L glycerol as an auxiliary substrate, and at 30 ℃, 200rpm, shaking culture for 72h, after the reaction, centrifuge the reaction solution, take the supernatant, add an equal volume of ethyl acetate to extract twice, and combine the extracts , and the solvent was evaporated with a rotary evaporator. The obtained concentrated solution was detected after dissolving with anhydrous methanol, the detection method was shown in Example 3, and the results were shown in Table 11.

Table 11 Influence of the amount of co-solvent added on the yield of ethyl hydroxide product

serial number Ethanol addition (%) Product yield (%) 1 0 25.0 2 3 32.0 3 5 43.0 4 7 73.0 5 8 38.0 6 9 31.0 7 10 11.0 8 11 8.0

Conclusion: It can be seen from Table 11 that the preferred ethanol addition amount is 7% of the final volume concentration, and the product yield is 73%.

Example 15 Investigation of the biotransformation activity of ethyl condensate by Rhizopus microspores var. rhizopodiformis ZJPH1308

(1) Rhizopus microspores var.rhizopodiformis ZJPH1308, deposited in the China Center for Type Culture Collection, the address is Wuhan University, Wuhan, China, zip code 430072, and the deposit number is CCTCC NO.M 2014645, deposited Date December 14, 2014, this strain has been disclosed in a previous patent application (application number 201510289729.X, application date June 1, 2015).

(2) slant culture: inoculate Rhizopus microspora whisker-like variant ZJPH1308 into slant medium, cultivate at 30°C for 4 to 5 days to obtain slant cells; the final concentration of the slant medium is: potato 200g/L, Glucose 20g/L, agar 20g/L, the solvent is distilled water, the pH is natural;

(3) Seed cultivation: select a ring of thalli from the slanted thalli and inoculate it into the seed medium, cultivate at 30° C. and 200 rpm for 22 hours to obtain seed liquid; the final concentration of the seed medium is composed of: glucose 25g/L, peptone 30g /L, KH ₂ PO ₄ 1 g/L, MgSO ₄ ·7H ₂ O 1.3 g/L, pH 6.0, and the solvent is distilled water.

(4) Fermentation culture: the seed liquid was inoculated into the fermentation medium with a volume concentration of 6% inoculum, fermented and cultured at 30°C and 200 rpm for 24 hours, the cells were taken out, washed with distilled water three times, and the wet cells were collected; the fermentation medium; The final concentration is: dextrin 20g/L, peptone 27.5g/L, (NH ₄ ) ₂ SO ₄ 3g/L, KH ₂ PO ₄ 1g/L, MgSO ₄ 7H ₂ O 1.3g/L, pH 6.0, solvent for distilled water.

(5) Biological reduction of ethyl condensate:

Suspend 3 g of the wet thalli obtained by fermentation and culture of Rhizopus microspora whisker-like variant ZJPH1308 in 10 ml, 0.1M phosphate buffer (pH 6.5), and the final concentration of the wet thalli is 300 g/L by wet weight. The ethyl condensate with a concentration of 7.0g/L was used as the substrate (dissolved with 37°C hot ethanol first, wherein the volume of ethanol was 7%), and glycerol with a final concentration of 60g/L was added as an auxiliary substrate, at 30°C, 200rpm, Shake culture for 72h, centrifuge the reaction solution after the reaction, take the supernatant, add an equal volume of ethyl acetate to extract twice, combine the extracts, and evaporate the solvent with a rotary evaporator. The obtained concentrated solution was dissolved in anhydrous methanol and then detected by HPLC. The detection method was shown in Example 3. The yield of the product, ethyl hydroxylate, was 7.8%.

Example 16 Investigation of the biotransformation activity of ethyl condensate by Pseudomonas putida ZJPH1606

(1) Pseudomonas putida ZJPH1606, deposited in China Center for Type Culture Collection, Address: Wuhan University, Wuhan, China, Zip Code: 430072; Deposit Number: CCTCC NO: M2017110, Deposit Date: March 2017 9th. This strain has been disclosed in the previous patent application (application number 201710344320.2, application date May 16, 2017).

(2) slant culture: inoculate Pseudomonas putida ZJPH1606 into slant medium, and cultivate at 30°C for 1-2 days to obtain slant cells; the final concentration of the slant medium is composed of: glucose 10g/L, peptone 5g /L, yeast extract 4g/L, (NH ₄ ) ₂ SO ₄ 2g/L, KH ₂ PO ₄ 1g/L, NaCl 0.5g/L, MgSO ₄ 7H ₂ O 0.5g/L, agar 20g/L, The pH was 6.5, and the solvent was distilled water.

(3) Seed culture: pick a ring of slanted thalli and inoculate it into the seed medium, cultivate at 30° C. and 200 rpm for 24 hours to obtain seed liquid; the final concentration of the seed medium is composed of: glucose 10g/L, peptone 5g /L, yeast extract 4g/L, (NH ₄ ) ₂ SO ₄ 2g/L, KH ₂ PO ₄ 2g/L, NaCl 0.5g/L, MgSO ₄ 7H ₂ O 0.5g/L, pH 6.5, solvent is Distilled water.

(4) Fermentation culture: the seed liquid was inoculated into the fermentation medium with a volume concentration of 8% inoculum, fermented and cultured at 30°C and 200 rpm for 36 hours, the cells were taken out, washed with distilled water three times, and the wet cells were collected; the fermentation medium; The final concentration is: glucose 38.5g/L, beef extract 32.7g/L, MgSO ₄ 7H ₂ O 1.1g/L, pH 6.0, the solvent is distilled water

(5) Biological reduction of ethyl condensate:

Suspend the wet thalline obtained by 3g Pseudomonas putida ZJPH1606 fermentation culture in 10ml, 0.1M phosphate buffer (pH 6.5), the final concentration of the wet thalli is 300g/L by wet weight, and the final concentration is 7.0 g/L ethyl condensate was used as the substrate (dissolved in hot ethanol at 37°C, where the volume of ethanol was 7%), glycerol with a final concentration of 60g/L was added as an auxiliary substrate, and the culture was shaken at 30°C and 200 rpm. 72h, after the reaction was completed, the reaction solution was centrifuged, the supernatant was taken, an equal volume of ethyl acetate was added for extraction twice, the extracts were combined, and the solvent was evaporated with a rotary evaporator. The obtained concentrated solution was dissolved in anhydrous methanol and then detected by HPLC. The detection method was shown in Example 3, and no ethyl hydroxide product was detected.

Conclusion: Pseudomonas putida ZJPH1606 could not convert ethyl condensate to prepare ethyl hydroxide.

sequence listing

<110> Zhejiang University of Technology

<120> A kind of biological preparation method of levonorgestrel key chiral intermediate

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 349

<212> DNA

<213> Geotrichum candidum

<400> 1

cctgcggaag gatcattaag aattataaat atttgtgaaa tttacacagc aaacaataat 60

tttatagtca aaacaaaaat aatcaaaact tttaacaatg gatctcttgg ttctcgtatc 120

gatgaagaac gcagcgaaac gcgatatttc ttgtgaattg cagaagtgaa tcatcagttt 180

ttgaacgcac attgcacttt ggggtatccc ccaaagtata cttgtttgag cgttgtttct 240

ctcttggaat tgcattgctt ttctaaaatt tcgaatcaaa ttcgtttgaa aaacaacact 300

attcaacctc agatcaagta ggattacccg ctgaacttaa gcatatcaa 349

Claims (5)

1. A biological preparation method of a key chiral intermediate of levonorgestrel is characterized in that wet thalli obtained by fermentation culture of Geotrichum candidum ZJPH1704 is used as an enzyme source, an ethyl condensation compound shown in a formula (III) is used as a substrate, an auxiliary substrate and a cosolvent are added, a phosphate buffer solution with the pH of 5.8-8.0 is used as a reaction medium to form a reaction system, the reaction is carried out at the temperature of 30-40 ℃ and the speed of 150-250 rpm, and after the reaction is finished, the reaction solution is separated and purified to obtain the key chiral intermediate of levonorgestrel shown in the formula (IV); the Geotrichum candidum (Geotrichum candidum) ZJPH1704 is preserved in the China center for type culture Collection with the preservation number: CCTCC NO: m2017380, deposit date: 26 months 6 and 2017, wherein the preservation address is Wuhan, Wuhan university, postcode 430072; the co-substrate is one of the following: glucose, maltose, sucrose, lactose, methanol, isopropanol, glycerol, L-alanine or L-cysteine; the cosolvent is one of the following: (1) preheating ethanol at 37 ℃; (2) dimethyl sulfoxide;

2. the method for biologically preparing the key chiral intermediate of levonorgestrel according to claim 1, wherein the dosage of the substrate is 4-7.5 g/L based on the volume of the buffer solution, and the dosage of the wet bacterial cells is 200-500 g/L based on the volume of the buffer solution.

3. The method for biologically preparing the key chiral intermediate of levonorgestrel according to claim 1, wherein the auxiliary substrate is glucose, maltose, sucrose, lactose, glycerol, L-alanine or L-cysteine, the dosage is 10-300 g/L based on the volume of the buffer solution, and the dosage is 10-50% based on the volume of the buffer solution when the auxiliary substrate is methanol or isopropanol.

4. The method for biologically preparing the levonorgestrel key chiral intermediate as claimed in claim 1, wherein the volume of the cosolvent added is 0.5-20% by volume of the buffer solution.

5. The process for the biological preparation of a key chiral intermediate of levonorgestrel according to claim 1, wherein the enzyme source is prepared by the following method: (1) slant culture: inoculating geotrichum candidum ZJPH1704 to a slant culture medium, and culturing for 1-2 days at 25-30 ℃ to obtain slant strains; the final concentration composition of the slant culture medium is as follows: 15g/L glucose, 7.5g/L peptone, 6g/L yeast extract, (NH)₄)₂SO₄ 3g/L，KH₂PO₄ 1.5g/L，NaCl 0.75g/L，MgSO₄·7H₂0.75g/L of O, 15-20 g/L of agar powder, distilled water as a solvent and pH of 6.5;

(2) seed culture: inoculating slant strains into a seed culture medium, and culturing at 25-30 ℃ and 150-250 rpm for 10-24 hours to obtain a seed solution; the final concentration composition of the seed culture medium is as follows: 15g/L glucose, 20g/L peptone, 10g/L yeast extract, (NH)₄)₂SO₄ 2g/L，KH₂PO₄ 2g/L，NaCl 1g/L，MgSO₄·7H₂O is 0.5g/L, the solvent is distilled water, and the pH value is 6.5;

(3) fermentation culture: inoculating the seed solution into a fermentation culture medium in an inoculation amount with the volume concentration of 4-10%, shaking the flask with the liquid loading amount of 70mL/250mL, culturing at 25-30 ℃ and 150-250 rpm for 24-28 h, centrifuging the fermentation liquid after the fermentation is finished, washing the obtained precipitate with 0.1M, pH 6.5.5 buffer solution, and collecting wet thalli, namely an enzyme source; the final concentration of the fermentation medium is as follows: glucose 24.45g/L, peptone 15.75g/L, (NH)₄)₂SO₄ 21.39g/L，CaCl₂1mmol/L, solvent distilled water, pH 6.5.

Images