CN107794282B - Preparation method and strain of crizotinib chiral intermediate - Google Patents

Abstract

The invention discloses a preparation method and a strain of crizotinib chiral intermediate, wherein the method comprises the steps of taking wet thalli obtained by fermentation culture of Geotrichum candidum ZJPH1704 as an enzyme source, taking 2, 6-dichloro-3-fluoroacetophenone as a substrate, taking glycerol as an auxiliary substrate and taking a buffer solution with the pH of 6-9 as a reaction medium to form a reaction system, carrying out reaction at the temperature of 25-50 ℃ and the speed of 150-250 rpm, and after the reaction is finished, separating and purifying the reaction solution to obtain (S) -1- (2, 6-dichloro-3-fluorophenyl) ethanol; the invention utilizes geotrichum candidum ZJPH1704 to prepare the product with high optical purity, and can improve the reaction yield to 93 percent and the e.e. value to be more than 99.9 percent.

Description

Preparation method and strain of crizotinib chiral intermediate

(I) technical field

The invention relates to a preparation method of a crizotinib chiral intermediate, in particular to a method for biologically catalyzing and asymmetrically synthesizing the crizotinib chiral intermediate by using a new strain-geotrichum candidum ZJPH 1704.

(II) background of the invention

2, 6-dichloro-3-fluorophenethanol (molecular weight: 209.04, CAS number: 877397-65-4) is prepared as Crizotinib (Crizotinib, trade name:

) A key intermediate of (1). The S configuration compound (I), namely formula (I-a), is a key chiral intermediate for preparing crizotinib. The chemical name of the formula (III) is 3- [ (R) -1- (2, 6-dichloro-3-fluorophenyl) ethoxy]-5- [1- (piperidin-4-yl) -1H-pyrazol-4-yl]Pyridin-2-amine.

The formula (I) is 2, 6-dichloro-3-fluorophenethanol, the formula (II) is substrate 2, 6-dichloro-3-fluorophenone, and the formula (III) is crizotinib.

The formula (I-a) is the (S) -isomer of the formula (I), and the formula (I-b) is the (R) -isomer of the formula (I).

Crizotinib is approved by the FDA in the United states for use at 26/8/2011, is the first ALK tyrosine kinase receptor inhibitor approved by the FDA to enter phase III clinical experiments, and can be used for treating non-small cell lung cancer. Formula (iii) is a specific pharmaceutical structural formula thereof disclosed in patent US 7230098.

The synthesis of crizotinib has the difficulty that the key chiral intermediate (S) -1- (2, 6-dichloro-3-fluorophenyl) ethanol, namely the formula (I-a), is prepared, and the synthesis method of the chiral intermediate can be divided into a chemical synthesis method and a biological synthesis method.

The chemical method for preparing the (S) -1- (2, 6-dichloro-3-fluorophenyl) ethanol needs to use expensive iridium as a catalyst and causes environmental pollution. The (S) -1- (2, 6-dichloro-3-fluorophenyl) ethanol prepared by the biological asymmetric reduction method of microbial whole cell catalysis has the advantages of mild reaction conditions, high stereoselectivity, environmental friendliness and the like.

At present, the biocatalytic synthesis of (S) -1- (2, 6-dichloro-3-fluorophenyl) ethanol reported in the literature mainly involves the following types of microorganisms:

cui J. Jean (Journal of clinical chemistry, 2011,54 (18): 6342-6363) and the like use 2, 6-dichloro-3-fluoro acetophenone as a starting material, obtain an S-type chiral intermediate formula (I-a) by utilizing pig liver esterase catalysis, then react with 3-hydroxy-2-nitropyridine under the conditions of diisopropyl azodicarboxylate and triphenylphosphine to obtain an R-type chiral intermediate formula (I-b), and then prepare crizotinib by reactions such as reduction, bromination, substitution, Suzuki coupling and the like, wherein the yield of the route is low.

Liuliqin et al (industrial microorganisms, 2016,46,8-42) construct recombinant Escherichia coli E.coli BL21-ADH and E.coli BL21-GDH, realize co-expression of glucose dehydrogenase and ethanol dehydrogenase, and perform coupling transformation. The yield of (S) -1- (2, 6-dichloro-3-fluorophenyl) ethanol is highest when the reaction temperature is 30 ℃ and the pH value is 7. When the feeding amount is 6%, the conversion rate reaches 93.75%. The pure enzyme used in this method is not easy to preserve and is volatile, thus limiting its application.

An Alcohol Dehydrogenase (ADH) expression plasmid pADH-pET21a is constructed by Beam pistil and the like (Master academic thesis of university of Henan university, 2015), and is transformed into E.coli BL21(DE3) together with pFDH-pET28a to obtain a recombinant bacterium E.coli BL 21-FDH/ADH. The (S) -1- (2, 6-dichloro-3-fluorophenyl) ethanol is prepared by double enzyme coupling of Alcohol Dehydrogenase (ADH) and Formate Dehydrogenase (FDH).

The (S) -1- (2, 6-dichloro-3-fluorophenyl) ethanol is prepared by using the whole microbial cells as a catalyst through biological reduction, and microbial enzyme source cells can be prepared by fermentation, so that the quality is stable, and the cost is low. Furthermore, in situ regeneration of the coenzyme can be achieved by adding a co-substrate during the bioreduction process.

Disclosure of the invention

The invention aims to provide a novel microbial strain-Geotrichum candidum ZJPH1704 for producing carbonyl reductase and a method for preparing (S) -1- (2, 6-dichloro-3-fluorophenyl) ethanol by catalyzing 2, 6-dichloro-3-fluoroacetophenone through whole cells by using the strain and asymmetrically reducing the 2, 6-dichloro-3-fluoroacetophenone. Compared with a chemical reduction route, the method has the advantages of high stereoselectivity, low catalyst preparation cost and environment-friendly conversion process.

The technical scheme adopted by the invention is as follows:

the invention provides a method for preparing crizotinib chiral intermediate, which comprises the steps of taking wet thalli obtained by fermentation culture of Geotrichum candidum ZJPH1704 as an enzyme source, taking 2, 6-dichloro-3-fluoroacetophenone as a substrate, taking a buffer solution (preferably pH 6-7) with pH 6-9 as a reaction medium to form a reaction system, carrying out reaction under the conditions of 25-50 ℃ (preferably 25-40 ℃) and 150-250 rpm (preferably 200rpm), and after the reaction is finished, separating and purifying the reaction solution to obtain (S) -1- (2, 6-dichloro-3-fluorophenyl) ethanol.

Furthermore, the dosage of the substrate is 0.1-10 g/L (preferably 0.5-1 g/L) by volume of the buffer solution, and the dosage of the wet bacteria is 50-450 g/L (preferably 100-300 g/L) by volume of the buffer solution.

Further, the buffer solution is phosphate buffer solution, and is selected within the ionic strength range of 0.01M and 0.2M. The ionic strength of the phosphate buffer solution is 0.01-0.2M, preferably 0.1M.

Furthermore, in order to promote coenzyme regeneration and improve reaction efficiency, an auxiliary substrate is also required to be added into the reaction system, and the auxiliary substrate is one of the following substances: glucose, maltose, sucrose, methanol, ethanol, isopropanol, glycerol, L-alanine, L-glutamic acid or L-cysteine; the addition amount of the auxiliary substrate is 4-200 g/L, preferably 60-100g/L in terms of the volume of the buffer solution. Preferably, the reaction is performed with one of glucose, sucrose and glycerol as co-substrate, most preferably glycerol (preferably 40-200g/L, most preferably 100 g/L). The biocatalytic yield without the addition of co-substrate was 65% for 24h reaction under the same conditions (for aqueous phase inversion, see in particular number 1 in Table 3 of example 5), and the biocatalytic yield with the addition of 100g/L glycerol as co-substrate was increased to 83% (for aqueous phase inversion, see in particular number 5 in Table 1 of example 3).

The invention also considers the influence of metal ions, DTT and EDTA on the conversion, and adds various metal ions including Co into the reaction system²⁺(CoCl₂·6H₂O)、Cu²⁺(CuCl₂·2H₂O)、Mg²⁺(MgSO₄·7H₂O) and Mn²⁺(MnCl₂·4H₂O), there is an inhibitory effect on the conversion reaction according to the invention (see in particular table 4 of example 6); the addition of Dithiothreitol (DTT) and disodium Ethylenediaminetetraacetate (EDTA) also had an inhibitory effect on the transformation reaction described in the present invention (see in particular example 6, Table 4).

Further, the reaction medium is a mixed solution of an organic solvent and a buffer solution with pH 6-9 (preferably pH 6.5), wherein the organic solvent is one of the following: glycerol, N-hexane, dichloromethane, isopropyl acetate, N-dimethylformamide, dimethyl sulfoxide or dibutyl phthalate, preferably glycerol or N-hexane, wherein the volume addition of the organic solvent is 0.5-20%, preferably 5%, based on the volume of the buffer solution; when the organic solvent is an emulsifier OP-10, the volume addition amount is 0.5-2 percent, preferably 0.5 percent based on the volume of the buffer solution; the volume addition amount of the rest organic solvent is 1-20 percent, preferably 5 percent based on the volume of the buffer solution. More preferably, the organic solvent is n-hexane or an emulsifier OP-10, so that the biocatalysis efficiency is improved; the emulsifier OP-10 is most preferable, so that the conversion yield can be improved, and the conversion reaction time can be shortened.

In addition, the other type of reaction medium is a mixed solution of an ionic liquid and a buffer solution with the pH value of 6-9. The ionic liquid mainly comprises: the traditional ionic liquid comprises 1-octyl-3-methylimidazole hexafluorophosphate, tetramethylammonium hexafluorophosphate, 1-octyl-3-methylimidazole tetrafluoroborate, 1-butyl-3-methylimidazole nitrate, N-butylpyridinium tetrafluoroborate and tetramethylammonium tetrafluoroborate. (II) amino acid ionic liquids including tetramethylammonium glutamic acid ([ N ]_1,1,1,1]⁺[Glu]^-) Tetraethylammonium glutamate ([ N ]_2,2,2,2]⁺[Glu]^-) The preparation method is shown in Chinese patent CN 103695480A; tetramethylammonium cysteine ([ N ]_1,1,1,1]⁺[Cys]^-) See literature for methods of preparation (Bioresource Technology 175(2015) 42-50). ③ eutectic ionic liquid, including choline chloride]⁺[ Glycine acid]^-The preparation method is described in the literature (Journal of Molecular Catalysis B: Enzymatic 122(2015) 188-198); [ Choline chloride]⁺[ glutathione]^-The preparation method is shown in Chinese patent CN 103709230A. The molar ratio of the anionic compound to the cationic compound of each ionic liquid was 1: 1. The mass addition amount of the ionic liquid is 0.1-10 g/L, preferably 5g/L, calculated by the volume of the buffer solution. Preferably [ Choline chloride ]]⁺[ Glycine acid]^-Or [ choline chloride ]]⁺[ glutathione]^-In particular, when [ choline chloride ] is added]⁺[ Glycine acid]^-In this case, the biocatalytic yield can be increased from 83% to 93% in the buffer system (see, in particular, example 10, Table 8, No. 10).

Further, the enzyme source of the present invention is prepared as follows: (1) slant culture: inoculating geotrichum candidum ZJPH1704 to a slant culture medium, and culturing at 25-30 ℃ for 24h, obtaining slant strains; the final concentration composition of the slant culture medium is as follows: 15g/L glucose, 7.5g/L peptone, 6g/L yeast extract, (NH)₄)₂SO₄ 3g/L，KH₂PO₄ 1.5g/L，NaCl 0.75g/L，MgSO₄·7H₂0.75g/L of O, 15-20 g/L of agar powder, distilled water as a solvent and pH of 6.5;

(2) seed culture: inoculating slant strains into a seed culture medium, and culturing at 25-30 ℃ and 150-250 rpm for 10-24 hours to obtain a seed solution; the final concentration composition of the seed culture medium is as follows: 15g/L glucose, 20g/L peptone, 10g/L yeast extract, (NH)₄)₂SO₄ 2g/L，KH₂PO₄ 2g/L，NaCl 1g/L，MgSO₄·7H₂O is 0.5g/L, the solvent is distilled water, and the pH value is 6.5;

(3) fermentation culture: inoculating the seed solution into a fermentation culture medium in an inoculation amount with the volume concentration of 4-10% (preferably 10%), wherein the liquid loading amount is 100mL/250mL shake flask, and culturing at 25-30 ℃ and 150-250 rpm for 24-28 h, preferably at 30 ℃ and 200rpm for 24 h. After fermentation is finished, centrifuging the fermentation liquor, washing the obtained precipitate with 0.1M buffer solution with the pH value of 6.5, and collecting wet thalli, namely an enzyme source; the final concentration of the fermentation medium is as follows: glucose 24.45g/L, peptone 15.75g/L, (NH)₄)₂SO₄21.39g/L, solvent distilled water, pH 6.5.

Compared with the prior art, the invention has the following beneficial effects: the invention provides a microorganism strain-Geotrichum candidum ZJPH1704 which can be used for preparing (S) -1-2, 6-dichloro-3-fluorophenylethanol (compound shown in a formula (I-a)) by asymmetrically reducing prochiral ketone substrate (II) with high stereoselectivity, and the product prepared by the strain has high optical purity and e.e. value>99.9 percent. 1g/L of the substrate was added to a phosphate buffer system at pH6.5, and the reaction was carried out for 24 hours, whereby the yield of the S-type reduction product was 83%. When the ionic liquid is added into the reaction system, the catalytic efficiency can be effectively improved, the reaction yield is improved, the reaction time is shortened, and particularly, the [ choline chloride ] is added into the reaction system]⁺[ Glycine acid]^-The reaction yield can be improved to 93%, and the e.e. value is more than 99.9%.

(IV) description of the drawings

FIG. 1 shows the colony morphology of the plate of Geotrichum candidum ZJPH 1704.

FIG. 2 is a scanning electron micrograph of Geotrichum candidum ZJPH1704 taken at 500-fold magnification.

FIG. 3 is a scanning electron micrograph of Geotrichum candidum ZJPH1704 at 10000 times.

FIG. 4 is a GC chromatogram detection of the product compound of formula (I-a) (containing internal standard n-dodecane).

FIG. 5 shows a GC chromatogram detection of a substrate of a compound of formula (II) (containing an internal standard of n-dodecane).

FIG. 6 shows GC chromatogram detection patterns (containing internal standard n-dodecane) of the racemic products, i.e., the mixture (1:1) of the compounds of formula (I-a) and formula (I-b).

FIG. 7 is a GC chromatogram detection spectrum (containing internal standard n-dodecane) of a sample (i.e., an extract) transformed with the strain ZJPH1704 of Geotrichum candidum (Geotrichum candidum) in example 1.

(V) detailed description of the preferred embodiments

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

example 1: screening of microbial strains for catalytic reduction of 2, 6-dichloro-3-fluoroacetophenone

1. Strain screening

Enrichment culture: adding 1g fresh soil sample (soil sample collected in campus of Zhejiang university of industry (Hangzhou Zhejiang)) into a 250mL shake flask filled with 50mL enrichment medium, culturing at 30 deg.C and 200rpm for 5d, transferring 1mL culture solution into fresh enrichment medium, culturing for 5d, and repeating the enrichment for 2 times. The enrichment medium consists of: (NH)₄)₂SO₄ 2g/L，KH₂PO₄ 2g/L，NaCl 1g/L，MgSO₄·7H₂O0.5 g/L, the compound of formula (II) (2g/L) as the sole carbon source, distilled water as the solvent, pH 6.5.

Primary screening by a flat plate: diluting the enriched culture solution with normal saline 10⁴-10⁶After doubling, the cells were plated on a plate screening medium and cultured at 30 ℃ for 2 days. Single colonies were picked and streaked again and incubated at 30 ℃ for 2 days. Purifying after 2 times of streaking separation cultureStrain ZJPH1704, and deposited on solid slant medium. The final concentration composition of the plate screening medium was: (NH)₄)₂SO₄ 2g/L，KH₂PO₄ 2g/L，NaCl 1g/L，MgSO₄·7H₂O0.5 g/L, agar powder 20g/L, distilled water as solvent, pH 6.5. The final concentration composition of the slant culture medium is as follows: 15g/L glucose, 7.5g/L peptone, 6g/L yeast extract, (NH)₄)₂SO₄ 3g/L，KH₂PO₄1.5g/L，NaCl 0.75g/L，MgSO₄·7H₂0.75g/L of O, 20g/L of agar powder and distilled water as a solvent, wherein the pH value is 6.5.

Culturing and collecting microbial cells: selecting and inoculating the purified seeds to a seed culture medium, culturing for 10-24 h at 30 ℃ and 200rpm, transferring the seeds to an initial fermentation culture medium according to the inoculation amount of 10% (v/v), and culturing for 24-48 h at 30 ℃ and 200 rpm. The fermentation broth was centrifuged at 9000rpm at 4 ℃ for 10min, the supernatant was discarded, and the cells were washed twice with a phosphate buffer solution having a pH of 6.5, and centrifuged again to obtain resting cells. The final concentration compositions of the seed culture medium and the initial fermentation culture medium are as follows: 15g/L glucose, 20g/L peptone, 10g/L yeast extract, (NH)₄)₂SO₄ 3g/L，KH₂PO₄1.5g/L，NaCl 0.75g/L，MgSO₄·7H₂O0.5 g/L, solvent distilled water, pH 6.5.

Re-screening strains: the (S) -type product (I-a) is prepared by stereoselective reduction of 2, 6-dichloro-3-fluoro acetophenone (II) by taking a resting cell of a microorganism as an enzyme source catalytic substrate, and the reaction system is as follows: 2g of resting cells (wet weight basis) were resuspended in 10mL of phosphate buffer (0.1M, pH 6.5.5), 1g/L substrate and 100g/L glycerol were added as co-substrate, and the reaction was carried out at 40 ℃ and 200rpm for 24 h. After the reaction, the reaction solution was extracted with ethyl acetate, and the converted product was analyzed and detected by Gas Chromatography (GC), and the presence of the peak of the reduced product of formula (I-a) in the biocatalytic sample was observed in comparison with the reduced product of racemate (I-a). The strain ZJPH1704 can reduce the substrate into the compound shown in the formula (I-a). The chiral GC method is adopted to detect the enantiomeric excess value (e.e. value) of the reduction product of the strain, and the detection result shows that the e.e. value is more than 99.9 percent.

Qualitative and quantitative analysis by gas chromatography: detecting the content of the product and the residual substrate after the conversion reaction, and calculating the concentration, the Yield (Yield) and the e.e. value of the related substances.

C in formula (1)_i、C₀The molar concentration of the product at the end of the reaction and the molar concentration of the substrate at the beginning of the reaction, respectively.

The optical purity of the product is characterized by enantiomeric excess (e.e.).

In equation (2): c_SAnd C_RThe molar concentrations of (S) -1- (2, 6-dichloro-3-fluorophenyl) ethanol and (R) -1- (2, 6-dichloro-3-fluorophenyl) ethanol, respectively.

Conditions for gas chromatography: the concentrations of the product and the residual substrate in the reaction extract were analyzed by gas chromatography and quantified by the internal standard method. The internal standard was dodecane. 1mL of the extract was analyzed by adding 1. mu.L of dodecane. Gas chromatography conditions: shimadzu, japan GC-2014 gas chromatograph, N2000 chromatography workstation, zheda; walian CP-Chirasil-Dex chiral capillary gas chromatography column (25 m. times.0.25 mm. times.0.25 μm) in USA. The carrier gas is high-purity nitrogen, and the flow rate is 2 mL/min; the sample injection amount is 1 mu L, and the split ratio is 15: 1; the temperature of the detector and the injection port is 250 ℃; the temperature of the chromatographic column is 120-170 ℃; temperature rise rate: 5 ℃/min; the detector is FID. The gas chromatogram of the compound of formula (I-a), the compound of formula (II), the mixture of compounds of formula (I-a) and formula (I-b), i.e. the racemate, and the sample (i.e. extract) transformed by strain ZJPH1704 are shown in FIGS. 4-7.

2. Identification of strains

Morphological characteristics, physiological and biochemical characteristics and ITS sequences of the strain ZJPH 1704:

morphological observation is carried out on a nutrient agar plate, the characteristics of appearance morphology, texture, color, growth speed and the like of a bacterial colony of the strain ZJPH1704 are observed, and the cell morphology is observed by a scanning electron microscope on bacterial cells. Culturing at 30 deg.C for 36 hr, wherein the colony on the nutrient agar plate is in planar diffusion, grows rapidly, and is flat, milky white, short velvet or powder-like, has concentric circles and radial lines, and has central protrusion. Generates leucogen, fluff or powder during liquid culture. Coarse larger colonies, see fig. 1; the ZJPH1704 strain can be observed to be in a dispersed and straight rod shape under a scanning electron microscope, and the cells are shown in figures 2 and 3.

The carbon sources which can be utilized by the physiological and biochemical characteristics comprise: glucose, D-xylose and galactose, sucrose, maltose, raffinose, lactose, arabinose, cellobiose and melibiose cannot be used. Can tolerate 0.01 percent and 0.1 percent of cycloheximide and can not assimilate nitrate and urea.

Thirdly, the characteristic ITS sequence can quickly, accurately and simply identify the fungus by amplifying the gene segment of the fungus ribosome ITS (internal transformed spacer) by using PCR. The ITS region of ZJPH1704 strain rDNA is amplified by adopting universal primers ITS1 and ITS4 to generate a DNA fragment with the size of 349bp, and the PCR amplification product is subjected to sequence determination. The fungal ribosomal ITS (internal TranscribSpacer) gene sequence (SEQ ID NO.1) of the ZJPH1704 strain was determined as follows:

CCTGCGGAAGGATCATTAAGAATTATAAATATTTGTGAAATTTACACAGCAAACAATAATTTTATAGTCAAAACAAAAATAATCAAAACTTTTAACAATGGATCTCTTGGTTCTCGTATCGATGAAGAACGCAGCGAAACGCGATATTTCTTGTGAATTGCAGAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCATTGCTTTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAAGCATATCAA

this sequence was submitted to GenBank (GenBank accession No. MG214158), and the ITS sequence of strain ZJPH1704 was compared for homology (BLAST) at the NCBI website (http:// www.ncbi.nlm.nih.gov), indicating that: the strain ZJPH1704 has high sequence homology with part of strains of Geotrichum sp, and has 100 percent of sequence homology with the strain Geotrichum candidum CBS:11628(GenBank accession No. KY103456.1). The strain ZJPH1704 is named Geotrichum candidum (Geotrichum candidum) ZJPH1704 and is deposited in the China center for type culture Collection with the deposit number: CCTCC NO: m2017380, deposit date: 26 th 6 th 2017, wherein the preservation address is Wuhan, Wuhan university, postcode 430072.

Example 2: obtaining enzyme source of resting cells under shake flask culture condition

(1) Slant culture: inoculating Geotrichum candidum ZJPH1704 into a slant culture medium, and culturing at 30 ℃ for 24h to obtain a mature slant strain. The final concentration composition of the slant culture medium is as follows: 15g/L glucose, 7.5g/L peptone, 6g/L yeast extract, (NH)₄)₂SO₄ 3g/L，KH₂PO₄ 1.5g/L，NaCl 0.75g/L，MgSO₄·7H₂0.75g/L of O, 20g/L of agar powder and distilled water as a solvent, wherein the pH value is 6.5.

(2) Seed culture: inoculating slant strains into a seed culture medium, and culturing at 30 ℃ and 200rpm for 12h to obtain a seed solution. The final concentration composition of the seed culture medium is as follows: 15g/L glucose, 20g/L peptone, 10g/L yeast extract, (NH)₄)₂SO₄ 2g/L，KH₂PO₄ 2g/L，NaCl 1g/L，MgSO₄·7H₂O0.5 g/L, solvent distilled water, pH 6.5.

(3) Fermentation culture: inoculating the seed solution into a fermentation culture medium at an inoculation amount of 10% by volume, loading the seed solution into a shake flask with the volume of 100mL/250mL, and culturing at 30 ℃ and 200rpm for 24 h. After the fermentation was completed, the fermentation broth was centrifuged, and the obtained precipitate was washed 2 times with a phosphate buffer (0.1M, pH 6.5.5) to obtain 38.10g of wet cells per liter of the fermentation broth (5.49 g in terms of dry weight). The final concentration of the fermentation medium is as follows: glucose 24.45g/L, peptone 15.75g/L, (NH)₄)₂SO₄21.39g/L, solvent distilled water, pH 6.5.

Example 3:

2g of wet microbial cells obtained in example 2 were suspended in 10mL of K₂HPO₄-KH₂PO₄The final concentration of wet cells in the buffer (0.1M, pH 6.5) was 200g/L (28.82 g/L dry basis weight). Adding a substrate of 1 g/L2, 6-dichloro-3-fluoro-acetophenone (i.e. 7.5. mu.L of the compound of formula (II)), adding glycerol of 100g/L (i.e. 1g) as an auxiliary substrate, and converting 2 in a shaker at 200rpm at different temperatures (25-50 ℃ C., see Table 1)And 4 h. After the reaction, the reaction solution was added with ethyl acetate of equal volume to terminate the reaction and extracted for 30min, centrifuged, and the supernatant organic phase was taken and added with dodecane as an internal standard for quantitative analysis by gas chromatography (same as example 1). The yields and e.e. values of the product (S) -2, 6-dichloro-3-fluorophenylethanol (compound of formula (I-a)) are shown in Table 1. The preferred reaction temperature is 40 ℃ and the yield of the compound of formula (I-a) is 83%, the value of e.e>99.9％。

TABLE 1 concentration and ee value of the product (I-a) at different conversion temperatures

Example 4:

2g of wet cells obtained according to example 2 were suspended in 10mL of different buffers (Table 2) to a final concentration of 200g/L (28.82 g/L dry weight), 1g/L substrate (i.e., 7.5. mu.L of the compound of formula (II)) was added to the wet cells, 100g/L glycerol (i.e., 1.0g) was added as an auxiliary substrate, and the mixture was transformed in a shaker at 40 ℃ and 200rpm for 24 hours. The yield of the product (S) -2, 6-dichloro-3-fluorophenylethanol, as determined by GC chromatography with equal volume of ethyl acetate extraction, e.e. values are shown in Table 2. Preferably 0.1M, pH6.5₂HPO₄-KH₂PO₄The yield of the compound of formula (I-a) in the buffer is 83%, and the e.e. value>99.9％。

TABLE 2 influence of buffer type on the concentration and ee value of the product (I-a)

Example 5:

2g of wet microbial cells obtained in example 2 were suspended in 10mL of K₂HPO₄-KH₂PO₄The final concentration of wet cells in the buffer (0.1M, pH 6.5) was 200g/L (28.82 g/L dry basis),substrate (i.e., 7.5. mu.L of the compound of formula (II)) was added at a final concentration of 1g/L, and glucose, maltose, sucrose, methanol, ethanol, isopropanol, glycerol, L-alanine, L-glutamic acid, and L-cysteine were added as cosubstrates, respectively, and the mixture was inverted at 40 ℃ for 24 hours in a shaker at 200rpm, without any addition of any cosubstrate as a control. After the reaction, the reaction solution was extracted with ethyl acetate of equal volume, and the yield and e.e. value of the product (S) -2, 6-dichloro-3-fluorophenylethanol were determined by the gas chromatography method of example 1 and are shown in Table 3. In a preferred embodiment, the yield of product is 83%, e.e. value, with 100g/L glycerol as co-substrate>99.9％。

TABLE 3 Effect of the addition of different cosubstrates on the yield and ee value of the product (I-a)

Example 6:

2g of wet microbial cells obtained in example 2 were suspended in 10mL of K₂HPO₄-KH₂PO₄In a buffer (0.1M, pH 6.5), the wet cell final concentration was 200g/L (28.82 g/L dry weight), a substrate (i.e., 7.5. mu.L of the compound of formula (II)) was added to a final concentration of 1g/L, glycerol (i.e., 1.0g) was added as an auxiliary substrate to a final concentration of 100g/L, and then metal ions and Dithiothreitol (DTT) and disodium Ethylenediaminetetraacetate (EDTA) were added to a final concentration of 1mmol/L, respectively (Table 4), and the mixture was inverted for 24 hours in a shaker at 40 ℃ and 200 rpm. After the reaction, the reaction solution was extracted with ethyl acetate of equal volume, and the yield and e.e. value of the product (S) -2, 6-dichloro-3-fluorophenylethanol were determined by the gas chromatography method of example 1 and are shown in Table 4. The addition of metal ions did not improve the yield of the product.

TABLE 4 influence of different metal ions on the concentration and ee value of the product (I-a)

Example 7:

2g of wet cells obtained in example 2 were suspended in 10mLK₂HPO₄-KH₂PO₄In a buffer (0.1M, pH 6.5), the wet cell final concentration was 200g/L (28.82 g/L dry weight), substrates (i.e., 3.75, 6, 7.5, 9, 11.25, 15. mu.L of the compound of formula (II)) were added to the buffer at final concentrations of 0.5, 0.8, 1.0, 1.2, 1.5, 2g/L, respectively, glycerol (i.e., 1.0g) was added as an auxiliary substrate at final concentration of 100g/L and the mixture was inverted for 24 hours in a shaker at 40 ℃ and 200 rpm. After the reaction, an equal volume of ethyl acetate was added to the reaction solution for extraction, and the concentration, yield and e.e. value of the product (S) -2, 6-dichloro-3-fluorophenylethanol were determined by the gas chromatography method of example 1 and are shown in table 5. Considering the yield and the initial substrate concentration for the bioreduction, preferably the initial substrate concentration is 1.0g/L, under which the conversion is carried out for 24h, the yield is 83%, and the e.e. value>99.9％。

TABLE 5 Effect of different initial substrate concentrations on the concentration of the product (I-a) and the ee value

Example 8:

1g, 1.5g, 2g, 2.5g, and 3g of the wet cells obtained in example 2 were suspended in 10mL of K₂HPO₄-KH₂PO₄In the buffer (0.1M, pH 6.5), the wet cells were added at final concentrations of 100, 150, 200, 250, 300g/L, respectively, substrates (i.e., 3.75, 6, 7.5, 9, 11.25. mu.L of the compound of formula (II)) at final concentrations of 0.5, 0.8, 1.0, 1.2, 1.5g/L were added, glycerol was added at a final concentration of 100g/L (i.e., 1.0g) as an auxiliary substrate, and the mixture was inverted at 40 ℃ for 24 hours in a shaker at 200 rpm. After the reaction, the reaction mixture was extracted with ethyl acetate of the same volume by the gas chromatography method of example 1The concentration and yield of the product (S) -2, 6-dichloro-3-fluorophenylethanol are shown in Table 6. Preferably, the yield of the product compound of formula (I-a) is 83% at a resting cell concentration and an initial substrate concentration of 200g/L and 1g/L, respectively (i.e., resting cell/initial substrate mass ratio of 2: 0.01).

TABLE 6 influence of resting cell concentration and initial substrate concentration on the concentration of the product (I-a) and the ee value

Example 9:

2.0g of wet microbial cells obtained in example 2 were suspended in 9.5mLK₂HPO₄-KH₂PO₄In a buffer (0.1M, pH 6.5) (final concentration 200g/L), an organic solvent (see Table 7) was added to the system at a final volume concentration of 5% (i.e., 0.5mL), wherein the organic solvent was glycerol, which was used as the solvent and co-substrate, and no additional co-substrate glycerol was added), a substrate was added at a final concentration of 1g/L (i.e., 7.5. mu.L of the compound of formula (II) was added), and further, glycerol (No. 1 was not added, i.e., glycerol-solvent group) was added at a final concentration of 200g/L as the co-substrate, and the mixture was inverted at 40 ℃ for 24 hours in a shaker at 200 rpm. After the reaction is finished, the reaction solution is added with equal volume of ethyl acetate for extraction, and the yield and the e.e. value of the product (S) -2, 6-dichloro-3-fluorophenylethanol are shown in Table 7 by adopting a gas chromatography method for detection. The buffer system with glycerol and the buffer system with n-hexane and OP-10 are preferred, and the catalytic reaction products of the compound shown as the formula (I-a) have the yields of 73%, 89% and 92% respectively, and the e.e. value is more than 99.9%.

TABLE 7 influence of the addition of different organic solvents to the buffer on the concentration and ee value of the product (I-a)

Example 10:

2.0g of wet microbial cells obtained in example 2 were suspended in 10mL of K₂HPO₄-KH₂PO₄Buffer solution(0.1M, pH 6.5) at a final wet cell concentration of 200g/L, ionic liquid (Table 8) at a final concentration of 5g/L, substrate (i.e., 7.5. mu.L of compound of formula (II)) at a final concentration of 1g/L, glycerol (i.e., 1.0g) at a final concentration of 100g/L as an auxiliary substrate, and the mixture was inverted for 24 hours in a shaker at 40 ℃ and 200 rpm. After the reaction, the reaction mixture was extracted with ethyl acetate of the same volume, and the yield and e.e. value of the product (S) -2, 6-dichloro-3-fluorophenylethanol were determined by the gas chromatography method in example 1 and shown in Table 8. Preferably, [ choline chloride ] is added into the reaction system]⁺[ Glycine acid]^-And [ choline chloride ]]⁺[ glutathione]^-Yields of 93% and 89%, respectively, e.e. values>99.9％。

TABLE 8 influence of the addition of different ionic liquids to the buffer on the concentration and ee value of the product (I-a)

Sequence listing

<110> Zhejiang industrial university

<120> preparation method and strain of crizotinib chiral intermediate

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 349

<212> DNA

<213> Geotrichum candidum (Geotrichum)

<400> 1

cctgcggaag gatcattaag aattataaat atttgtgaaa tttacacagc aaacaataat 60

tttatagtca aaacaaaaat aatcaaaact tttaacaatg gatctcttgg ttctcgtatc 120

gatgaagaac gcagcgaaac gcgatatttc ttgtgaattg cagaagtgaa tcatcagttt 180

ttgaacgcac attgcacttt ggggtatccc ccaaagtata cttgtttgag cgttgtttct 240

ctcttggaat tgcattgctt ttctaaaatt tcgaatcaaa ttcgtttgaa aaacaacact 300

attcaacctc agatcaagta ggattacccg ctgaacttaa gcatatcaa 349

Claims (10)

1. A preparation method of a crizotinib chiral intermediate is characterized in that wet thalli obtained by fermentation culture of Geotrichum candidum ZJPH1704 is used as an enzyme source, 2, 6-dichloro-3-fluoroacetophenone is used as a substrate, glycerol is used as an auxiliary substrate, a buffer solution with the pH of 6-9 is used as a reaction medium to form a reaction system, the reaction is carried out at the temperature of 25-50 ℃ and the speed of 150-250 rpm, and after the reaction is finished, the reaction solution is separated and purified to obtain (S) -1- (2, 6-dichloro-3-fluorophenyl) ethanol; the Geotrichum candidum (Geotrichum candidum) ZJPH1704 is preserved in the China center for type culture Collection with the preservation number: CCTCC NO: m2017380, deposit date: 26 th 6 th 2017, wherein the preservation address is Wuhan, Wuhan university, postcode 430072.

2. The method for preparing the crizotinib chiral intermediate as claimed in claim 1, wherein the dosage of the substrate is 0.1-10 g/L based on the volume of the buffer solution, and the dosage of the wet bacteria is 50-450 g/L based on the volume of the buffer solution.

3. The method for preparing the crizotinib chiral intermediate as claimed in claim 1, characterized in that the reaction system further comprises an auxiliary substrate, wherein the auxiliary substrate is one of the following substances: glucose, maltose, sucrose, methanol, ethanol, isopropanol, glycerol, L-alanine, L-glutamic acid or L-cysteine.

4. The preparation method of the crizotinib chiral intermediate as claimed in claim 3, characterized in that the amount of the cosubstrate is 4-200 g/L based on the volume of the buffer.

5. The preparation method of the crizotinib chiral intermediate as claimed in claim 3, characterized in that an organic solvent is further added to the reaction medium, wherein the organic solvent is one of the following: glycerol, N-hexane, dichloromethane, isopropyl acetate, emulsifier OP-10, N-dimethylformamide, dimethyl sulfoxide or dibutyl phthalate.

6. The method for preparing crizotinib chiral intermediate according to claim 5, wherein the volume of the organic solvent is 0.5-20% of the volume of the buffer.

7. The preparation method of the crizotinib chiral intermediate as claimed in claim 3, characterized in that an ionic liquid is further added to the reaction medium, wherein the ionic liquid is one of the following: 1-octyl-3-methylimidazolium hexafluorophosphate, tetramethylammonium hexafluorophosphate, 1-octyl-3-methylimidazolium tetrafluoroborate, 1-butyl-3-methylimidazolium nitrate, N-butylpyridinium tetrafluoroborate, tetramethylammonium glutamic acid, tetraethylammonium glutamic acid, tetramethylammonium cysteine, [ choline chloride [ (] C-CHLORINATE ]]⁺[ Glycine acid]^-Or [ choline chloride ]]⁺[ glutathione]^-。

8. The preparation method of the crizotinib chiral intermediate as claimed in claim 7, characterized in that the mass addition amount of the ionic liquid is 0.1-10 g/L based on the volume of the buffer solution.

9. The process for preparing crizotinib chiral intermediate according to claim 1, characterized in that the enzyme source is prepared as follows: (1) slant culture: inoculating geotrichum candidum ZJPH1704 to a slant culture medium, and culturing for 24h at 25-30 ℃ to obtain slant strains; the final concentration composition of the slant culture medium is as follows: 15g/L glucose, 7.5g/L peptone, 6g/L yeast extract, (NH)₄)₂SO₄ 3g/L，KH₂PO₄ 1.5g/L，NaCl 0.75g/L，MgSO₄·7H₂0.75g/L of O, 15-20 g/L of agar powder, distilled water as a solvent and pH of 6.5;

(2) seed culture: inoculating slant strains into a seed culture medium, and culturing at 25-30 ℃ and 150-250 rpm for 10-24 hours to obtain a seed solution; the final concentration composition of the seed culture medium is as follows: 15g/L glucose, 20g/L peptone and fermentMother cream 10g/L, (NH)₄)₂SO₄ 2g/L，KH₂PO₄ 2g/L，NaCl 1g/L，MgSO₄·7H₂O is 0.5g/L, the solvent is distilled water, and the pH value is 6.5;

(3) fermentation culture: inoculating the seed solution into a fermentation culture medium in an inoculation amount with the volume concentration of 4-10%, shaking the flask with the liquid loading amount of 100mL/250mL, culturing at 25-30 ℃ and 150-250 rpm for 24-28 h, centrifuging the fermentation liquid after the fermentation is finished, washing the obtained precipitate with 0.1M, pH 6.5.5 buffer solution, and collecting wet thalli, namely an enzyme source; the final concentration of the fermentation medium is as follows: glucose 24.45g/L, peptone 15.75g/L, (NH)₄)₂SO₄21.39g/L, solvent distilled water, pH 6.5.

10. Geotrichum candidum ZJPH1704, which is deposited at the China center for type culture Collection and has the deposit number: CCTCC NO: m2017380, deposit date: 26 th 6 th 2017, wherein the preservation address is Wuhan, Wuhan university, postcode 430072.

Images