CN108441433B - Rhodotorula mucilaginosa NQ1 and application thereof in preparation of chiral alcohol - Google Patents

Abstract

The invention discloses Rhodotorula mucilaginosa NQ1 and application thereof in preparing chiral alcohol. The invention prepares the optically pure (S) - [3, 5-bis (trifluoromethyl) phenyl ] ethanol by using resting cells obtained by fermenting Rhodotorula mucilaginosa (Rhodotorula mucilaginosa) NQ1 as a chiral biocatalyst, has the advantages of good stereoselectivity, high optical purity of products and the like, and when the concentration of a substrate ([3, 5-bis (trifluoromethyl) phenyl ] ethanone) is 80mmol/L and the final concentration of an auxiliary substrate glucose is 35g/L, the reaction is carried out for 24h in a phosphate buffer solution with the pH value of 7.5 and the temperature of 30 ℃, the yield of the target product (S) - [3, 5-bis (trifluoromethyl) phenyl ] ethanol reaches 84.2 percent, and the ee reaches 99.5 percent.

Description

Rhodotorula mucilaginosa NQ1 and application thereof in preparation of chiral alcohol

Technical Field

The invention belongs to the technical field of microorganism application, and particularly relates to rhodotorula mucilaginosa NQ1 and application thereof in preparation of chiral alcohol.

Background

Chiral alcohols are important chiral modular compounds, are widely applied to the fields of chemistry, medical industry, fine chemical industry, agriculture and the like, and particularly in the pharmaceutical industry, the chiral alcohols become important intermediates or chiral raw materials for synthesizing various chiral drugs. For example, D- (-) -pantolactone may be synthesized as calcium D-pantothenate (Vitamin B)₅) (S) - (4-chlorphenyl) (pyridine-2-yl) methanol can be used for synthesizing an antiallergic drug Betahistine (Betahistine), (S) - (-) -3-chloro-1-phenyl-1-propanol can be used for synthesizing antidepressant drug Fluoxetine (Fluoxetine), (R) -2-hydroxy-4-benzeneEthyl butyrate can be used for synthesizing antihypertensive drug captopril (Enalapril) and the like.

The (S) - [3, 5-bis (trifluoromethyl) phenyl ] ethanol is an important chiral intermediate for synthesizing novel chemo-treatment antiemetic drug NK-1 receptor antagonist drugs, and the antidepressant drug prepared by the (S) - [3, 5-bis (trifluoromethyl) phenyl ] ethanol has good potential curative effect in treating a series of central and peripheral nervous system inhibition. The existing methods for preparing optically pure (S) - [3, 5-bis (trifluoromethyl) phenyl ] ethanol by using [3, 5-bis (trifluoromethyl) phenyl ] ethanone mainly comprise chemical methods and biological methods. When the synthesis is carried out by a chemical method, expensive chemical catalysts such as transition metal Ru and the like are needed, and the method has the disadvantages of complicated steps, harsh reaction conditions, high energy consumption, high pollution and low yield. Biological algorithms are catalyzed by free enzymes or whole cells. The oxidoreductases applied to asymmetric catalytic reduction of carbonyl compounds are mainly alcohol dehydrogenase or aldehyde ketone reductase, which need to add coenzyme (NAD (P) H) in the catalytic process, but the coenzyme is expensive, and the separation and purification steps of the aldehyde ketone reductase or the alcohol dehydrogenase are complicated, thereby limiting the industrial application thereof to a certain extent. The disadvantages can be overcome by adopting the microbial whole-cell biocatalytic reduction, because the microbial cells not only contain enzymes for oxidation and reduction, but also can realize coenzyme regeneration, and the complicated separation and purification process of the enzymes can be saved. At present, the biocatalytic synthesis of (S) - [3, 5-bis (trifluoromethyl) phenyl ] ethanol reported in the literature mainly involves the following microorganisms or enzymes. Pollard et al (Pollard D, Truppo M, Pollard J, et al, Tetrahedron Asymmetry,2006,17(4): 554-; zhu et al (Zhu D, Yang Y, John D, et al, Org Biomol Chem,2006,4: 2690-; zhang Fang et al (Zhang Fang, JiangShu, Liu Chun Mei et al. pharmaceutical biotechnology, 2007,16(1): 411) 414) utilizes rhodotorula (Saccharomyces rhodotoria) resting cells to catalyze [3, 5-bis (trifluoromethyl) phenyl ] ethanone to reduce in a two-phase system consisting of water/octane (volume fraction of 20%) to obtain (S) - [3, 5-bis (trifluoromethyl) phenyl ] ethanol, and after 36h of reaction, the conversion rate is 81.7%, but the ee value of the product is only 89.5% at most; wang et al (Wang P, Su H Z, Sun L M, et a1., Chinese J Chem Eng,2011,19(6): 1028) 1032) a process for the preparation of (S) - [3, 5-bis (trifluoromethyl) phenyl ] ethanol by catalytic asymmetric reduction using Candida tropicalis (Candidatropicalis)104, which is carried out in an aqueous system with an ee value of more than 99.9%.

Disclosure of Invention

One of the purposes of the invention is to provide a new microbial strain, namely Rhodotorula mucilaginosa NQ1, the classification of the strain is named as Rhodotorula mucor NQ1, the strain is preserved in China center for type culture Collection (CCTCC for short), the preservation address is China, Wuhan and Wuhan university, the preservation number is CCTCC NO: m2018001, preservation date of 2018, 1 month and 2 days.

The second purpose of the invention is to provide the application of the rhodotorula mucilaginosa NQ1 in preparing chiral alcohol, wherein the chiral alcohol is preferably (S) - [3, 5-bis (trifluoromethyl) phenyl ] ethanol.

The technical scheme adopted by the invention is as follows:

rhodotorula mucilaginosa (Rhodotorula mucilaginosa) NQ1, obtained by screening according to the following steps:

(1) strain screening: rhodotorula mucilaginosa NQ1 is obtained by separating and screening a soil sample collected from Hunan Tan City of Hunan province; the specific screening method is as follows: adding the collected soil sample (Hunan quan) into a 250mL shake flask filled with 50mL enrichment medium, culturing for 4-5 days at 25-35 ℃ at 150-250 rpm, taking 1mL culture solution to transfer to fresh enrichment medium after the culture solution becomes turbid, continuing culturing for 4-5 days, and repeating the enrichment culture for 3-4 times. Enrichment of the medium with [3, 5-bis (trifluoromethyl) phenyl]Ethanone is the sole carbon source. The final concentration of the enrichment medium is as follows: [3, 5-bis (trifluoromethyl) phenyl group]5-200 mmol/L of ethanone and KH₂PO₄ 0.5～5.0g/L，(NH₄)₂SO₄ 1.0～5.0g/L，NaCl 1.0～5.0g/L，MgSO₄·7H₂O1.0-4.0 g/L, water as solvent, and pH 6.0-8.0. And (3) diluting the enrichment culture solution for the last time, coating a plate culture medium, and performing multiple isolated culture to obtain a single colony strain. The plate culture medium consists of an enrichment culture medium and 15-20 g/L agar. Selecting a single colony strain, inoculating the single colony strain to a seed culture medium, culturing at 25-35 ℃ and 150-250 rpm for 1-2 days, taking a seed solution, transferring the seed solution to a fermentation culture medium by an inoculum size of 5-10% of volume concentration, culturing at 25-35 ℃ and 150-250 rpm for 1-2 days, and centrifuging a fermentation liquid to obtain wet thalli; with [3, 5-bis (trifluoromethyl) phenyl]Using ethyl ketone as a substrate, using a screened microbial cell (namely wet thallus after fermentation culture) as a catalyst, performing biotransformation in a phosphate buffer solution (pH value is 6.0-8.0) at 20-35 ℃ for 12-60 h, and detecting a target product (S) - [3, 5-bis (trifluoromethyl) phenyl group) in a transformation solution by adopting a chiral gas chromatography]The enantiomeric excess value (ee value) of the ethanol is screened to obtain a microbial strain with a high enantiomeric excess value (ee value > 99 percent), namely the microbial strain is recorded as a strain NQ 1;

(2) physiological and biochemical characteristics of strain NQ1 colony morphology: culturing for 48 hours on a slant culture medium at the temperature of 25-35 ℃, wherein the bacterial colony is irregular, has a moist, smooth and slightly raised surface, and is pink and glossy; cell morphology: the cells are in a shape of ellipsoid; physiological and biochemical characteristics: positive catalase, negative nitrate reduction, positive starch hydrolysis and negative esculin hydrolysis;

(3) the ITS (internal Transcribed space) gene sequence characteristic of the strain NQ1 is characterized in that a fungus genome DNA rapid extraction kit is used for extracting cell total DNA, the ITS gene of the strain NQ1 is amplified by using fungus universal primers by using the fungus genome DNA rapid extraction kit as a template, then 1% agarose gel electrophoresis is carried out on a PCR product, a single band appears at 600bp, and after the band is recovered and purified, sequencing (Erysia guangyo Biotech, Guangzhou) confirms that the ITS gene sequence of the strain NQ1 is SEQIDNO: 1, and the following components:

GTGGACGGGGTGTCTACTGATTTGAGATCTAATCTTAAAATGTAGACATTCTGATTAGAAGCTTCCTTTAACCCAACCCGGCTCTAATCCGAAGACTAGAATTCCTCAGCGAATAGTCTATTACGCCAAGTCAATCCGAAGTTCGATTGCGGATGCTAATGCATTACGAACGAGCTAGACCGTAAAGGCCAGCAGCGCTCAGAAACCAAACACCTCTTCAATCATTAAGAAAGAGGAGGGTTGAAGTATTCATGACACTCAAACAGGCATGCTCCACGGAATACCATGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGTTGAAAGTTTTATTTTGTTATAAAATTTAATACATTCATAGACTTTGTGTTTATAAGTGAATAGGAGTTCGCTCTCTTGCGAGAGTTACTATCCCAAACAAGTGCACAGGGTTAGAAAGTGAGAGTTCGGACTCCAAGTTAAGTTGGACGTCCTATATTCACTAATGATCCTTCCGCAGGTCACCTTACCGGAAGAGGAAC

the ITS gene sequence of strain NQ1 was compared for homology (BLAST) on the NCBI website (http:// www.ncbi.nlm.nih.gov), and the results showed that: the strain NQ1 has high sequence homology with part of strains of Rhodotorula sp. The NQ1 strain had 99% sequence homology with Rhodotorula mucoginosa isolate A7 strain (GenBank accession No. EU781664.1). According to the physiological and biochemical characteristics combined with the molecular biological identification, the strain NQ1 was identified as Rhodotorula mucilaginosa, named Rhodotorula mucilaginosa NQ 1.

The Rhodotorula mucilaginosa NQ1 is applied to the preparation of chiral alcohol, wherein the chiral alcohol is (S) - [3, 5-bis (trifluoromethyl) phenyl ] ethanol, and the specific application is as follows: taking [3, 5-bis (trifluoromethyl) phenyl ] ethanone as a substrate, taking wet thalli obtained by fermentation culture of Rhodotorula mucilaginosa (Rhodotorula mucor) NQ1 as an enzyme source, reacting at 20-35 ℃ in a reaction system consisting of buffer solution or distilled water with the pH of 6.0-8.5, centrifuging reaction liquid after the reaction is finished, taking supernate, adding equal volume of ethyl acetate or n-hexane into the supernate, extracting to obtain extract liquid which is mixed liquid containing a target product, and separating and purifying the mixed liquid to obtain (S) - [3, 5-bis (trifluoromethyl) phenyl ] ethanol.

Furthermore, the initial final concentration of the substrate is 10-200 mmol/L, preferably 40-120 mmol/L, and the dosage of wet thallus is 10-70 g/L, preferably 20-60 g/L based on the dry thallus weight.

Furthermore, the reaction temperature is preferably 25-35 ℃, and the reaction time is 12-72 hours, preferably 24-48 hours.

Further, the method for separating and purifying the mixed solution containing the target product comprises the following steps: and (3) distilling and concentrating the mixed solution by 6-9 times of volume by using a rotary evaporator, adding silica gel with the column volume of 2-6%, uniformly mixing, transferring to a silica gel-containing chromatographic column, adding silica gel with the column volume of 2-6%, performing silica gel column chromatography separation by using a petroleum ether-ethyl acetate mixed solution (the volume ratio of the petroleum ether to the ethyl acetate is preferably 8: 1) as an eluent, collecting and combining eluates containing a target product, and evaporating the eluates containing the target product by using the rotary evaporator to dryness to obtain the (S) - [3, 5-bis (trifluoromethyl) phenyl ] ethanol.

(S) - [3, 5-bis (trifluoromethyl) phenyl]Ethanol¹HNMR(600MHz,CDCl₃):7.85(s,2H),7.79(s,1H),5.06-5.03(q,1H,J＝6.48Hz),1.54(d,3H,J＝6.48Hz)。

Furthermore, in order to promote the regeneration of coenzyme and improve the reaction efficiency, an auxiliary substrate is added into the reaction system to form a conversion system, and the auxiliary substrate is selected from one of methanol, ethanol, isopropanol, glycerol, glucose, lactose, sucrose, maltose, xylose, ribose, galactose or trehalose; preferably one of glucose, lactose, sucrose or maltose; more preferably glucose, the final concentration of the added glucose is 10-200 g/L of the conversion system (preferably 35g/L), and the optical purity and the yield of the obtained product are highest.

When the cosubstrate is added, the application is carried out as follows: taking [3, 5-bis (trifluoromethyl) phenyl ] ethanone as a substrate, taking wet thalli obtained by fermentation culture of Rhodotorula mucilaginosa NQ1 as an enzyme source, adding an auxiliary substrate, reacting for 24-48 h at 25-35 ℃ in a conversion system consisting of buffer solution or distilled water with the pH of 6.0-8.5, centrifuging reaction liquid after the reaction is finished, taking supernate, adding equal-volume ethyl acetate or n-hexane into the supernate for extraction, wherein the extract is mixed liquid containing a target product, and separating and purifying the mixed liquid to obtain (S) - [3, 5-bis (trifluoromethyl) phenyl ] ethanol; in the transformation system, the initial final concentration of a substrate is 10-200 mmol/L, and the using amount of wet thalli is 20-60 g/L in terms of the dry weight of the thalli.

Further, the enzyme source is obtained by the following method:

(1) slant culture: selecting Rhodotorula mucilaginosa NQ1 single colony, inoculating to slant culture mediumCulturing at 25-35 ℃ for 2-3 days, and preserving in a refrigerator at 3-6 ℃; the final concentration composition of the slant culture medium is as follows: 10-25 g/L glucose, 5-20 g/L peptone, 3-15 g/L yeast extract, (NH)₄)₂SO₄1.0～5.0g/L，NaCl 1.0～5.0g/L，MgSO₄·7H₂1.0-4.0 g/L of O, 15-20 g/L of agar, water as a solvent and pH of 6.0-8.0;

(2) seed culture: selecting a ring of bacteria from a mature culture inclined plane, inoculating the bacteria into a seed culture medium, and culturing at 25-35 ℃ and 150-250 rpm for 24-48 h to obtain a seed solution; the final concentration of the seed culture medium is as follows: 10-25 g/L glucose, 3-15 g/L yeast extract and KH₂PO₄ 0.5～5.0g/L，(NH₄)₂SO₄1.0-5.0 g/L, 5-20 g/L peptone, 1.0-5.0 g/L NaCl, MgSO₄·7H₂O is 1.0-4.0 g/L, the solvent is water, and the pH value is 6.0-8.0;

(3) fermentation culture: transferring the seed solution into a fermentation culture medium by an inoculation amount with the volume concentration of 6-10%, culturing at 25-35 ℃ and 150-250 rpm for 24-48 h to obtain a fermentation liquid, centrifuging the fermentation liquid, washing the obtained precipitate with a buffer solution to obtain wet bacteria, namely an enzyme source; the formula of the fermentation medium is the same as that of the seed culture medium.

Further, the buffer is preferably phosphate buffer, more preferably Na₂HPO₄-citric acid, Na₂HPO₄-NaH₂PO₄、K₂HPO₄-KH₂PO₄、Na₂HPO₄-KH₂PO₄Or K₂HPO₄NaOH buffer solution, further preferably Na having a pH of 6.0 to 8.0₂HPO₄-NaH₂PO₄And (4) a buffer solution.

Further, the concentration of the product and unreacted substrate in the extract is analyzed by gas chromatography and quantified by an internal standard method, which specifically comprises the following steps: taking dodecane as an internal standard substance, taking 1ml of extract liquid, and adding 2 mul of dodecane into the extract liquid for analysis; the gas chromatography conditions were: japan Shimadzu GC-2014 gas chromatograph; walian CP-Chirasil-Dex chiral capillary gas chromatography column (25 m.times.0.25 mm. times.0.25 μm); the carrier gas is high-purity nitrogen, and the flow rate is 2 mL/min; the sample injection amount is 1 mu L, and the split ratio is 15: 1; the temperature of the detector and the injection port is 250 ℃; the temperature of the chromatographic column is 80-180 ℃; the temperature rising speed is 8 ℃/min; the detector is FID; according to the gas chromatography detection spectrogram, the concentration and the ee value of the product in the reaction solution are calculated by a relative correction factor method, and the yield calculation method is an internal standard method.

An internal standard method: and measuring a product concentration standard curve by using dodecane as an internal standard substance. During the determination, a certain amount of dodecane is added into a sample as an internal standard substance, and the concentration of a product is calculated according to the concentration of the internal standard substance. Preparation method of standard curve: accurately weighing a series of substrate or product standard substances with different concentrations, dissolving in ethyl acetate or n-hexane to obtain a series of mixed solutions, and detecting by gas chromatography respectively. Integrating the obtained chromatogram to obtain peak area, and comparing the peak area of the substrate or product with that of n-dodecane (S)_Substrate/S_DodecaneOr S_{Product of}/S_Dodecane) On the abscissa, the concentration ratio (C)_Substrate/C_DodecaneOr C_{Product of}/C_Dodecane) As an ordinate, a calibration curve was plotted, thereby obtaining a relative correction factor of 13.4 for 3, 5-bistrifluoromethylacetophenone and the internal standard, and a relative correction factor of 19.6 for 3, 5-bistrifluoromethylphenethyl alcohol and the internal standard. The product or substrate concentration can be calculated from the peak areas of the product or substrate and the internal standard dodecane. I.e. C_{Product of}＝19.6×S_{Product of}×C_Dodecane/S_Dodecane；C_Substrate＝13.4×S_Substrate×C_Dodecane/S_Dodecane

The yield and ee of the product were calculated as follows:

the yield was calculated as follows:

Y％＝C_P/C₀×100％

in the above formula C_pIs (S) - [3, 5-bis (trifluoromethyl) phenyl]Concentration of ethanol, C₀Is [3, 5-bis (trifluoromethyl) phenyl]Initial concentration of ethanone.

The optical purity of the product is characterized by enantiomeric excess (ee). The calculation formula is as follows:

ee＝(C_S-C_R)/(C_S+C_R)×100％

in the above formula C_SAnd C_RAre respectively S-type and R-type [3, 5-bis (trifluoromethyl) phenyl group]Molar concentration of ethanol.

The invention has the following beneficial effects:

the invention provides a new microbial strain, Rhodotorula mucilaginosa NQ1, which can be used for preparing chiral alcohol by asymmetric reduction, thereby providing beneficial reference in the aspect of preparing a key chiral intermediate (S) - [3, 5-bis (trifluoromethyl) phenyl ] ethanol of NK-1 receptor antagonist drugs by a microbiological method; the new strain is adopted to catalyze and prepare optically pure (S) - [3, 5-bis (trifluoromethyl) phenyl ] ethanol, and has the advantages of good stereoselectivity, high optical purity of the product and the like; the invention adopts wet thallus obtained by fermenting Rhodotorula mucilaginosa (Rhodotorula mucilaginosa) NQ1 as chiral biocatalysis of a catalyst, when the concentration of a substrate is 80mmol/L and the concentration of an auxiliary substrate is 35g/L, the reaction is carried out for 24 hours in a phosphate buffer solution with the pH value of 7.5 and the temperature of 30 ℃, the yield of a target product (S) - [3, 5-bis (trifluoromethyl) phenyl ] ethanol reaches 84.2 percent, and the ee reaches 99.5 percent.

Drawings

FIG. 1 is a gas chromatogram of a substrate [3, 5-bis (trifluoromethyl) phenyl ] ethanone standard and an internal standard dodecane.

FIG. 2 is a gas chromatogram of a product [3, 5-bis (trifluoromethyl) phenyl ] ethanol standard and an internal standard dodecane.

FIG. 3 is a gas chromatogram of Rhodotorula mucilaginosa (Rhodotorula mucor) NQ1 bioreduction reaction extract.

Detailed Description

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto.

Example 1

Obtaining of wet cells (1) slant culture: selecting Rhodotorula mucilaginosa (Rhodotorula mucilaginosa) NQ1 single colony, inoculating to slant culture medium, culturing at 30 deg.C for 3d, and storing in refrigerator at 4 deg.C; the final concentration composition of the slant culture medium is as follows: glucose 20g/L, peptone 10g/L, yeast extract 10g/L, (NH)₄)₂SO₄ 2.5g/L，NaCl 1.0g/L，MgSO₄·7H₂O1.0 g/L, agar 20g/L, water as solvent, pH 6.8; (2) seed culture: selecting a ring of thalli from a mature culture inclined plane, inoculating the selected ring of thalli into a seed culture medium, and culturing at 30 ℃ and 180rpm for 24 hours to obtain a seed solution; the final concentration of the seed culture medium is as follows: 25g/L glucose, 10g/L yeast extract and KH₂PO₄ 1.0g/L，(NH₄)₂SO₄3.0g/L, peptone 10g/L, NaCl 1.0g/L, MgSO₄·7H₂O1.0 g/L, water as solvent, pH 6.8; (3) fermentation culture: transferring the seed solution into a fermentation culture medium by an inoculation amount with the volume concentration of 8%, culturing at 30 ℃ and 180rpm for 48h to obtain a fermentation liquid, centrifuging the fermentation liquid, washing the obtained precipitate with a phosphate buffer solution to obtain wet bacteria, namely an enzyme source; the formula of the fermentation medium is the same as that of the seed culture medium.

Example 2

Gas phase detection analysis of the product: and centrifuging the reaction solution after the reaction is finished, and adding equal volume of ethyl acetate into the supernatant for extraction. The concentrations of the product and unreacted substrate in the extract were analyzed by gas chromatography and quantified by an internal standard method. The internal standard was dodecane. 1ml of the extract was analyzed by adding 2. mu.l of dodecane. Gas chromatography conditions: japan Shimadzu GC-2014 gas chromatograph; walian CP-Chirasil-Dex chiral capillary gas chromatography column (25 m. times.0.25 mm. times.0.25 μm) in USA. The carrier gas is high-purity nitrogen, and the flow rate is 2 mL/min; the sample injection amount is 1 mu L, and the split ratio is 15: 1; the temperature of the detector and the injection port is 250 ℃; the temperature of the chromatographic column is 80-180 ℃; the temperature rising speed is 8 ℃/min; the detector is FID. The peak time for each material was about: [3, 5-bis (trifluoromethyl) phenyl ] ethanone 3.657min, dodecane 7.365min, (S) - [3, 5-bis (trifluoromethyl) phenyl ] ethanol 8.398min, and (R) - [3, 5-bis (trifluoromethyl) phenyl ] ethanol 8.798 min. And (4) calculating the concentration and ee value of the product in the reaction solution by using a relative correction factor method according to a gas chromatography detection spectrogram. The yield calculation method is an internal standard method.

An internal standard method: and measuring a product concentration standard curve by using dodecane as an internal standard substance. During the determination, a certain amount of dodecane is added into a sample as an internal standard substance, and the concentration of a product is calculated according to the concentration of the internal standard substance. Standard of meritThe curve preparation method comprises the following steps: accurately weighing a series of substrate or product standard substances with different concentrations, dissolving in ethyl acetate or n-hexane to obtain a series of mixed solutions, and detecting by gas chromatography respectively. Integrating the obtained chromatogram to obtain peak area, and comparing the peak area of the substrate or product with that of n-dodecane (S)_Substrate/S_DodecaneOr S_{Product of}/S_Dodecane) On the abscissa, the concentration ratio (C)_Substrate/C_DodecaneOr C_{Product of}/C_Dodecane) To the ordinate, a standard curve was drawn to obtain [3, 5-bis (trifluoromethyl) phenyl group]The relative correction factor of the ethanone to the internal standard was 13.4, [3, 5-bis (trifluoromethyl) phenyl]The relative correction factor for ethanol to internal standard was 19.6. The product or substrate concentration can be calculated from the peak areas of the product or substrate and the internal standard dodecane. I.e. C_{Product of}＝19.6×S_{Product of}×C_Dodecane/S_Dodecane；C_Substrate＝13.4×S_Substrate×C_Dodecane/S_Dodecane

The yield and ee of the product were calculated as follows:

the yield was calculated as follows:

Y％＝C_P/C₀×100％

in the above formula C_pIs (S) - [3, 5-bis (trifluoromethyl) phenyl]Concentration of ethanol, C₀Is [3, 5-bis (trifluoromethyl) phenyl]Initial concentration of ethanone.

The optical purity of the product is characterized by enantiomeric excess (ee). The calculation formula is as follows:

ee＝(C_S-C_R)/(C_S+C_R)×100％

in the above formula C_SAnd C_RAre respectively S-type and R-type [3, 5-bis (trifluoromethyl) phenyl group]Molar concentration of ethanol.

Examples 3 to 15: the wet cells obtained in example 1 were suspended in 5mL of a phosphate buffer (Na)₂HPO₄-NaH₂PO₄Buffer, pH 8.0), the concentration of wet cells was 30g/L based on dry cell weight; adding [3, 5-bis (trifluoromethyl) phenyl ] with a final concentration of 40mmol/L]Using ethanone as a substrate, andadding various auxiliary substrates such as methanol, ethanol, isopropanol, glycerol, glucose, lactose, sucrose, maltose, xylose, ribose, galactose or trehalose (solid concentration of 50g/L and liquid concentration of 10%), and reacting in a shaker at 30 deg.C and 180rpm for 24 h. After the reaction was completed, the yield and ee value of the product were calculated according to the method of example 2. The product (S) - [3, 5-bis (trifluoromethyl) phenyl]The ethanol yield and ee value are shown in Table 1. As can be seen from Table 1, when the cosubstrate is glucose, the product (S) - [3, 5-bis (trifluoromethyl) phenyl]The yield of ethanol was highest at 86.7% and ee value at 94.1%.

TABLE 1 Effect of different co-substrate types on yield and ee value

Examples 16 to 26: the wet cells obtained in example 1 were suspended in 5mL of a phosphate buffer (Na)₂HPO₄-NaH₂PO₄Buffer, pH 8.0), the concentration of wet cells was 30g/L based on dry cell weight; adding [3, 5-bis (trifluoromethyl) phenyl ] with a final concentration of 40mmol/L]Adding glucose (such as 0, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100g/L) with different concentrations into acetone as substrate, and reacting in a shaker at 30 deg.C and 180rpm for 24 h. After the reaction was completed, the yield and ee value of the product were calculated according to the method of example 2. The product (S) - [3, 5-bis (trifluoromethyl) phenyl]The ethanol yield and ee value are shown in Table 2. As can be seen from Table 2, when the glucose concentration was 35g/L, the product (S) - [3, 5-bis (trifluoromethyl) phenyl group]The highest ethanol yield was 94.9%, and the ee value was 99.6%.

TABLE 2 influence of glucose concentration on yield and ee value

Examples 27 to 30: the wet cells obtained in example 1 were suspended in 5mL of a phosphate buffer (Na)₂HPO₄-NaH₂PO₄Buffer, pH 8.0), the concentration of wet cells was 30g/L based on dry cell weight; adding [3, 5-bis (trifluoromethyl) phenyl ] with a final concentration of 40mmol/L]Adding glucose with final concentration of 35g/L as auxiliary substrate, and adding [3, 5-bis (trifluoromethyl) phenyl with final concentration of 40mmol/L]The ethanone was used as substrate and then placed in a shaker at 180rpm at different temperatures (20, 25, 30, 35, 40 ℃) for 24 h. After the reaction was completed, the yield and ee value of the product were calculated according to the method of example 2. The product (S) - [3, 5-bis (trifluoromethyl) phenyl]The ethanol yield and ee value are shown in Table 3. As can be seen from Table 3, when the temperature was 30 ℃, the product (S) - [3, 5-bis (trifluoromethyl) phenyl group]The highest ethanol yield was 94.9%, and the ee value was 99.6%.

TABLE 3 influence of the reaction temperature on the yield and ee value

Examples 31 to 39: the wet cells obtained in example 1 were suspended in 5mL of different pH buffers (4.2, 5.0, 5.6, 6.0, 6.5, 6.8, 7.2, 7.5, 8.0, 8.5) at a concentration of 30g/L based on dry cell weight; adding glucose with the final concentration of 35g/L as an auxiliary substrate, adding [3, 5-bis (trifluoromethyl) phenyl ] ethanone with the final concentration of 40mmol/L as a substrate, and placing the mixture in a shaking table with the temperature of 30 ℃ and the rpm of 180 for reaction for 24 hours. After the reaction was completed, the yield and ee value of the product were calculated according to the method of example 2. The yield and ee value of the product (S) - [3, 5-bis (trifluoromethyl) phenyl ] ethanol are shown in Table 4. As can be seen from Table 4, the yield of the product (S) - [3, 5-bis (trifluoromethyl) phenyl ] ethanol was the highest at 99.3% and ee was 99.7% at a buffer pH of 7.5.

TABLE 4 influence of buffer pH on yield and ee value

Examples 40 to 46: the wet cells obtained in example 1 were suspended in 5mL of a phosphate buffer (Na)₂HPO₄-NaH₂PO₄Buffer, pH 7.5), the concentration of wet cells was 30g/L based on dry cell weight; adding glucose with final concentration of 35g/L as auxiliary substrate, and adding [3, 5-bis (trifluoromethyl) phenyl with different concentrations]The acetone (such as 10, 20, 40, 60, 80, 100, 150, 200mmol/L) is used as substrate, and is put into a shaker at 30 ℃ and 180rpm for reaction for 24 h. After the reaction was completed, the yield and ee value of the product were calculated according to the method of example 2. The product (S) - [3, 5-bis (trifluoromethyl) phenyl]The ethanol concentration, yield and ee value are shown in Table 5. As can be seen from Table 5, when [3, 5-bis (trifluoromethyl) phenyl group]When the concentration of the ethanone is 80mmol/L, the product (S) - [3, 5-bis (trifluoromethyl) phenyl]The highest concentration of ethanol was 67.4mmol/L, and the yield was 84.2% with an ee value of 99.5%.

TABLE 5 influence of [3, 5-bis (trifluoromethyl) phenyl ] ethanone substrate concentration on yield and ee value

Sequence listing

<110> Hunan university of science and technology

<120> Rhodotorula mucilaginosa NQ1 and application thereof in preparation of chiral alcohol

<130> 20180329

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 598

<212> DNA

<213> Rhodotorula mucilaginosa (Rhodotorula mucolignosa NQ1)

<400> 1

gtggacgggg tgtctactga tttgagatct aatcttaaaa tgtagacatt ctgattagaa 60

gcttccttta acccaacccg gctctaatcc gaagactaga attcctcagc gaatagtcta 120

ttacgccaag tcaatccgaa gttcgattgc ggatgctaat gcattacgaa cgagctagac 180

cgtaaaggcc agcagcgctc agaaaccaaa cacctcttca atcattaaga aagaggaggg 240

ttgaagtatt catgacactc aaacaggcat gctccacgga ataccatgga gcgcaaggtg 300

cgttcaaaga ttcgatgatt cactgaattc tgcaattcac attacttatc gcatttcgct 360

gcgttcttca tcgatgcgag agccaagaga tccgttgttg aaagttttat tttgttataa 420

aatttaatac attcatagac tttgtgttta taagtgaata ggagttcgct ctcttgcgag 480

agttactatc ccaaacaagt gcacagggtt agaaagtgag agttcggact ccaagttaag 540

ttggacgtcc tatattcact aatgatcctt ccgcaggtca ccttaccgga agaggaac 598

Claims (8)

1. Rhodotorula mucilaginosa NQ1 is characterized in that the Rhodotorula mucilaginosa is classified and named as (A)Rhodotorula mucilaginosa) NQ1, preserved in China center for type culture Collection with the preservation number of CCTCC NO: m2018001, preservation date of 2018, 1 month and 2 days.

2. The use of Rhodotorula mucilaginosa NQ1 as claimed in claim 1 in the preparation of chiral alcohol, wherein the chiral alcohol is (A)S) - [3, 5-bis (trifluoromethyl) phenyl group]And (3) ethanol.

3. The use of Rhodotorula mucilaginosa NQ1 in the preparation of chiral alcohol according to claim 2 is characterized in that the application method is: with [3, 5-bis (trifluoromethyl) phenyl]Using ethyl ketone as a substrate, using wet thalli obtained by fermenting and culturing rhodotorula mucilaginosa NQ1 as an enzyme source, reacting in a reaction system consisting of buffer solution or distilled water with the pH value of 6.0-8.5 at the temperature of 20-35 ℃, centrifuging reaction liquid after the reaction is finished, taking supernate, adding equal volume of ethyl acetate or n-hexane into the supernate for extraction, wherein the extract is mixed liquid containing a target product, and separating and purifying the mixed liquid to obtain (A), (B) and (C)S) - [3, 5-bis (trifluoromethyl) phenyl group]And (3) ethanol.

4. The application of Rhodotorula mucilaginosa NQ1 in preparing chiral alcohol according to claim 3, wherein the initial final concentration of the substrate is 10-200 mmol/L, and the usage amount of wet thallus is 10-70 g/L based on dry thallus weight.

5. The application of the Rhodotorula mucilaginosa NQ1 in the preparation of chiral alcohol according to claim 3 is characterized in that the reaction temperature is 25-35 ℃ and the reaction time is 12-72 h.

6. The application of Rhodotorula mucilaginosa NQ1 in the preparation of chiral alcohol according to claim 3, wherein the separation and purification method of the mixed solution containing the target product comprises: distilling and concentrating the mixed solution by 6-9 times of volume by using a rotary evaporator, adding silica gel with the column volume of 2-6%, uniformly mixing, transferring to a chromatographic column containing the silica gel, adding the silica gel with the column volume of 2-6%, performing silica gel column chromatography separation by using a petroleum ether-ethyl acetate mixed solution as an eluent, collecting and combining eluates containing a target product, and evaporating the eluates containing the target product by using the rotary evaporator to obtain (A), (B), (C) and (C)S) - [3, 5-bis (trifluoromethyl) phenyl group]And (3) ethanol.

7. The use of Rhodotorula mucilaginosa NQ1 in the preparation of chiral alcohol according to claim 3, further comprising adding an auxiliary substrate selected from one of methanol, ethanol, isopropanol, glycerol, glucose, lactose, sucrose, maltose, xylose, ribose, galactose or trehalose to the reaction system to form a conversion system.

8. Use of the Rhodotorula mucilaginosa NQ1 in the preparation of chiral alcohols according to any one of claims 3 to 7, characterized in that the enzyme source is obtained by the following method:

(1) slant culture: selecting Rhodotorula mucilaginosa (A)Rhodotorula mucilaginosa) Inoculating single NQ1 bacterial colony to a slant culture medium, culturing at 25-35 ℃ for 2-3 days, and storing in a refrigerator at 3-6 ℃; the final concentration composition of the slant culture medium is as follows: 10-25 g/L glucose, 5-20 g/L peptone, 3-15 g/L yeast extract, (NH)₄)₂SO₄ 1.0～5.0g/L， NaCl 1.0～5.0g/L，MgSO₄·7H₂1.0-4.0 g/L of O, 15-20 g/L of agar, water as a solvent and pH of 6.0-8.0;

(2) seed culture: selecting a ring of bacteria from a mature culture inclined plane, inoculating the bacteria into a seed culture medium, and culturing at 25-35 ℃ and 150-250 rpm for 24-48 h to obtain a seed solution; the final concentration of the seed culture medium is as follows: 10-25 g/L glucose, 3-15 g/L yeast extract and KH₂PO₄ 0.5～5.0g/L，(NH₄)₂SO₄1.0-5.0 g/L, 5-20 g/L peptone, 1.0-5.0 g/L NaCl, MgSO₄·7H₂O is 1.0-4.0 g/L, the solvent is water, and the pH value is 6.0-8.0;

(3) fermentation culture: transferring the seed solution into a fermentation culture medium by an inoculation amount with the volume concentration of 6-10%, culturing at 25-35 ℃ and 150-250 rpm for 24-48 h to obtain a fermentation liquid, centrifuging the fermentation liquid, washing the obtained precipitate with a buffer solution to obtain wet bacteria, namely an enzyme source; the formula of the fermentation medium is the same as that of the seed culture medium.

Images